BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2026. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Feb 21, 2026; 32(7): 115143
Published online Feb 21, 2026. doi: 10.3748/wjg.v32.i7.115143
Candida-mediated vertical transmission of Helicobacter pylori in C57BL/6J mice
Xiao-Li Xu, Ting-Ting Luo, Qi Liu, Department of Gastroenterology, The Affiliated Hospital of Guizhou Medical University, Guiyang 550004, Guizhou Province, China
Xiao-Li Xu, Ting-Ting Luo, Gu-Zhen Cui, Dao-Yan Wu, Xiao-Juan Wu, Ting-Xiu Yang, Jian-Chao Sun, Hui-Feng Jian, Zheng-Hong Chen, Guizhou Key Laboratory of Microbio and Infectious Disease Prevention and Control, Guizhou Medical University, Gui’an New Area 561113, Guizhou Province, China
Xiao-Li Xu, Ting-Ting Luo, Qi Liu, Guizhou Provincial Key Laboratory for Digestive System Diseases, Guizhou Medical University, Guiyang 550004, Guizhou Province, China
Shu-Wei Zhuo, Clinical Laboratory, Guangdong Provincial Hospital of Chinese Medicine Hainan Hospital, Haikou 570100, Hainan Province, China
ORCID number: Xiao-Li Xu (0000-0002-0474-3309); Zheng-Hong Chen (0000-0002-2944-6001).
Co-first authors: Xiao-Li Xu and Ting-Ting Luo.
Co-corresponding authors: Qi Liu and Zheng-Hong Chen.
Author contributions: Xu XL and Luo TT contributed equally, conducted the animal experiments, analyzed the results, and wrote the main manuscript text as co-first authors; Chen ZH conceived and designed the experiments, critically revised the manuscript; Liu Q assisted with data analysis; Chen ZH and Liu Q reviewed the manuscript; Cui GZ provided technical guidance; Wu XJ and Jian HF assisted with the breeding of animals; Liu Q, Wu DY, Yang TX, Sun JC, and Zhuo SW supplied the experimental strains; Yang TX and Sun JC verified these strains. All authors reviewed and approved the final manuscript.
Supported by National Natural Science Foundation of China, No. 82260402; Research Foundation of The Affiliated Hospital of Guizhou Medical University, No. GYFYMF002 and No. GYFYMF001; Central-Guided Local Science and Technology Projects of Guizhou Province, No. Qiankehe[2025]024; Guizhou Key Laboratory, No. ZDSYS[2023]004; Guizhou Provincial Key Laboratory for Digestive System Diseases, No. ZSYS[2025]021; Basic Research Program of Guizhou Science and Technology Plan, No. ZK[2022]341 and No. ZK[2022]368; and National Science Foundation of Hainan, No. 821QN0993.
Institutional review board statement: The isolation and use of clinical Candida strains were approved by the Ethics Committee of Guizhou Medical University, No. 2022-40 and No. 2021-141.
Institutional animal care and use committee statement: All procedures involving animals were reviewed and approved by the Animal Experimental Ethical Inspection of Guizhou Medical University, No. 2303009.
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: The datasets generated and/or analyzed during the current study are available in the National Center for Biotechnology Information GenBank with accession number OP796841.1, OP824698, OP850598, OP850582, and OQ733328 and Sequence Read Archive repository with the accession number PRJNA1221296, PRJNA1225572, PRJNA1221135, PRJNA1221297, PRJNA1225511, and PRJNA1221321.
Corresponding author: Zheng-Hong Chen, PhD, Professor, Guizhou Key Laboratory of Microbio and Infectious Disease Prevention and Control, Guizhou Medical University, No. 6 Ankang Avenue, Gui’an New Area 561113, Guizhou Province, China. chenzhenghong@gmc.edu.cn
Received: October 14, 2025
Revised: November 10, 2025
Accepted: December 16, 2025
Published online: February 21, 2026
Processing time: 119 Days and 21.5 Hours

Abstract
BACKGROUND

Although Helicobacter pylori (H. pylori) can cause a range of gastric diseases and affects approximately 50% of the global population, its routes of transmission have yet to be sufficiently clarified. In a preliminary study, we found that H. pylori can reside within the cells of Candida yeasts, with maternal Candida serving as a potential reservoir for the transmission of H. pylori to neonates during delivery.

AIM

To study the route of H. pylori transmission from mothers to offspring.

METHODS

We established vaginal and gastric infection models using female C57BL/6J mice infected with H. pylori 16S rDNA and urease A (ureA) genes-positive Candida. The successfully infective female mice were then mated with normal male mice until conception (classified vaginal and cesarean deliveries). The H. pylori infection status in female mice and their offspring was assessed using enzyme-linked immunosorbent assay, polymerase chain reaction, Candida isolation and culture, and histopathological examination.

RESULTS

The enzyme-linked immunosorbent assay results showed an increase in H. pylori-specific IgG and IgM serum antibodies in the H. pylori-positive Candida group maternal and offspring mice compared to the control and normal groups. H. pylori 16S rDNA or ureA genes was detected in samples from some of the maternal and offspring mice, including gastric mucosa, intestinal contents, vaginal tissue, placenta, and fetal membranes. In addition, H. pylori 16S rDNA- or ureA gene-positive Candida were successfully isolated from the tissues of some postpartum maternal and offspring mice. Moreover, histopathological examination revealed bleeding spots and inflammatory cell infiltration in the gastric mucosal tissues of some maternal mice and offspring in the H. pylori-positive Candida group.

CONCLUSION

In conclusion, H. pylori infection of newborns may be acquired through vertical transmission during childbirth, potentially originating from the mother’s Candida that has been internalized by H. pylori.

Key Words: Helicobacter pylori; Candida; Internalization; Reservoir; Vertical transmission

Core Tip: A comprehensive understanding of the familial pathway for Helicobacter pylori (H. pylori) transmission is essential for establishing effective infection prevention and control measures. However, the route through which this pathogen is transmitted remains unclear. Our preliminary findings had revealed that H. pylori can internalize within Candida cells, and that maternal vaginal colonization of Candida may serve as a potential route for transmission to neonates during childbirth. On the basis of animal experiments, we seek to confirm the transmission of H. pylori-positive Candida from maternal mice to their offspring during birth, potentially leading to H. pylori infection in the offspring.



INTRODUCTION

Helicobacter pylori (H. pylori), a microaerobic, spiral-shaped, gram-negative bacterium that inhabits the human stomach, produces a number of virulence factors, including cytotoxin-associated protein A (cagA), vacuolating cytotoxin, and urease A (ureA), and is considered the primary cause of chronic gastritis, peptic ulcers, and mucosa-associated lymphoid tissue lymphoma[1,2]. Furthermore, in 1994, the International Agency for Research on Cancer classified H. pylori as a class I carcinogen[3]. It is estimated that H. pylori infection affects approximately 50% of the global population[4]. and despite a decline in prevalence, the rate of H. pylori infection in China remains relatively high at 42.58%[5]. The Chinese Consensus Report on Family-Based Control and Management of H. pylori Infection (2021 Edition) highlighted that H. pylori infection is a significant health threat to families and society in China[6]. with approximately 25%-30% of infected individuals experiencing varying degrees of gastrointestinal diseases, and infection also being closely associated with certain extra-gastrointestinal conditions[6]. This consensus report highlights the key role of the intra-family transmission of H. pylori infection and introduced the concept of “family-based prevention and control of H. pylori infection”. However, further research is required to established the specific routes of transmission.

As determined based on an analysis of the H. pylori stool antigen (HpSA), the prevalence of H. pylori in newborns in the Southeastern region of Norway has been estimated at 52%[7], which is consistent with the 50% prevalence in the overall population[4]. Furthermore, in Chile, it has been found that from birth to 3 years of age, one-third of children tested positive for at least one HpSA, with 20% of infants experiencing persistent infection[8]. In our previous study, 33.7% (30/89) of assessed mothers and 40.4% (36/89) of their newborns tested positive for H. pylori HpSA[9], thereby providing evidence indicating that H. pylori infections may occur during early childhood, with the mother probably serving as the primary source of infection. In addition, studies that have investigated H. pylori infection in mothers and offspring using multi-locus sequence typing and random amplified polymorphic DNA (RAPD) fingerprinting techniques have provided further evidence supporting the mother-to-child transmission of this bacterium[10,11].

Certain types of microorganism, including bacteria and fungi, can be transmitted vertically from the mother to newborn during pregnancy, childbirth, and lactation, thereby contributing to microbial colonization of the skin, oral cavity, and gastrointestinal tract of offspring[12-14]. Such infections have been detected in fecal samples obtained from neonates delivered vaginally or via cesarean section using quantitative real-time polymerase chain reaction (PCR) and 16S and 18S rRNA gene amplicon sequencing[15]. In addition, some studies have reported the presence of microorganisms in the placenta and amniotic fluid[16,17]. Moreover, species of the yeast Candida have been identified as the predominant fungi invading the amniotic cavity[18], and have been detected in amniotic fluid via culture and amplicon sequencing[19].

Candida, which comprises approximately 200 species, inhabit the human gastrointestinal tract, vagina, and skin, and can be transmitted vertically from mothers to offspring[9,20-22]. In early 2005, Siavoshi et al[23] reported the presence of bacterial-like bodies in oral yeast and confirmed the detection of H. pylori 16S rDNA and cagA genes within these yeasts using PCR. Subsequent studies have reported the intracellular occurrence of H. pylori within Candida cells[20,24-28]. Chen et al[29] highlighted that fungi are commonly found on the skin and internal organs of the human body and demonstrated cross-kingdom interactions with bacteria, whereas Sánchez-Alonzo et al[30] identified a virulence-associated genotype of H. pylori in vaginal yeast using PCR. Moreover, in our previous studies[9,31], we have detected H. pylori 16S rDNA, the ureA, and cagA genes, and H. pylori antigens within Candida cells. In addition, there is evidence to indicate that H. pylori may be harbored within Candida colonizing the vagina, and oral or fecal Candida derived from neonates have been shown to be genetically related to vaginal Candida isolated from the mother[9,20]. H. pylori-specific genes and antigens can be detected in Candida cells, and these H. pylori-positive Candida have been demonstrated to have urease activity[32]. Furthermore, intracellular H. pylori released from yeast as membrane-bound or free bacterial cells can be isolated using an immunomagnetic separation assay and have been visualized using scanning electron microscopy[33]. Collectively, these findings provide evidence to indicate that maternal Candida may serve as a “Trojan horse”, providing a conduit for the transmission of potentially infectious H. pylori to neonates. In this study, we established female mouse models of vaginal and gastric Candida infections with a view toward characterizing the Candida-mediated transmission of H. pylori from maternal mice to their offspring during vaginal delivery or cesarean section.

MATERIALS AND METHODS
Candida and H. pylori strains used for mice models

The H. pylori strain used in this study was generously provided by Wu DY (Guizhou Medical University)[34]. As yeast strains, we used Candida albicans (C. albicans) ATCC 10231 (Ca10231), and four clinical Candida strains (the vaginal isolates J115 and H100, gastric isolate W49, and fecal isolate F67). In addition, we used a laboratory modified strain of C. albicans that harbors H. pylori (16S rDNA and ureA genes positive), designated Ca-co-Hp. The Ca10231, J115 and H100 isolates were kindly provided by Yang TX (Guizhou Medical University)[31]. F67 was isolated from a stool sample of a volunteer using Sabouraud dextrose agar (SDA; Basebio, HangZhou, China) supplemented with 100 μg/mL chloramphenicol (Solarbio, Beijing, China)[9]. which was also used to isolate W49 from a gastric mucosal sample of a patient with gastric carcinoma. To eliminate any potential bacterial contamination, the Candida isolates were passaged on chloramphenicol-supplemented SDA for five generations. Ca-co-Hp was obtained by co-culturing H. pylori and Ca10231 followed by passaging for five generations on SDA supplemented with 100 μg/100 mL chloramphenicol[32]. H. pylori was cultured on a Columbia Agar base (Hopebio, Qingdao, China) supplemented with 7% (v/v) defibrinated sheep blood (Jushibio, Henan, China) and incubated at 37 °C in a 10% CO2 environment for 48 hours. The Candida strains were subsequently revived on SDA supplemented with 100 μg/100 mL chloramphenicol under aerobic condition at 37 °C for 48 hours. Identification of Candida harboring H. pylori was performed based on gram staining and internal transcribed spacer (ITS) sequencing. Intracellular H. pylori within Candida was identified using a nested PCR to amplify the 16S rDNA and ureA genes[35,36]. Identify Candida species by amplifying the ITS sequence[37]. DNA was extracted from Candida strains and H. pylori using an automated nucleic acid extraction device in conjunction with a Daan nucleic acid extraction and purification kit (Guangzhou Daan Gene Co., Ltd, Guangzhou, China). Nested PCR of H. pylori 16S rDNA and ureA genes was performed using 2-μL reaction mixtures containing a 2 × Hieff® PCR Master Mix (Yeasen Biotechnology, Shanghai Co., Ltd, Shanghai, China), primers (10 μM; Sangon Biotech Co., Ltd, Shanghai, China), sterile deionized water, and genomic DNA. Table 1 lists the primers used and the amplification procedure. The resulting amplicons underwent Sanger sequencing at Sangon Biotech, and genomic alignment was conducted using basic local alignment search tool (BLAST). In addition, to assess urease activity, H. pylori-positive Candida were inoculated onto SDA-urea medium containing sterile 0.01% phenol red and 5% urea solution and incubated under aerobic conditions at 37 °C. A change in the color of the SDA-urea from yellow to red indicates urease activity, which is interpreted to be associated with the urease produced by H. pylori internalized within the Candida cells. H. pylori were also inoculated on SDA-urea to serve as a positive control and to verify the appropriate preparation of the medium.

Table 1 Primers used to detect Helicobacter pylori and Candida strains.
Gene
Sequence
Polymerase chain reaction product size (bp)
Procedure
Ref.
16S rDNAHeliS: AAGAACCTTACCTAGGCTTGACATTG49794 °C 3 minutes; 37 cycles at 94 °C 45 seconds, 57 °C 60 seconds, 72 °C 60 seconds; 72 °C 5 minutes[35]
HeliN: GCTAAGAGATCAGCCTATGTCC
Hpup: TGAGAGAATCCGCTAGAAATAGTGG45494 °C 3 minutes; 25 cycles at 94 °C 45 seconds, 57 °C 1 minutes, 72 °C 1 minutes; 72 °C 5 minutes
Hpdown: TAGCATCCTGACTTAAGGCAAACA
ureAPylF: CCAGATGATGTGATGGATGG60794 °C 3 minutes; 25 cycles at 94 °C 45 seconds; 50 °C 45 seconds, 72 °C 3 minutes; 72 °C 5 minutes[36]
PylR: TCAAGTCTGTATCGCCCAATC
HpU1: GCCAATGGTAAATTAGTT41194 °C 3 minutes; 34 cycles at 94 °C 45 seconds, 45 °C 45 seconds, 72 °C 45 seconds; 72 °C 5 minutes
HpU2: CTCCTTAATTGTTTTTAC
ITSITS1: TCCGTAGGTGAACCTGCGG500-80094 °C 5 minutes; 35 cycles at 94 °C 1 minutes; 60 °C 30 seconds; 72 °C 1 minutes; 72 °C 10 minutes[37]
ITS4: TCCTCCGCTTATTGATATGC
C57BL/6J female mice model infected with H. pylori-positive Candida

The animal experiments performed in this study were approved by the Ethics Review Committee of Animal Experiments at Guizhou Medical University, No. 2303009. Four-week-old specific pathogen-free female and male C57BL/6J and ICR mice were obtained from Guizhu Huijiu Biotechnology Co., Ltd. The animal experimental protocol was designed to minimize pain or discomfort to the animals. Both female and male mice were acclimatized to laboratory conditions (22 ± 2 °C, 12 hours/12 hours light/dark, 50% ± 10% humidity, for 1 week prior to experimentation, during which time, they had ad libitum access to food and water. Vaginal inoculation and intragastric gavage administration was carried out with conscious animals, using a straight vaginal injection pipette tip (100 μL) and gavage needles (15-18 g body weight: 22-gauge, 25 mm length, 1.25 mm ball diameter) appropriate for the size of the experimental animals. Prior to tissue collection, all mice were anesthetized to unconsciousness using 2%-2.5% isoflurane inhalation. Mice in the experimental, control, and normal groups were respectively housed in independent breeding rooms to prevent cross-infection. During the adaptation period, fecal and vaginal discharge samples were collected from 20 randomly selected female mice (10 C57BL/6J and 10 ICR mice), and feces were collected from 10 randomly selected male mice (5 C57BL/6J and 5 ICR mice). These samples were used to isolate and culture Candida species, along with the detection of H. pylori in mice feces using nested PCR, to rule out potential infections by H. pylori or Candida. Table 2 shows the grouping of the mice.

Table 2 Grouping of mice models.
Models
Groups
Groups number
Strains for modeling
Model of vaginal infection caused by CandidaExperimental groupV1 (n = 10)J115
V2 (n = 10)H100
V3 (n = 10)Ca-co-Hp
Control groupVC (n = 8)Ca10231
Normal groupVN1 (n = 8)
Model of gastric infection with CandidaExperimental groupG12 (n = 10)Helicobacter pylori and Ca10231
G2 (n = 10)W49
G3 (n = 10)F67
G4 (n = 10)Ca-co-Hp
Control groupGC (n = 8)Ca10231
Normal groupGN3 (n = 8)
Modeling of Candida vaginal infection in mice

A Candida vaginal infection model was established as previously described by Yano et al[38]. Six days prior to vaginal inoculation with Candida, mice were administered a 0.1 mL subcutaneous injection of 2 mg/mL estradiol benzoate solution, which was repeated 2 days later. Subsequently, daily intravaginal inoculation of 20 μL of a Candida suspension [5 McFarland standard, 1.5 × 109 colony-forming unit (CFU)/Ml] was administered for seven consecutive days. Groups V1, V2, and V3 were intravaginally inoculated with J115, H100, and Ca-co-Hp, respectively. Group VC was intravaginally inoculated with Ca10231, whereas group VN received saline solution.

The successful modeling of vaginal Candida infection was confirmed by the presence of at least two of the following indicators: (1) Clinical symptoms displayed by female mice, including vaginal congestion, edema, and erosion, and an increase in vaginal secretion; (2) Gram staining and microscopic observation of Candida in vaginal secretion samples, revealing numerous epithelial cells, Candida spores and hyphae; and (3) Detection of Candida CFUs. On day 8 after infection, samples of vaginal discharge were collected from female mice, and Candida colonies were counted as described by Yano et al[38]. Candida colonization was considered successful if the colony count exceeded 1 × 103 CFU/10 μL. Subsequently, the presence of H. pylori within Candida cells was confirmed by performing nested PCR amplification of the H. pylori ureA gene, and urease activity was detected using a urea medium culture test.

Modeling of Candida or H. pylori gastric infection in mice

In this experiment, we modeled mice to determine whether H. pylori administered via gavage can migrate from the gastrointestinal tract to the vagina and thereafter internalize within Candida cells colonizing the vagina. Prior to undergoing gavage, all treated mice were initially fasted for 8 hours. Mice in group G1 initially received 0.3 mL of a NaHCO3 (0.1 mol/L) solution via gastric lavage, followed by H. pylori gastric gavage after 30 minutes, and were then inoculated intravaginally with the Candida Ca10231 strain. This procedure was repeated a further 12 times at 2-day intervals.

Mice in the G2, G3, G4, and GC groups were administered 0.3 mL suspensions (5 McFarland standard) of the Candida strains W49, F67, Ca-co-Hp, and Ca10231, respectively, via gavage, whereas those in group GN were administered saline solution via the same route. This procedure was subsequently repeated a further 12 times at 2-day intervals. Fecal samples were collected from the G1, G2, G3, G4, and GC mice, and vaginal discharge was collected from those in group G1. These samples were inoculated into SDA medium and incubated at 37 °C for 48 hours. Successful modeling of gastric Candida infection involved isolation and cultivation of yeast from the feces of mice. For the G1 group, it was necessary to detect Candida colonization in the vagina, and this was considered successful if the quantity of Candida cells in the vaginal discharge exceeded 1 × 103 CFU/10 μL. Candida strains isolated from fecal samples were analyzed for the presence of the H. pylori ureA gene and urease activity.

Conception and parturition of maternal mice and nursing of offspring mice

Maternal mice infected with Candida were mated with age-comparable healthy male mice until pregnancy. Pregnant mice were housed separately and divided into two groups, the natural delivery and the cesarean section groups. Pregnant mice scheduled for cesarean section were anesthetized by inhalation of 2%-2.5% isoflurane until unconscious, after which they were euthanized via cervical dislocation, and blood was rapidly collected via orbital puncture. Within 10 minutes, offspring mice were delivered by the cesarean section. All newborn mice were immediately separated from their mothers after delivery and thereafter allotted to healthy maternal ICR mice, which had given birth 1 week previously and were selected as nurse mothers to ensure lactation until the newborns had reached 3 or 6 weeks of age.

Detection of H. pylori infection in maternal mice and their offspring

Sample collection: Prior to sampling, all mice were anesthetized to unconsciousness using 2%-2.5% isoflurane inhalation[39]. Blood was rapidly collected via orbital puncture, followed by euthanasia by cervical dislocation whilst the mice remained under anesthesia. The offspring mice were categorized into three groups based on age (0, 3, and 6 weeks). With the exception of 0-week-old mice, for which blood samples were not collected, blood, gastric mucosal, and intestinal contents and tissues were collected from C57BL/6J maternal mice and their offspring. In addition, we obtained vaginal tissues from maternal mice, as well as placentas and fetal membranes from cesarean section-delivered offspring.

Detection of H. pylori antibodies in serum: Blood samples from mothers and offspring were naturally coagulated for 10-20 minutes, followed by centrifugation at 1000 × g for 15 minutes to separate the serum, which was then stored at -20 °C. H. pylori IgG in serum was quantitated using a mouse Hp-IgG-Ab enzyme-linked immunosorbent assay kit (ml057759; Shanghai Enzyme-linked Biotechnology Co., Ltd, Shanghai, China). Qualitative detection of H. pylori IgM in the serum of the offspring was conducted using a mouse Hp-IgM-Ab enzyme-linked immunosorbent assay kit (ml024722B; Shanghai Enzyme-linked Biotechnology, Shanghai, China). Following the manufacturer’s instructions for this kit, the cutoff value was determined by measuring the optical density (OD450) of the negative control provided in the kit and adding a value of 0.25 to the result. Serum samples with OD450 values below the cutoff were considered negative, whereas those with values exceeding the cutoff were considered positive.

Detection of H. pylori 16S rDNA and ureA genes in tissue samples of mice: Tissue samples were homogenized and the extracted DNA was subsequently subjected to nested PCR amplification targeting the H. pylori 16S rDNA and the ureA genes. Amplicons were sequenced by Sangon Biotech, and genomic alignment was conducted using BLAST. Isolation of Candida in samples of postpartum maternal mice and offspring, and detection of H. pylori genes within Candida isolates.

Following parturition in the maternal mice, Candida were isolated from gastric mucosal samples, intestinal contents, and vaginal tissues from maternal mice and gastric mucosal samples, intestinal contents (or intestinal tissues of 0-week-old offspring mice) from their offspring at 0, 3, and 6 weeks of age, along with placentas and fetal membranes from cesarean section-delivered offspring mice. The isolated Candida strains were subsequently cultured, and DNA extracted from these strains was subjected to nested PCR for the identification of H. pylori 16S rDNA and ureA genes (Table 1).

Histopathological examination of gastric mucosa and vaginal tissue: The gastric mucosa of maternal and offspring in groups V1, V2, V3, VC, and VN and G1, G2, G3, G4, GC, and GN were fixed in 4% paraformaldehyde for histopathological analysis. According to the pathological diagnostic criteria for chronic gastritis[40], pathological scores were determined based on the density and depth of inflammatory cell infiltration within the mucosal layer, with a particular emphasis on density as the primary indicator. The degree of inflammation was quantified using the following scoring system: 1 = no inflammatory cell infiltration in the mucosal layer or less than five mononuclear cells per field of view; 2 = minimal infiltration, with few inflammatory cells confined to the superficial layer of the mucosa, not exceeding one-third of the mucosal layer; 3 = moderate infiltration with a dense accumulation of inflammatory cells, exceeding one-third but not reaching two-thirds of the mucosal layer; and 4 = extensive infiltration with abundant inflammatory cells extending across the entire mucosal layer.

Statistical analysis

Data were analyzed using GraphPad Prism 9.5.0, which was used for graph plotting, descriptive statistics, and one-way ANOVA to assess serum indicators among the different groups of mice. The Tukey test was used for intergroup multiple comparisons. The results are presented as the mean ± SD. A P value < 0.05 was considered statistically significant. The statistical methods of the present study were reviewed by Lu Y from Department of Statistics Teaching and Research, Guizhou Medical University.

RESULTS
Confirmation of Candida and H. pylori strains used for establishing mice models

The six Candida strains used for modeling were gram-positive yeast cells identified as C. albicans (J115, Ca-co-Hp and Ca10231), Candida tropicalis (H100), Candida glabrata (W49), and Candida guilliermondii (F67) based on ITS sequencing (Table 3). Cells of the H. pylori strain was characterized by a typical gram-negative spiral shape with a “C” or “S” morphology. Candida strains J115, H100, W49, F67, and Ca-co-Hp were positive for H. pylori 16S rDNA and ureA genes, as identified by performing nested PCR (Figure 1A, Supplementary Figure 1). The sequences of all amplified products were established to have the highest similarity with that of H. pylori, ranging from 97% to 100%. In contrast, the control strain, Ca10231, was negative for both H. pylori 16S rDNA and ureA genes.

Figure 1
Figure 1 Nested polymerase chain reaction amplification of Helicobacter pylori-specific genes. A: Identification of the strains used for modeling. a: Helicobacter pylori (H. pylori) 16S rDNA; b: H. pylori ureA gene; lane M: DL2000 marker; lane 1: Candida W49; lane 2: Candida F67; lane 3: Candida Ca-co-Hp; lane 4: Candida J115; lane 5: Candida H100; lane B: Blank control (ddH2O); lane N: Negative control (Ca10231); lane P: Positive control (H. pylori). Candida strains J115, H100, W49, F67, and Ca-co-Hp tested positive for H. pylori 16S rDNA and ureA genes, whereas the Ca10231 strain tested negative; B: Identification of H. pylori ureA gene in vaginal Candida isolates obtained from maternal mice. Lane M: DL2000 marker; lanes 1-10: Ten mice in each group; lane B: Blank control (ddH2O); lane N: Negative control (Ca10231); lane P: Positive control (H. pylori). Groups V1-V3 mice intravaginally inoculated with J115, H100, or Ca-co-Hp. Group VC was intravaginally inoculated with Ca10231. Group VN received saline solution.
Table 3 Candida strains used in the establishment of animal models.
StrainsCandida speciesITS GenBank ID
SRA accession code
Hp 16S rDNA
Hp ureA
Hp negative CandidaCa10231Candida albicansOP796841.1--
Hp 16S rDNA and ureA genes positive CandidaJ115Candida albicansOP824698PRJNA1221296PRJNA1221135
H100Candida tropicalisOP850598PRJNA1225572
W49Candida glabrataOP850582
F67Candida guilliermondiiOQ733328
Ca-co-HpCandida albicansPV110845

In the urease activity test, H. pylori were inoculated onto SDA medium containing with urea, the color of which subsequently changed from yellow to red, indicating that this medium was effective in detecting urease activity. When inoculated with the strains J115, H100, W49, F67, and Ca-co-Hp, the color of the SDA-urea agar turned from yellow to red after culturing for 30, 26, 30, 7, and 7 days, respectively, thus identifying these strains as urease positive. However, although a large bacterial lawn developed on SDA-urea 24 hours after inoculation with the Ca10231 strain, the color of the culture medium had still not turn red until day 35, and was accordingly designated urease negative.

Candida or H. pylori-positive Candida colonized the gastric mucosa and vagina of female mice following modeling

Candida isolates and H. pylori were absent in mice prior to modeling: Prior to modeling, we failed to obtain any Candida isolates from the feces of selected female and male mice, or from the vaginal discharge of female mice. Similarly, as confirmed by nested PCR, neither H. pylori 16S rDNA nor ureA genes was detected in the fecal samples obtained from 20 female mice (10 C57BL/6J and 10 ICR mice) or 10 male mice (5 C57BL/6J and 5 ICR mice).

Diagnosis of vaginal infection in mice with Candida or H. pylori ureA gene-positive Candida: After 7 days of vaginal inoculation with Candida, with the exception of the VN group mice, those in all the other assessed groups (V1, V2, V3, and VC) were characterized by vaginal congestion and elevated levels of vaginal discharge. In addition, microscopic observations clearly revealed large numbers of exfoliated vaginal epithelial cells and Candida spores in vaginal lavage samples. Candida strains were isolated from the vaginal discharge of mice in groups V1, V2, V3, and VC, with colony counts exceeding 1 × 103 CFU/10 μL. In contrast, we detected no evidence of vaginal congestion or Candida colonization among mice in the VN group.

The Candida strains isolated from the vaginal lavage samples obtained from group V1, V2, and V3 mice were established to be urease-positive, as confirmed using the SDA-urea culture test, whereas strains isolated from mice in group VC were urease-negative. Nested PCR analysis revealed that 80% (8/10), 60% (6/10), and 70% (7/10) of vaginal Candida isolates derived from the mice in groups V1, V2, and V3, respectively, were positive for ureA gene, whereas all Candida strains isolated from group VC mice tested negative (Figure 1B, Supplementary Figure 1). For the purposes of sequencing, we selected PCR products obtained from nine of the ureA gene-positive samples, with BLAST analysis revealing 97% to 99% identity with H. pylori sequences. These datasets have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) repository (accession number: PRJNA1221297).

Diagnosis of gastric infection in mice with Candida or H. pylori ureA gene-positive Candida: Following modeling with H. pylori and Candida, Candida strains were isolated from the fecal samples of all mice in groups G1, G2, G3, G4, and GC, and were also isolated from the vaginal discharge of mice in group G1, with all colony counts exceeding 1 × 103 CFU/10 μL. These Candida strains tested positive for urease, as confirmed by performing SDA-urea culture tests, whereas strains isolated from group VC mice were negative. On the basis of nested PCR analysis, we established that among fecal Candida isolates obtained from mice in groups G1, G2, G3, and G4, prevalences of the ureA gene were 50% (5/10), 60% (6/10), 60% (6/10), and 70% (7/10), respectively. In addition, 60% (6/10) of vaginal Candida isolates obtained from group G1 mice tested positive for this gene, whereas in contrast, all strains isolated from group GC mice tested negative (Figure 2, Supplementary Figure 1). For sequencing, we selected the PCR products of eight ureA gene-positive samples, with BLAST analysis revealing 97% to 99% identity with H. pylori sequences. These datasets have likewise been deposited in the NCBI SRA repository (accession number: PRJNA1221297).

Figure 2
Figure 2 Nested polymerase chain reaction amplification of Helicobacter pylori ureA gene. A: Fecal and vaginal Candida isolated from group G1 mice; B: Fecal Candida isolated from group G2, G3, G4, and GN mice. Lane M: DL2000 marker; lanes 1-10: The 10 mice in each group; lane B: Blank control (ddH2O); lane N: Negative control (Ca10231); lane P: Positive control (Helicobacter pylori). G1-G: Fecal Candida from group G1 mice. G1-V: Vaginal Candida from group G1 mice. Group G1 mice were infected with Helicobacter pylori via gavage and Candida Ca10231 was inoculated intravaginally. Mice in groups G2, G3, G4, and GC were infected with Candida strains W49, F67, Ca-co-Hp, and Ca10231 via gavage, respectively. Group GN mice received saline solution via gavage.
H. pylori-specific antibodies in the serum of model mice and their offspring

The levels of H. pylori IgG in sera collected from both maternal mice and their offspring in groups V1, V2, and V3, in which the maternal mice had been vaginally infected with Candida, were found to be significantly higher than those in the VC and VN group mice (P < 0.05). However, we detected no significant differences between the VC and VN group maternal mice and 3- and 6-week-old offspring mice with respect to H. pylori IgG levels (Figure 3A, Supplementary Table 1). With regards to IgM detection, the OD450 values obtained for the negative control provided with the test kit ranged from 0.076 to 0.105, with the cutoff set between 0.326 and 0.355. The levels of H. pylori IgM in the sera of all offspring mice in groups V1, V2, and V3 were found to exceed the cutoff, whereas those in the VC and VN groups remained below the cutoff (Figure 3A, Supplementary Table 2).

Figure 3
Figure 3 Helicobacter pylori IgG and IgM antibodies in mice sera. A: A model of vaginal infection; B: A model of gastric infection. V1: Vagina infected with Candida J115; V2: Vagina infected with Candida H100; V3: Vagina infected with Candida Ca-co-Hp; VC: Vagina infected with Candida Ca10231; VN: Vagina treated with saline solution. G1: Mice with gastric infection with Helicobacter pylori (H. pylori) and vagina infected with Candida Ca10231; G2: Mice infected with Candida W49; G3: Mice infected with Candida F67; G4: Mice infected with Candida Ca-co-Hp; GC: Mice infected with Ca10231; GN: Gavage saline solution. Candida strains J115, H100, W49, F67, and Ca-co-Hp were positive for H. pylori 16S rDNA and ureA genes. The control Candida Ca10231 strain was negative for H. pylori 16S rDNA and ureA genes. Results are presented as the mean ± SD (n = 4), with P values calculated using ANOVA. Different letters denote significant differences.

For both maternal mice and their offspring in groups G1, G2, G3, and G4, in which the maternal mice had been infected with H. pylori and Candida via gavage, the serum levels of H. pylori IgG were found to be significantly higher compared with those in the GC and GN group mice (P < 0.05). Comparatively, we detected no significant differences between maternal mice and 3- and 6-week-old offspring mice in the GC and GN groups with respect to H. pylori IgG levels (Figure 3B; Supplementary Table 1). Regarding IgM detection, we obtained OD450 values ranging from 0.07 to 0.1 for the negative control provided with the test kit, with the cutoff set between 0.32 and 0.35. H. pylori IgM levels in the sera of all offspring mice in groups G1, G2, G3, and G4 exceeded the cutoff, whereas levels in the sera of GC and GN group mice were below the cutoff (Figure 3B, Supplementary Table 1). In groups G3 and G4, the IgM levels in three of four mice exceeded the cutoff, with values for the remaining mouse in each group falling below the cutoff. In contrast, IgM levels in all mice in the GC and GN groups were below the cutoff value (Figure 3B, Supplementary Table 2).

H. pylori 16S rDNA or ureA genes in maternal mice and their offspring

Tables 4 and 5 present the nested PCR results for the H. pylori 16S rDNA and ureA genes in gastric mucosa, intestinal contents, and vaginal tissue samples obtained from maternal mice, and in gastric mucosa, intestinal contents, and tissue samples obtained from offspring mice. Notably, all samples obtained from mice in the VN, VC, GN, and GC groups yielded negative results, whereas a proportion of samples obtained from animals in the V1, V2, V3, G1, G2, G3, and G4 groups tested positive. For sequence verification, we selected the PCR products of 29 H. pylori 16S rDNA-positive and 48 ureA-positive samples, BLAST analyses of which revealed a 97% to 99% identity with H. pylori sequences. These datasets have been deposited in the NCBI SRA repository, (accession numbers: PRJNA1225511 and PRJNA1221321).

Table 4 Rates of positive detection for the Helicobacter pylori 16S rDNA or urease A genes in maternal mice, n (%).
GroupNumber of examined mice
Gastric mucosa samples
Intestinal contents
Vaginal tissues
Hp 16S rDNA positive samples
Hp ureA positive samples
Hp 16S rDNA positive samples
Hp ureA positive samples
Hp 16S rDNA positive samples
Hp ureA positive samples
Modeling of vaginal infection with Candida1V183 (37.5)2 (25.0)3 (37.5)1 (12.5)3 (37.5)0 (0)
V2100 (0)1 (10.0)2 (20.0)0 (0)1 (10.0)0 (0)
V3103 (30.0)1 (10.0)3 (30.0)1 (10.0)0 (0)4 (40.0)
VC60 (0)0 (0)0 (0)0 (0)0 (0)0 (0)
VN80 (0)0 (0)0 (0)0 (0)0 (0)0 (0)
Modeling of gastric infection with Candida2G194 (44.4)0 (0)3 (33.3)0 (0)1 (11.1)2 (22.2)
G284 (50.0)0 (0)4 (50.0)0 (0)2 (25.0)1 (12.5)
G382 (25.0)1 (12.5)3 (37.5)1 (12.5)0 (0)0 (0)
G483 (37.5)0 (0)3 (37.5)0 (0)2 (25.0)1 (12.5)
GC80 (0)0 (0)0 (0)0 (0)0 (0)0 (0)
GN80 (0)0 (0)0 (0)0 (0)0 (0)0 (0)
Table 5 Rates of positive detection for the Helicobacter pylori 16S rDNA or urease A genes in offspring mice, n (%).
GroupNumber of examined mice
Gastric mucosa samples1
Intestinal tissues1
Number of examined mice
Gastric mucosa samples2
Intestinal contents2
Number of examined mice
Gastric mucosa samples3
Intestinal contents3
Hp 16S rDNA positive samples
Hp ureA positive samples
Hp 16S rDNA positive samples
Hp ureA positive samples
Hp 16S rDNA positive samples
Hp ureA positive samples
Hp 16S rDNA positive samples
Hp ureA positive samples
Hp 16S rDNA positive samples
Hp ureA positive samples
Hp 16S rDNA positive samples
Hp ureA positive samples
Modeling of vaginal infection with CandidaV183 (37.5)1 (12.5)5 (62.5)3 (37.5)150 (0)0 (0)1 (6.7)0 (0)162 (12.5)1 (6.3)0 (0)2 (12.5)
V2103 (30.0)2 (20.0)3 (30.0)0 (0)162 (12.5)0 (0)0 (0)0 (0)172 (11.8)0 (0)1 (5.9)0 (0)
V3103 (30.0)0 (0)0 (0)1 (10.0)176 (35.3)0 (0)3 (17.6)3 (17.6)182 (11.1)0 (0)2 (11.1)0 (0)
VC60 (0)0 (0)0 (0)0 (0)80 (0)0 (0)0 (0)0 (0)90 (0)0 (0)0 (0)0 (0)
VN80 (0)0 (0)0 (0)0 (0)150 (0)0 (0)0 (0)0 (0)140 (0)0 (0)0 (0)0 (0)
Modeling of gastric infection with CandidaG180 (0)2 (25.0)0 (0)1 (12.5)140 (0)4 (28.6)1 (7.1)0 (0)113 (27.3)2 (18.2)2 (18.2)0 (0)
G281 (12.5)1 (12.5)1 (12.5)1 (12.5)181 (5.6)2 (11.1)3 (16.7)0 (0)143 (21.4)4 (28.6)1 (7.1)0 (0)
G381 (12.5)1 (12.5)2 (25.0)2 (25.0)201 (5.0)3 (15.0)4 (20.0)0 (0)193 (15.8)0 (0)2 (10.5)0 (0)
G480 (0)3 (37.5)0 (0)0 (0)140 (0)0 (0)5 (35.7)0 (0)101 (10.0)0 (0)3 (30.0)1 (10.0)
GC70 (0)0 (0)0 (0)0 (0)200 (0)0 (0)0 (0)0 (0)120 (0)0 (0)0 (0)0 (0)
GN80 (0)0 (0)0 (0)0 (0)120 (0)0 (0)0 (0)0 (0)100 (0)0 (0)0 (0)0 (0)

Among the gastric mucosa samples obtained at 0, 3, and 6 weeks from vaginally delivered offspring mice in the V1, V2, and V3 groups, we recorded positive detection rates of 25% (3/12), 21.7% (5/23), and 8% (2/25) for H. pylori 16S rDNA, and corresponding rates of 8.3% (1/12), 0%, and 4% (1/25) for ureA gene, respectively. Similarly, for intestinal tissues or fecal contents of the offspring, the positive detection rates for both H. pylori 16S rDNA and ureA genes at 0, 3, and 6 weeks were 25% (3/12), 8.3% (2/24), and 4% (1/25), respectively. In addition, H. pylori 16S rDNA and ureA genes were detected in intestinal tissues obtained from two 0-week-old offspring and in one gastric mucosal sample from a 6-week-old mouse (Supplementary Table 3).

For offspring mice in the V1, V2, and V3 groups delivered via cesarean section, we recorded positive detection rates of 37.5% (6/16), 12% (3/25), and 4% (1/25) for H. pylori 16S rDNA and 12.5% (2/16), 0%, and 0% for ureA gene at 0, 3, and 6 weeks, respectively. In the intestinal tissues or fecal contents of offspring, the rates of positive detection for H. pylori 16S rDNA were 37.5% (6/16), 8% (2/25), and 8% (2/25) at 0, 3, and 6 weeks, respectively, and the corresponding values for ureA gene were 18.8% (3/16), 4% (1/25), and 4% (1/25), respectively. In addition, H. pylori 16S rDNA and ureA genes were detected in the intestinal tissues of two 0-week-old offspring mice and in a gastric mucosal sample from a single 6-week-old mouse (Supplementary Table 3).

For gastric mucosa samples obtained from offspring mice in the G1, G2, G3, and G4 groups delivered vaginally, the rates of positive detection for H. pylori 16S rDNA at 0, 3, and 6 weeks were 6.3% (1/16), 5.7% (2/35), and 19.2% (5/26), respectively and for ureA gene were 12.5% (2/16), 14.3% (5/35), and 11.5% (3/26), respectively. For the intestinal tissues or fecal contents of offspring, the rates of positive detection for H. pylori 16S rDNA were 6.3% (1/16), 25.7% (9/35), and 19.2% (5/26) at 0, 3, and 6 weeks, respectively, and the corresponding values for ureA gene were 6.3% (1/16), 0%, and 3.8% (1/26), respectively. In addition, H. pylori 16S rDNA and ureA genes were detected in the gastric mucosa samples obtained from one 6-week-old offspring, along with the intestinal content of a 6-week-old mouse (Supplementary Table 4).

For gastric mucosa obtained from offspring mice in the G1, G2, G3, and G4 groups delivered via cesarean section, the rates of positive detection for H. pylori 16S rDNA were 6.3% (1/16), 6.5% (2/31), and 18.5% (5/27) at 0, 3, and 6 weeks, respectively, and the corresponding values for ureA gene were 31.3% (5/16), 16.1% (5/31), and 11.1% (3/27), respectively. For the intestinal tissues or fecal contents of the offspring, the rates of positive detection for H. pylori 16S rDNA were 6.3% (1/16), 29.0% (9/31), and 11.1% (3/27) at 0, 3, and 6 weeks, respectively, and those for ureA gene were 6.3% (1/16), 0%, and 0%, respectively. We also detected H. pylori 16S rDNA and ureA genes in the gastric mucosa samples obtained from one 6-week-old offspring, and in the intestinal contents from a single 6-week-old mouse (Supplementary Table 4). In addition, we detected H. pylori 16S rDNA or ureA genes in a proportion of the gastric mucosal samples and intestinal tissues or contents from offspring mice delivered either vaginally or via cesarean section (Table 6). Furthermore, these genes were also identified in some of the placental and fetal membrane tissues obtained from mice that had undergone cesarean delivery (Table 7).

Table 6 Rates of positive detection for Helicobacter pylori in vaginally and cesarean section-delivered offspring, n (%).
GroupVaginal delivery1
Cesarean section1
Vaginal delivery2
Cesarean section2
Vaginal delivery3
Cesarean section3
Number of mice
Hp positive mice4
Number of mice
Hp positive mice
Number of mice
Hp positive mice
Number of mice
Hp positive mice
Number of mice
Hp positive mice
Number of mice
Hp positive mice
Modeling of vaginal infection with CandidaV141 (25.0)43 (75.0)90 (0)61 (16.7)102 (20.0)61 (16.7)
V242 (50.0)63 (50.0)72 (28.6)90 (0)72 (28.6)100 (0)
V341 (25.0)62 (33.3)74 (57.1)104 (40.0)81 (12.5)102 (20.0)
VC20 (0)40 (0)30 (0)50 (0)30 (0)60 (0)
VN40 (0)40 (0)90 (0)60 (0)80 (0)60 (0)
Modeling of gastric infection with CandidaG150 (0)32 (66.7)94 (44.4)50 (0)73 (42.9)43 (75.0)
G241 (25.0)42 (50.0)114 (36.4)71 (14.3)95 (55.6)51 (20.0)
G342 (50.0)42 (50.0)92 (22.2)115 (45.5)70 (0)124 (33.3)
G442 (50.0)41 (25.0)73 (42.9)72 (28.6)42 (50.0)61 (16.7)
GC40 (0)30 (0)130 (0)70 (0)70 (0)50 (0)
GN40 (0)40 (0)60 (0)60 (0)30 (0)70 (0)
Table 7 Rates of positive detection for Helicobacter pylori 16S rDNA or urease A genes in the placenta and fetal membranes of cesarean section-delivered offspring mice, n (%).
GroupNumber of examined samples
Placenta
Fetal membranes
Hp 16S rDNA positive samples
Hp ureA positive samples
Hp 16S rDNA positive samples
Hp ureA positive samples
Modeling of vaginal infection with CandidaV141 (25.0)0 (0)1 (25.0)0 (0)
V262 (33.3)1 (16.7)1 (16.7)1 (16.7)
V362 (33.3)0 (0)1 (16.7)2 (33.3)
VC40 (0)0 (0)0 (0)0 (0)
VN40 (0)0 (0)0 (0)0 (0)
Modeling of gastric infection with CandidaG140 (0)1 (25.0)0 (0)1 (25.0)
G240 (0)0 (0)0 (0)0 (0)
G341 (25.0)1 (25.0)0 (0)1 (25.0)
G440 (0)0 (0)0 (0)0 (0)
GC40 (0)0 (0)0 (0)0 (0)
GN40 (0)0 (0)0 (0)0 (0)
Isolation of Candida from samples of postpartum maternal mice and offspring and detection of H. pylori genes within Candida isolates

For mice in the groups with vaginal Candida infection, we isolated and cultured Candida from selected tissue samples. Specifically, we collected gastric mucosa samples, intestinal contents, and vaginal tissues from 42 postpartum maternal mice; placenta and fetal membranes tissues from 24 cesarean section-delivered offspring mice; and gastric mucosa samples and intestinal tissues or contents from 42 neonatal (0-week-old), 71 six-week-old, and 74 six-week-old offspring mice. In total, we isolated only four Candida strains, among which, two were from the gastric mucosa sample and intestinal contents of a single maternal mouse in group V2, and the other two were from the corresponding samples of a further maternal mouse in group V3. However, PCR analysis conducted for the presence of H. pylori 16S rDNA and ureA genes in these four Candida strains yielded negative results. No Candida were isolated from samples obtained from any of the remaining maternal mice or offspring.

For mice in the groups with gastric Candida infection, we carried out isolation of Candida from different tissue samples as follows: Gastric mucosa samples, intestinal contents, and vaginal tissues from 49 postpartum maternal mice; placenta and fetal membrane tissues from 22 cesarean section-delivered neonatal (0-week-old) offspring mice; and gastric mucosa samples and intestinal tissues or contents from 47 neonatal (0-week-old), 98 three-week-old, and 76 six-week-old offspring mice. Only a single Candida strain was isolated from the intestinal contents of a maternal mouse in group G3, and subsequent PCR analysis confirmed the presence of H. pylori 16S rDNA in this strain. Among the 3-week-old offspring mice, we succeeded in isolating six Candida strains were isolated, including one from the gastric mucosa sample of a mouse in group G1, three from the intestinal contents of three maternal mice in group G3, and two from the gastric mucosa samples of two mice in group GC. PCR analysis revealed that the Candida strain from the group G1 offspring mouse was positive for both H. pylori 16S rDNA and ureA genes, whereas these genes were not detected in any of the remaining five Candida strains. No Candida strains were isolated from samples obtained from the remaining maternal mice or any other offspring.

Histopathological results

Candida vaginal infection model: Supplementary Table 5 presents the pathological scores obtained for the gastric mucosal samples collected from both maternal and offspring mice. Under high magnification, tissues were classified as normal if the number of mononuclear cells did not exceed five. The pathological scores obtained for mice in groups V1, V2, and V3 were predominantly either 2 or 3, whereas those for mice in groups VC and VN, were primarily either 1 or 2. Notably, in samples obtained from some of the maternal mice in groups V1, V2, and V3, we detected bleeding spots and inflammatory cell infiltration within the gastric mucosal epithelium and lamina propria. Conversely, samples from mice in the VC and VN groups showed minimal pathological features, with only occasional bleeding spots being observed in the mucosal layer and limited inflammatory cell infiltration (< 5). In samples obtained from group VN mice, the structure of the mucosal epithelium was generally found to be intact (Figure 4A). In contrast, no significant pathological changes were observed in the gastric mucosa of most 3- and 6-week-old offspring mice in groups V1, V2, and V3. Figure 4B and C show the gastric mucosa of offspring mice with evident pathological alterations.

Figure 4
Figure 4 Hematoxylin and eosin staining of the gastric mucosa in Candida vaginal infection model (× 200). A: Maternal mice; B: Three-week-old offspring mice; C: Six-week-old offspring mice. a: Gastric mucosa from offspring mice in the experimental group; b: Gastric mucosa from offspring in the control group; c: Gastric mucosa from offspring in the normal group. V1: Vagina infected with Candida J115; V2: Vagina infected with Candida H100; V3: Vagina infected with Candida Ca-co-Hp; VC: Vagina infected with Candida Ca10231; VN: Vagina treated with saline solution. The orange and black arrows in the figure indicate the bleeding points and inflammatory cells, respectively.

Candida gastric infection model: Supplementary Table 6 presents the pathological scores obtained for the gastric mucosa samples collected from both maternal and offspring mice. Under high magnification, tissues were classified as normal if the number of mononuclear cells did not exceed five. The pathological scores for mice in groups G1, G2, G3, and G4 ranged predominantly from 2 to 4 points, whereas those for mice in groups VC and VN were primarily either 1 or 2. In samples obtained from a proportion of the maternal mice in groups G1, G2, G3, and G4, we observed bleeding spots and inflammatory cell infiltration within the gastric mucosal epithelium and lamina propria. The mucosal epithelium of group G1 mice was found to be characterized by atrophy and hemorrhage within the epithelial layer, whereas we observed comparatively little pathological disruption in mucosal samples obtained from mice in the GC and GN groups, with only occasional bleeding spots being detected in the mucosal layer and limited inflammatory cell infiltration (< 5). Among mice in the VN group, the structure of the mucosal epithelium remained intact (Figure 5A), whereas in contrast, among the 3- and 6-week-old offspring mice in groups G1, G2, G3, and G4, we detected little evidence of any significant pathological changes. Figure 5B and C show the gastric mucosa of offspring mice with evident pathological alterations.

Figure 5
Figure 5 Hematoxylin and eosin staining of gastric mucosa in Candida gastric infection model (× 200). A: Maternal mice; B: Three-week-old offspring mice; C: Six-week-old offspring mice. a: Gastric mucosa from offspring mice in the experimental group; b: Gastric mucosa from offspring in the control group; c: Gastric mucosa from offspring in the normal group. Group G1 mice were infected with Helicobacter pylori via gavage and inoculated intravaginally with Candida Ca10231; group G2 mice were gavaged with Candida W49; group G3 mice were gavaged with Candida F67; group G4 mice were gavaged with Candida Ca-co-Hp; group GC mice were gavaged with Candida Ca10231; and group GN mice were gavaged with saline solution. The orange and black arrows in the figure indicate bleeding points and inflammatory cells, respectively.
DISCUSSION

The findings of epidemiological studies have revealed that household transmission is the primary mode of transmission for H. pylori among humans[6,41]. In China, H. pylori is transmitted through the oral-oral and fecal-oral routes, along with waterborne transmission[6]. However, in developed countries, transmission via the fecal-oral route is considered unlikely, and there is currently limited evidence for transmission via water or food[42]. Moreover, given that oral-oral transmission is not universally prevalent[43], the route whereby H. pylori is transmitted remains unclear.

Maternal transmission of microbial communities may occur during pregnancy, childbirth, or breastfeeding[44], and it has been established that newborns can acquire Candida via vertical transmission during birth, leading to intestinal colonization[21]. For example, quantitative PCR and sequencing analyses have revealed the presence of bacteria and Candida in the meconium of newborns delivered either vaginally or through cesarean section[15]. In addition, the findings of recent research have provided evidence that the amniotic fluid environment is not consistently sterile, thereby indicating that the microbiota colonizing the neonatal gut may initially originate from the amniotic fluid microbiome. This challenges our traditional understanding of the amniotic cavity as a sterile environment[16,17,45]. Furthermore, it has been confirmed that certain opportunistic pathogens or pathogenic bacteria, including strains of Candida, Treponema pallidum[46] and Listeria monocytogenes[47], can be vertically transmitted from an infected mother to the fetus during pregnancy or through contact with maternal lesions during childbirth.

Previous studies have identified the presence of H. pylori in both amniotic fluid and meconium. For example, in a cohort study of 48 pregnant women in Turkey, 58.3% of the amniotic fluid samples obtained from these women tested positive for an H. pylori antigen[48]. In addition, the findings of an animal study have revealed that H. pylori infection can be detected as early as birth[49]. In this study, in which gastric mucosa samples were collected via gastroscopy from 20 newborn monkeys aged 12-64 weeks for H. pylori isolation, one or more positive cultures were obtained for 18 animals (90%), and at 12 weeks, six of 15 monkeys (40%) tested positive for H. pylori. The researchers accordingly concluded that neonates are most likely to acquire H. pylori from their mothers during the perinatal period, and that this infection tends to persist[49]. In humans, H. pylori has been detected in the feces of newborns[7,9,50,51], and the findings of numerous studies have revealed that H. pylori infection can manifest in children at an early age[48,52,53]. Furthermore, infected mothers have been established to play a pivotal role in the transmission of H. pylori[6,10,11,54]. Indeed, the findings of RAPD-based analyses have indicated that mother-to-child transmission is the most likely route of transmission for H. pylori[55-57]. However, having passed out of stomach environment, it is considered unlikely that H. pylori would survive and reproduce, and, consequently, the mechanism associated with H. pylori transmission from mothers to children remains unclear. H. pylori is a facultative intracellular bacterium[58] that has been variously detected within host gastric epithelial cells[59-61], macrophages[62,63], and dendritic cells[64]. Moreover, to evade the detrimental effects of adverse external factors, H. pylori can also colonize the cells of Candida yeasts[27].

Notably in this regard, Candida is characterized by a strong resistance to external pressure, and can thus provide a protective environment for H. pylori, as well as a source of nutrition for survival. In addition, Candida can serve as a vector for bacterial transmission in populations and environments[27,65]. As evidence by the findings of recent studies that have detected the presence of H. pylori in Candida isolated from oral, gastrointestinal, and vaginal sources based on PCR and direct immunofluorescence analyses[25-27,30,31]. Furthermore, Heydari et al[33] have revealed that H. pylori can be released via yeast vesicles and effectively captured in free form using immunomagnetic separation assays. In our previous study, we detected H. pylori 16S rDNA and cagA gene fragments in Candida isolates obtained from gastric mucosa, feces, and vaginal discharge samples and found that Candida isolates obtained from four mother-neonate pairs were characterized identical RAPD patterns and highly homologous ITS sequences[9]. Consistent with these findings, Siavoshi et al[20] have identified a correlation between the presence of H. pylori genes in the vaginal yeast of mothers and the oral yeast of newborns. These findings accordingly provide compelling evidence to verify that H. pylori can internalize within yeast cells, which can thereby facilitate the vertical transmission of H. pylori from mother to offspring.

To enable survival in the acidic gastric environment and facilitate colonization of the gastric mucosa, H. pylori secretes urease[66,67], and although Candida is deficient in intrinsic urease activity, we established that H. pylori 16S rDNA- and ureA genes-positive Candida strains acquire this activity, which is consistent with the findings of Hiengrach et al[32]. Notably, this activity was demonstrated to persist through five generations, thereby confirming stable H. pylori-specific urease expression. In this regard, we speculate that the observed discrepancy between the detection of H. pylori ureA gene and urease activity may arise from a sampling bias associated with the low initial viability of H. pylori in Candida, as well as delayed urease expression during the culturing process. Consequently, the observed differences in the time to the activation of urease activity may indicate that Candida strain-specific factors influence the colonization of H. pylori.

To investigate whether H. pylori-positive Candida can be transmitted during childbirth and cause H. pylori infection in offspring, we conducted experiments using mice, and to prevent intra-nest infection between maternal mice and offspring, we adopted a nursing foster approach. H. pylori 16S rDNA or ureA gene were successfully detected in certain tissues of maternal mice infected with H. pylori 16S rDNA- and ureA genes-positive Candida and their offspring using PCR. Serum levels of H. pylori IgG showed an increasing trend in H. pylori-positive Candida groups containing infected maternal mice and offspring compared with mice in the control and normal groups, with the presence of H. pylori IgM being detected in offspring mice, indicating that both maternal and offspring mice were infected with H. pylori. Regardless of whether they were delivered vaginally or via cesarean section, newborn mice were found to have evidence H. pylori infection, thereby indicating that infection is not influenced by the mode of delivery. However, whereas infection among the offspring mice delivered vaginally originates from the maternal vagina, that in mice delivered via cesarean section may be derived from the retrograde migration of maternal vaginal microbiota to the cervix and fetal membranes, which subsequently enter the amniotic fluid when membranes rupture. Given the young age of the offspring mice assessed in this study, the gastric mucosa of most of these showed no significant pathological changes, thereby tending to indicate a latent asymptomatic state of H. pylori infection. Indeed, such asymptomatic infections of H. pylori have previously been reported in newborns[68]. However, in the present study, we detected both individual and concurrent positivity for the H. pylori 16S rDNA and ureA genes in both maternal and offspring mice, which could indicate that current PCR methods may lack sufficient sensitivity for reliable detection, and/or that endogenous Helicobacter species in mice might interfere with detection of the target bacteria. Consequently, more sensitive detection methods should be developed to overcome these limitations. In this regard, a nested PCR technique has been demonstrated to be associated with relatively low rates of detection for the ureA gene in both dental pulp (12%, 23/192) and dental plaque (1%, 2/192) samples obtained from H. pylori-infected individuals[69]. This accordingly highlights the potential limitations in the sensitivity of molecular detection techniques when applied for the analysis of complex biological samples.

In this study, in which we attempted to isolate and culture H. pylori from mouse tissues, we experienced difficulties in culturing H. pylori. We speculate that this problem could be attributable to a number of factors, including the unsuitability of traditional cultivation conditions for isolating H. pylori within Candida, a low quantity of H. pylori presents within Candida cells, or because H. pylori persists in a viable albeit non-culturable state, in which its toxicity is lower than that of the spiral form, although can still retain metabolic activity and pathogenicity[70]. In this context, Heydari et al[71] have successfully isolated and cultured Arthrobacter, Cellulomonas, and Staphylococcus from Candida using the method of aging and starvation stress, and Staphylococcus has been isolated from stomach-derived Candida exposed to amphotericin B-induced stress[72]. However, to the best of our knowledge, there have been no previous studies in which H. pylori has been isolated from Candida and subsequently cultured. Although the isolation and culture of H. pylori from human gastric mucosa is relative efficient, with rates that can exceed 70%[73,74], there have been no reports regarding the successful isolation and culture of H. pylori from the gastric mucosa of mice. Similarly, the mouse model of infection with H. pylori-positive Candida in this study serves to further highlight the difficulties in isolating and culturing H. pylori. Consequently, further follow-up research in clinical trials is warranted.

Although the traditional Koch’s postulates serve as a fundamental framework for establishing the relationship between pathogens and diseases, some microorganisms may have pathogenicity but cannot be successfully cultured on artificial medium[75]. For example, Mycobacterium leprae, which has not been successfully cultured in vitro, can only be grown within the host bodies of the nine-banded armadillo Dasypus novemcinctus[76]. However, the molecular version of Koch’s postulates can now be used to determine the relationships between pathogens and diseases[77]. In this study, we sought to detect the H. pylori 16S rDNA and ureA genes in maternal and offspring mouse tissues, with a view toward fulfilling Koch’s postulates for H. pylori infection in mice at the molecular level. Furthermore, histopathological examination of the gastric mucosa in some maternal and offspring mice, along with the detection of H. pylori IgG and H. pylori IgM in mouse sera, provide evidence of H. pylori infection in both maternal mice and their offspring.

In this study, we succeeded in isolating Candida strains from only a relatively small number samples of gastric mucosal tissues, intestinal contents, or vaginal secretions obtained from maternal mice after childbirth, and some of these strains tested negative for H. pylori using PCR. Possible explanations for this phenomenon include: (1) The gradual development of an immune response by the mice, resulting in the elimination of Candida; and (2) The self-cleaning of mice, enabling them to remove Candida.

For the purposes of the present study, we selected C57BL/6J mice as experimental animals, primarily based the following reasons. First, research on animal models of mother-to-child transmission of H. pylori infection remains limited. Second, a relatively large number of mice were required for this study, and C57BL/6J mice have relatively strong vitality and good adaptability, as well as can be bred at relatively low costs, which is conducive to experiment efficiency. Although Mongolian gerbils are more sensitive to H. pylori infection[78], we refrained from selecting these as the primary experimental model on account of their higher cost and the uncertainty of experimental outcomes in this study. However, on the basis of our preliminary findings in this study, we believe that female Mongolian gerbils could be used in subsequent studies as models infected with H. pylori-positive Candida prior to mating and giving birth. It is thus plausible that H. pylori could then be isolated and cultured from the stomach tissues and intestinal contents of the offspring. In addition, based on the premise of the 3R principles of animal experiments, we could appropriately increase the sample size for further verification. Furthermore, having initially obtained ethical approval, it may be feasible to collect amniotic fluid from parturient women, along with rectal and oral swabs from newborns, which could be used to detect specific antigens and nucleic acids of H. pylori, thereby providing further evidence for the vertical transmission of H. pylori. However, although our findings in this study have yielded preliminary evidence for the vertical transmission of H. pylori, as such, these are currently insufficient to fully confirm this route of transmission. We accordingly intend to conduct further in-depth studies to obtain more compelling evidence that will hopefully contribute to elucidating the mechanisms whereby H. pylori is transmitted.

CONCLUSION

In this study, we established vaginal and gastric infection models using female C57BL/6J mice infected with H. pylori 16S rDNA- and ureA genes-positive Candida (H. pylori-positive Candida), and accordingly detected H. pylori-specific IgG antibodies in the sera of maternal mice infected with these yeasts. In addition, H. pylori 16S rDNA and/or ureA gene fragments were identified in gastric tissues, fecal samples, and vaginal tissues, and we observed marked inflammatory responses in the gastric mucosa of these mice. These findings indicate that H. pylori-positive Candida may retain pathogenically active H. pylori, which can be released, thereby causing infection in the maternal mice. Regardless of the mode of delivery (vaginal or cesarean section), H. pylori specific IgG/IgM antibodies were detected in the sera of offspring mice at 0, 3, and 6 weeks of age. Furthermore, H. pylori 16S rDNA and/or ureA genes were detected in the gastric tissues, intestinal tissues, or fecal samples of the offspring mice, thus indicating the high probability that H. pylori infection observed in these mice was derived via maternal transmission. Collectively, our findings provide convincing evidence that H. pylori infection in newborns may be acquired via vertical transmission during childbirth from mothers infected with Candida harboring internalized H. pylori.

References
1.  Warren JR, Marshall B. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet. 1983;1:1273-1275.  [PubMed]  [DOI]
2.  Sanders MK, Peura DA. Helicobacter pylori-Associated Diseases. Curr Gastroenterol Rep. 2002;4:448-454.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 57]  [Cited by in RCA: 39]  [Article Influence: 1.6]  [Reference Citation Analysis (8)]
3.  Infection with Helicobacter pylori. IARC Monogr Eval Carcinog Risks Hum. 1994;61:177-240.  [PubMed]  [DOI]
4.  Wise MJ, Lamichhane B, Webberley KM. A Longitudinal, Population-Level, Big-Data Study of Helicobacter pylori-Related Disease across Western Australia. J Clin Med. 2019;8:1821.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 8]  [Cited by in RCA: 7]  [Article Influence: 1.0]  [Reference Citation Analysis (4)]
5.  Wang L, Li Z, Tay CY, Marshall BJ, Gu B; Guangdong Center for Quality Control of Clinical Gene Testing and Study Group of Chinese Helicobacter pylori Infection and Antibiotic Resistance Rates Mapping Project (CHINAR-MAP). Multicentre, cross-sectional surveillance of Helicobacter pylori prevalence and antibiotic resistance to clarithromycin and levofloxacin in urban China using the string test coupled with quantitative PCR. Lancet Microbe. 2024;5:e512-e513.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 44]  [Cited by in RCA: 42]  [Article Influence: 21.0]  [Reference Citation Analysis (1)]
6.  Ding SZ, Du YQ, Lu H, Wang WH, Cheng H, Chen SY, Chen MH, Chen WC, Chen Y, Fang JY, Gao HJ, Guo MZ, Han Y, Hou XH, Hu FL, Jiang B, Jiang HX, Lan CH, Li JN, Li Y, Li YQ, Liu J, Li YM, Lyu B, Lu YY, Miao YL, Nie YZ, Qian JM, Sheng JQ, Tang CW, Wang F, Wang HH, Wang JB, Wang JT, Wang JP, Wang XH, Wu KC, Xia XZ, Xie WF, Xie Y, Xu JM, Yang CQ, Yang GB, Yuan Y, Zeng ZR, Zhang BY, Zhang GY, Zhang GX, Zhang JZ, Zhang ZY, Zheng PY, Zhu Y, Zuo XL, Zhou LY, Lyu NH, Yang YS, Li ZS; National Clinical Research Center for Digestive Diseases (Shanghai), Gastrointestinal Early Cancer Prevention & Treatment Alliance of China (GECA), Helicobacter pylori Study Group of Chinese Society of Gastroenterology, and Chinese Alliance for Helicobacter pylori Study. Chinese Consensus Report on Family-Based Helicobacter pylori Infection Control and Management (2021 Edition). Gut. 2022;71:238-253.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 155]  [Cited by in RCA: 156]  [Article Influence: 39.0]  [Reference Citation Analysis (4)]
7.  Stray-Pedersen A, Gaustad P, Stray-Pedersen B, Rognum TO. Detection rate of Helicobacter pylori stool antigen in newborn infants and small children. J Perinat Med. 2007;35:155-158.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 16]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
8.  O'Ryan ML, Lucero Y, Rabello M, Mamani N, Salinas AM, Peña A, Torres-Torreti JP, Mejías A, Ramilo O, Suarez N, Reynolds HE, Orellana A, Lagomarcino AJ. Persistent and transient Helicobacter pylori infections in early childhood. Clin Infect Dis. 2015;61:211-218.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 39]  [Cited by in RCA: 36]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
9.  Yang T, Zhang Y, Zhang H, Wu X, Sun J, Hua D, Pan K, Liu Q, Cui G, Chen Z. Intracellular presence and genetic relationship of Helicobacter pylori within neonates' fecal yeasts and their mothers' vaginal yeasts. Yeast. 2023;40:401-413.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 9]  [Article Influence: 3.0]  [Reference Citation Analysis (1)]
10.  Yokota S, Konno M, Fujiwara S, Toita N, Takahashi M, Yamamoto S, Ogasawara N, Shiraishi T. Intrafamilial, Preferentially Mother-to-Child and Intraspousal, Helicobacter pylori Infection in Japan Determined by Mutilocus Sequence Typing and Random Amplified Polymorphic DNA Fingerprinting. Helicobacter. 2015;20:334-342.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 71]  [Cited by in RCA: 57]  [Article Influence: 5.2]  [Reference Citation Analysis (3)]
11.  Mamishi S, Eshaghi H, Mahmoudi S, Bahador A, Hosseinpour Sadeghi R, Najafi M, Farahmand F, Khodadad A, Pourakbari B. Intrafamilial transmission of Helicobacter pylori: genotyping of faecal samples. Br J Biomed Sci. 2016;73:38-43.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 38]  [Cited by in RCA: 34]  [Article Influence: 3.4]  [Reference Citation Analysis (1)]
12.  Tamburini S, Shen N, Wu HC, Clemente JC. The microbiome in early life: implications for health outcomes. Nat Med. 2016;22:713-722.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1046]  [Cited by in RCA: 908]  [Article Influence: 90.8]  [Reference Citation Analysis (0)]
13.  Dominguez-Bello MG, Costello EK, Contreras M, Magris M, Hidalgo G, Fierer N, Knight R. Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proc Natl Acad Sci U S A. 2010;107:11971-11975.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3937]  [Cited by in RCA: 3294]  [Article Influence: 205.9]  [Reference Citation Analysis (4)]
14.  Coscia A, Bardanzellu F, Caboni E, Fanos V, Peroni DG. When a Neonate Is Born, So Is a Microbiota. Life (Basel). 2021;11:148.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 57]  [Cited by in RCA: 46]  [Article Influence: 9.2]  [Reference Citation Analysis (0)]
15.  Wampach L, Heintz-Buschart A, Hogan A, Muller EEL, Narayanasamy S, Laczny CC, Hugerth LW, Bindl L, Bottu J, Andersson AF, de Beaufort C, Wilmes P. Colonization and Succession within the Human Gut Microbiome by Archaea, Bacteria, and Microeukaryotes during the First Year of Life. Front Microbiol. 2017;8:738.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 237]  [Cited by in RCA: 205]  [Article Influence: 22.8]  [Reference Citation Analysis (0)]
16.  Collado MC, Rautava S, Aakko J, Isolauri E, Salminen S. Human gut colonisation may be initiated in utero by distinct microbial communities in the placenta and amniotic fluid. Sci Rep. 2016;6:23129.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 909]  [Cited by in RCA: 766]  [Article Influence: 76.6]  [Reference Citation Analysis (4)]
17.  He Q, Kwok LY, Xi X, Zhong Z, Ma T, Xu H, Meng H, Zhao F, Zhang H. The meconium microbiota shares more features with the amniotic fluid microbiota than the maternal fecal and vaginal microbiota. Gut Microbes. 2020;12:1794266.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 115]  [Cited by in RCA: 99]  [Article Influence: 16.5]  [Reference Citation Analysis (0)]
18.  DiGiulio DB. Diversity of microbes in amniotic fluid. Semin Fetal Neonatal Med. 2012;17:2-11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 301]  [Cited by in RCA: 252]  [Article Influence: 18.0]  [Reference Citation Analysis (0)]
19.  DiGiulio DB, Romero R, Kusanovic JP, Gómez R, Kim CJ, Seok KS, Gotsch F, Mazaki-Tovi S, Vaisbuch E, Sanders K, Bik EM, Chaiworapongsa T, Oyarzún E, Relman DA. Prevalence and diversity of microbes in the amniotic fluid, the fetal inflammatory response, and pregnancy outcome in women with preterm pre-labor rupture of membranes. Am J Reprod Immunol. 2010;64:38-57.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 399]  [Cited by in RCA: 254]  [Article Influence: 15.9]  [Reference Citation Analysis (0)]
20.  Siavoshi F, Taghikhani A, Malekzadeh R, Sarrafnejad A, Kashanian M, Jamal AS, Saniee P, Sadeghi S, Sharifi AH. The role of mother's oral and vaginal yeasts in transmission of Helicobacter pylori to neonates. Arch Iran Med. 2013;16:288-294.  [PubMed]  [DOI]
21.  Filippidi A, Galanakis E, Maraki S, Galani I, Drogari-Apiranthitou M, Kalmanti M, Mantadakis E, Samonis G. The effect of maternal flora on Candida colonisation in the neonate. Mycoses. 2014;57:43-48.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 35]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
22.  Al-Rusan RM, Darwazeh AMG, Lataifeh IM. The relationship of Candida colonization of the oral and vaginal mucosae of mothers and oral mucosae of their newborns at birth. Oral Surg Oral Med Oral Pathol Oral Radiol. 2017;123:459-463.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 19]  [Article Influence: 2.1]  [Reference Citation Analysis (0)]
23.  Siavoshi F, Salmanian AH, Akbari F, Malekzadeh R, Massarrat S. Detection of Helicobacter pylori-specific genes in the oral yeast. Helicobacter. 2005;10:318-322.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 44]  [Cited by in RCA: 49]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
24.  Salmanian AH, Siavoshi F, Akbari F, Afshari A, Malekzadeh R. Yeast of the oral cavity is the reservoir of Heliobacter pylori. J Oral Pathol Med. 2008;37:324-328.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 38]  [Cited by in RCA: 39]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
25.  Saniee P, Siavoshi F, Nikbakht Broujeni G, Khormali M, Sarrafnejad A, Malekzadeh R. Immunodetection of Helicobacter pylori-specific proteins in oral and gastric Candida yeasts. Arch Iran Med. 2013;16:624-630.  [PubMed]  [DOI]
26.  Saniee P, Siavoshi F, Nikbakht Broujeni G, Khormali M, Sarrafnejad A, Malekzadeh R. Localization of H.pylori within the vacuole of Candida yeast by direct immunofluorescence technique. Arch Iran Med. 2013;16:705-710.  [PubMed]  [DOI]
27.  Siavoshi F, Saniee P. Vacuoles of Candida yeast as a specialized niche for Helicobacter pylori. World J Gastroenterol. 2014;20:5263-5273.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 55]  [Cited by in RCA: 51]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
28.  Saniee P, Siavoshi F. Endocytotic uptake of FITC-labeled anti-H. pylori egg yolk immunoglobulin Y in Candida yeast for detection of intracellular H. pylori. Front Microbiol. 2015;6:113.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 13]  [Cited by in RCA: 15]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
29.  Chen X, Zhou X, Liao B, Zhou Y, Cheng L, Ren B. The cross-kingdom interaction between Helicobacter pylori and Candida albicans. PLoS Pathog. 2021;17:e1009515.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 23]  [Cited by in RCA: 21]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
30.  Sánchez-Alonzo K, Matamala-Valdés L, Parra-Sepúlveda C, Bernasconi H, Campos VL, Smith CT, Sáez K, García-Cancino A. Intracellular Presence of Helicobacter pylori and Its Virulence-Associated Genotypes within the Vaginal Yeast of Term Pregnant Women. Microorganisms. 2021;9:131.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 13]  [Cited by in RCA: 13]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
31.  Yang T, Li J, Zhang Y, Deng Z, Cui G, Yuan J, Sun J, Wu X, Hua D, Xiang S, Chen Z. Intracellular presence of Helicobacter pylori antigen and genes within gastric and vaginal Candida. PLoS One. 2024;19:e0298442.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 8]  [Article Influence: 4.0]  [Reference Citation Analysis (1)]
32.  Hiengrach P, Panpetch W, Chindamporn A, Leelahavanichkul A. Helicobacter pylori, Protected from Antibiotics and Stresses Inside Candida albicans Vacuoles, Cause Gastritis in Mice. Int J Mol Sci. 2022;23:8568.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 26]  [Cited by in RCA: 27]  [Article Influence: 6.8]  [Reference Citation Analysis (0)]
33.  Heydari S, Siavoshi F, Jazayeri MH, Sarrafnejad A, Saniee P. Helicobacter pylori release from yeast as a vesicle-encased or free bacterium. Helicobacter. 2020;25:e12725.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 16]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
34.  Wu D, Cao M, Li N, Zhang A, Yu Z, Cheng J, Xie X, Wang Z, Lu S, Yan S, Zhou J, Peng J, Zhao J. Effect of trimethylamine N-oxide on inflammation and the gut microbiota in Helicobacter pylori-infected mice. Int Immunopharmacol. 2020;81:106026.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 20]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
35.  Šeligová B, Lukáč Ľ, Bábelová M, Vávrová S, Sulo P. Diagnostic reliability of nested PCR depends on the primer design and threshold abundance of Helicobacter pylori in biopsy, stool, and saliva samples. Helicobacter. 2020;25:e12680.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 50]  [Cited by in RCA: 40]  [Article Influence: 6.7]  [Reference Citation Analysis (0)]
36.  Jankowski M, Spużak J, Kubiak K, Glińska-Suchocka K, Biernat M. Detection of gastric Helicobacter spp. in stool samples of dogs with gastritis. Pol J Vet Sci. 2016;19:237-243.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 5]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
37.  White TJ, Bruns TD, Lee SB, Taylor JW.   Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In: PCR Protocols. New York: Academic Press, 1990: 315-322.  [PubMed]  [DOI]
38.  Yano J, Fidel PL Jr. Protocols for vaginal inoculation and sample collection in the experimental mouse model of Candida vaginitis. J Vis Exp. 2011;3382.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 45]  [Cited by in RCA: 57]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
39.  Oh SS, Narver HL. Mouse and Rat Anesthesia and Analgesia. Curr Protoc. 2024;4:e995.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 82]  [Cited by in RCA: 86]  [Article Influence: 43.0]  [Reference Citation Analysis (0)]
40.  Fang JY, Du YQ, Liu WZ, Ren JL, Li YQ, Chen XY, Lv NH, Chen YX, Lv B; Chinese Society of Gastroenterology, Chinese Medical Association. Chinese consensus on chronic gastritis (2017, Shanghai). J Dig Dis. 2018;19:182-203.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 65]  [Cited by in RCA: 62]  [Article Influence: 7.8]  [Reference Citation Analysis (4)]
41.  Yu XC, Shao QQ, Ma J, Yu M, Zhang C, Lei L, Zhou Y, Chen WC, Zhang W, Fang XH, Zhu YZ, Wu G, Wang XM, Han SY, Sun PC, Ding SZ. Family-based Helicobacter pylori infection status and transmission pattern in central China, and its clinical implications for related disease prevention. World J Gastroenterol. 2022;28:3706-3719.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 28]  [Cited by in RCA: 22]  [Article Influence: 5.5]  [Reference Citation Analysis (0)]
42.  Katelaris P, Hunt R, Bazzoli F, Cohen H, Fock KM, Gemilyan M, Malfertheiner P, Mégraud F, Piscoya A, Quach D, Vakil N, Vaz Coelho LG, LeMair A, Melberg J. Helicobacter pylori World Gastroenterology Organization Global Guideline. J Clin Gastroenterol. 2023;57:111-126.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 161]  [Cited by in RCA: 135]  [Article Influence: 45.0]  [Reference Citation Analysis (0)]
43.  Mao X, Jakubovics NS, Bächle M, Buchalla W, Hiller KA, Maisch T, Hellwig E, Kirschneck C, Gessner A, Al-Ahmad A, Cieplik F. Colonization of Helicobacter pylori in the oral cavity - an endless controversy? Crit Rev Microbiol. 2021;47:612-629.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 52]  [Cited by in RCA: 38]  [Article Influence: 7.6]  [Reference Citation Analysis (0)]
44.  Santus W, Devlin JR, Behnsen J. Crossing Kingdoms: How the Mycobiota and Fungal-Bacterial Interactions Impact Host Health and Disease. Infect Immun. 2021;89:e00648-e00620.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 109]  [Cited by in RCA: 97]  [Article Influence: 19.4]  [Reference Citation Analysis (0)]
45.  Kaisanlahti A, Turunen J, Byts N, Samoylenko A, Bart G, Virtanen N, Tejesvi MV, Zhyvolozhnyi A, Sarfraz S, Kumpula S, Hekkala J, Salmi S, Will O, Korvala J, Paalanne N, Erawijantari PP, Suokas M, Medina TP, Vainio S, Medina OP, Lahti L, Tapiainen T, Reunanen J. Maternal microbiota communicates with the fetus through microbiota-derived extracellular vesicles. Microbiome. 2023;11:249.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 73]  [Cited by in RCA: 65]  [Article Influence: 21.7]  [Reference Citation Analysis (0)]
46.  Peeling RW, Mabey D, Kamb ML, Chen XS, Radolf JD, Benzaken AS. Syphilis. Nat Rev Dis Primers. 2017;3:17073.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 540]  [Cited by in RCA: 425]  [Article Influence: 47.2]  [Reference Citation Analysis (0)]
47.  Eallonardo SJ, Freitag NE. Crossing the Barrier: A Comparative Study of Listeria monocytogenes and Treponema pallidum in Placental Invasion. Cells. 2023;13:88.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 16]  [Cited by in RCA: 14]  [Article Influence: 4.7]  [Reference Citation Analysis (0)]
48.  Aydın M, Tolunay HE, Varlı EN, Boza B, Şahin Ö, Özer S, Dülger AC. Helicobacter Pylori Infection in Amniotic Fluid May Cause Hyperemesis Gravidarum. Yale J Biol Med. 2020;93:487-493.  [PubMed]  [DOI]
49.  Solnick JV, Chang K, Canfield DR, Parsonnet J. Natural acquisition of Helicobacter pylori infection in newborn rhesus macaques. J Clin Microbiol. 2003;41:5511-5516.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 39]  [Cited by in RCA: 37]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
50.  Merino JS, Araneda L, Lincoñir-Campos P, Parra C, Sáez K, García A. Dynamics of Helicobacter pylori infection in infants during the first six months of life. Enferm Infecc Microbiol Clin (Engl Ed). 2019;37:109-111.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 8]  [Article Influence: 1.1]  [Reference Citation Analysis (3)]
51.  Rowland M, Daly L, Vaughan M, Higgins A, Bourke B, Drumm B. Age-specific incidence of Helicobacter pylori. Gastroenterology. 2006;130:65-72; quiz 211.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 193]  [Cited by in RCA: 169]  [Article Influence: 8.5]  [Reference Citation Analysis (4)]
52.  Malaty HM, Kumagai T, Tanaka E, Ota H, Kiyosawa K, Graham DY, Katsuyama T. Evidence from a nine-year birth cohort study in Japan of transmission pathways of Helicobacter pylori infection. J Clin Microbiol. 2000;38:1971-1973.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 51]  [Cited by in RCA: 47]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
53.  Kivi M, Johansson AL, Reilly M, Tindberg Y. Helicobacter pylori status in family members as risk factors for infection in children. Epidemiol Infect. 2005;133:645-652.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 71]  [Cited by in RCA: 69]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
54.  Fujimoto Y, Furusyo N, Toyoda K, Takeoka H, Sawayama Y, Hayashi J. Intrafamilial transmission of Helicobacter pylori among the population of endemic areas in Japan. Helicobacter. 2007;12:170-176.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 52]  [Cited by in RCA: 39]  [Article Influence: 2.1]  [Reference Citation Analysis (0)]
55.  Han SR, Zschausch HC, Meyer HG, Schneider T, Loos M, Bhakdi S, Maeurer MJ. Helicobacter pylori: clonal population structure and restricted transmission within families revealed by molecular typing. J Clin Microbiol. 2000;38:3646-3651.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 64]  [Cited by in RCA: 54]  [Article Influence: 2.1]  [Reference Citation Analysis (0)]
56.  Konno M, Fujii N, Yokota S, Sato K, Takahashi M, Sato K, Mino E, Sugiyama T. Five-year follow-up study of mother-to-child transmission of Helicobacter pylori infection detected by a random amplified polymorphic DNA fingerprinting method. J Clin Microbiol. 2005;43:2246-2250.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 94]  [Cited by in RCA: 85]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
57.  Nahar S, Kibria KM, Hossain ME, Sultana J, Sarker SA, Engstrand L, Bardhan PK, Rahman M, Endtz HP. Evidence of intra-familial transmission of Helicobacter pylori by PCR-based RAPD fingerprinting in Bangladesh. Eur J Clin Microbiol Infect Dis. 2009;28:767-773.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 24]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
58.  Dubois A, Borén T. Helicobacter pylori is invasive and it may be a facultative intracellular organism. Cell Microbiol. 2007;9:1108-1116.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 128]  [Cited by in RCA: 130]  [Article Influence: 6.8]  [Reference Citation Analysis (6)]
59.  Pathak SK, Tavares R, de Klerk N, Spetz AL, Jonsson AB. Helicobacter pylori protein JHP0290 binds to multiple cell types and induces macrophage apoptosis via tumor necrosis factor (TNF)-dependent and independent pathways. PLoS One. 2013;8:e77872.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 25]  [Cited by in RCA: 24]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
60.  Huang Y, Wang QL, Cheng DD, Xu WT, Lu NH. Adhesion and Invasion of Gastric Mucosa Epithelial Cells by Helicobacter pylori. Front Cell Infect Microbiol. 2016;6:159.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 125]  [Cited by in RCA: 119]  [Article Influence: 11.9]  [Reference Citation Analysis (1)]
61.  Chu YT, Wang YH, Wu JJ, Lei HY. Invasion and multiplication of Helicobacter pylori in gastric epithelial cells and implications for antibiotic resistance. Infect Immun. 2010;78:4157-4165.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 82]  [Cited by in RCA: 80]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
62.  Wang YH, Wu JJ, Lei HY. The autophagic induction in Helicobacter pylori-infected macrophage. Exp Biol Med (Maywood). 2009;234:171-180.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 75]  [Cited by in RCA: 77]  [Article Influence: 4.5]  [Reference Citation Analysis (1)]
63.  Tubau-Juni N, Bassaganya-Riera J, Leber A, Zoccoli-Rodriguez V, Kronsteiner B, Viladomiu M, Abedi V, Philipson CW, Hontecillas R. Identification of new regulatory genes through expression pattern analysis of a global RNA-seq dataset from a Helicobacter pylori co-culture system. Sci Rep. 2020;10:11506.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 18]  [Cited by in RCA: 15]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
64.  Wang YH, Gorvel JP, Chu YT, Wu JJ, Lei HY. Helicobacter pylori impairs murine dendritic cell responses to infection. PLoS One. 2010;5:e10844.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 72]  [Cited by in RCA: 70]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
65.  Dantas Ada S, Day A, Ikeh M, Kos I, Achan B, Quinn J. Oxidative stress responses in the human fungal pathogen, Candida albicans. Biomolecules. 2015;5:142-165.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 252]  [Cited by in RCA: 221]  [Article Influence: 20.1]  [Reference Citation Analysis (0)]
66.  Kusters JG, van Vliet AH, Kuipers EJ. Pathogenesis of Helicobacter pylori infection. Clin Microbiol Rev. 2006;19:449-490.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Reference Citation Analysis (0)]
67.  Ansari S, Yamaoka Y. Survival of Helicobacter pylori in gastric acidic territory. Helicobacter. 2017;22.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 180]  [Cited by in RCA: 167]  [Article Influence: 18.6]  [Reference Citation Analysis (0)]
68.  Ding Z, Zhao S, Gong S, Li Z, Mao M, Xu X, Zhou L. Prevalence and risk factors of Helicobacter pylori infection in asymptomatic Chinese children: a prospective, cross-sectional, population-based study. Aliment Pharmacol Ther. 2015;42:1019-1026.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 56]  [Cited by in RCA: 52]  [Article Influence: 4.7]  [Reference Citation Analysis (5)]
69.  Iwai K, Watanabe I, Yamamoto T, Kuriyama N, Matsui D, Nomura R, Ogaya Y, Oseko F, Adachi K, Takizawa S, Ozaki E, Koyama T, Nakano K, Kanamura N, Uehara R, Watanabe Y. Association between Helicobacter pylori infection and dental pulp reservoirs in Japanese adults. BMC Oral Health. 2019;19:267.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 31]  [Cited by in RCA: 22]  [Article Influence: 3.1]  [Reference Citation Analysis (0)]
70.  Mazaheri Assadi M, Chamanrokh P, Whitehouse CA, Huq A. Methods for Detecting the Environmental Coccoid Form of Helicobacter pylori. Front Public Health. 2015;3:147.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 15]  [Cited by in RCA: 21]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
71.  Heydari S, Siavoshi F, Ebrahimi H, Sarrafnejad A, Sharifi AH. Excision of endosymbiotic bacteria from yeast under aging and starvation stresses. Infect Genet Evol. 2020;78:104141.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 14]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
72.  Tavakolian A, Siavoshi F, Eftekhar F. Candida albicans Release Intracellular Bacteria When Treated With Amphotericin B. Arch Iran Med. 2018;21:191-198.  [PubMed]  [DOI]
73.  Alvarez-Aldana A, Fernandez Uribe PA, Mejía Valencia T, Guaca-Gonzalez YM, Santacruz-Ibarra JJ, Arturo-Arias BL, Castañeda-Chavez LJ, Pacheco-López R, Londoño-Giraldo LM, Moncayo-Ortiz JI. Antimicrobial susceptibility of clinical Helicobacter pylori isolates and its eradication by standard triple therapy: a study in west central region of Colombia. Microbiol Spectr. 2024;12:e0040124.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5]  [Cited by in RCA: 5]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
74.  Choi KD, Kim JM, Baik GH, Park JC, Jung HK, Ryu HS, Cho SJ, Shin CM, Jung HY; Korean College of Helicobacter and Upper Gastrointestinal Research. Helicobacter pylori Isolation and Antibiotic Susceptibility Testing Using Rapidly Frozen Biopsy Samples. Korean J Helicobacter Up Gastrointest Res. 2024;24:360-364.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 2]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
75.  Alipour N, Gaeini N. Helicobacter is preserved in yeast vacuoles! Does Koch's postulates confirm it? World J Gastroenterol. 2017;23:2266-2268.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 8]  [Cited by in RCA: 8]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
76.  Ploemacher T, Faber WR, Menke H, Rutten V, Pieters T. Reservoirs and transmission routes of leprosy; A systematic review. PLoS Negl Trop Dis. 2020;14:e0008276.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 151]  [Cited by in RCA: 110]  [Article Influence: 18.3]  [Reference Citation Analysis (0)]
77.  Chen ZH, Sun JC, Yang TX, Cui GZ. Ability of Helicobacter pylori to internalize into Candida. World J Gastroenterol. 2024;30:2281-2284.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 7]  [Cited by in RCA: 5]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
78.  Robinson AJ, House GL, Morales DP, Kelliher JM, Gallegos-Graves V, LeBrun ES, Davenport KW, Palmieri F, Lohberger A, Bregnard D, Estoppey A, Buffi M, Paul C, Junier T, Hervé V, Cailleau G, Lupini S, Nguyen HN, Zheng AO, Gimenes LJ, Bindschedller S, Rodrigues DF, Werner JH, Young JD, Junier P, Chain PSG. Widespread bacterial diversity within the bacteriome of fungi. Commun Biol. 2021;4:1168.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 45]  [Cited by in RCA: 34]  [Article Influence: 6.8]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade B, Grade B, Grade B

Novelty: Grade B, Grade B, Grade B

Creativity or Innovation: Grade B, Grade B, Grade B

Scientific Significance: Grade B, Grade B, Grade B

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: He YF, MD, Assistant Professor, Associate Chief Physician, China; Su GY, MD, PhD, China S-Editor: Wu S L-Editor: A P-Editor: Wang CH

Write to the Help Desk