Revised: January 23, 2026
Accepted: April 24, 2026
Published online: June 27, 2026
Processing time: 180 Days and 23.6 Hours
Chronic liver injury is a significant global health concern, necessitating the deve
To elucidate the effects of HHQG on macrophage polarization and to clarify the underlying molecular mechanisms using in vitro and in vivo experimental models.
A carbon tetrachloride (CCL4)-induced liver injury mouse model and the RAW264.7 macrophage cell line were employed. The effects of HHQG on macrophage polarization were assessed through reverse transcription-quantitative polymerase chain reaction, immunohistochemistry, and cell counting kit-8 assays. This study employed the molecular docking method to simulate the interactions between the key compounds of HHQG (Apigenin, Emodin, Genistein, Kaempferol, Quercetin) and the nuclear receptor subfamily 4 group A member 1 (NR4A1) and NR4A2.
Toxicity experiments demonstrated that HHQG showed no significant hepatotoxicity at the tested doses. In the CCL4-induced liver injury model, HHQG significantly alleviated weight loss, reduced serum alanine aminotransferase and aspartate aminotransferase levels, ameliorated liver tissue necrosis, inflammatory infiltration and collagen deposition, and effectively inhibited the expression of inflammatory factors [tumor necrosis factor-α, CCL2, interleukin (IL)-1β, IL-6]. Transcriptome analysis indicated that HHQG activated peroxisome proliferator-activated receptor and lipid metabolism-related pathways, inhibited mitogen-activated protein kinase and other inflammation-related pathways, and regulated the expression of genes related to macrophage polarization (such as upregulating Nr4a1/2, Ppargc1a, and downregulating CCR2, Ly6C1/2). Quantitative real-time polymerase chain reaction and immunohistochemical assays showed that HHQG could reduce the infiltration of pro-inflammatory macrophages (decreased F4/80, CD11b, T-cell immunoglobulin and mucin domain-containing protein 4), promote the expression of M2-related anti-inflammatory factors (C-X3-C motif chemokine receptor 1, YM-1, transforming growth factor-β, IL-10), and upregulate the expression of transcription factors NR4A1/NR4A2 in a dose-dependent manner. In vitro RAW264.7 cell experiments further confirmed that 50 μg/mL and 100 μg/mL HHQG inhibited M1 pro-inflammatory genes and enhanced the expression of M2 genes and NR4A1/NR4A2. Molecular docking results showed that in terms of binding affinity, apigenin exhibited the lowest Vina score (-8.2) in the NR4A1 system, while quercetin showed the lowest Vina score (-8.2) in the NR4A2 system.
HHQG exhibits significant hepatoprotective effects by regulating macrophage polarization.
Core Tip: Honghua Qinggan Shisanwei Wan (HHQG), a traditional Mongolian medicinal formula, shows hepatoprotective potential. This study reveals HHQG inhibits M1 macrophage polarization and promotes M2 polarization, regulating the peroxisome proliferator-activated receptor signaling pathway by upregulating nuclear receptors nuclear receptor subfamily 4 group A member 1 and nuclear receptor subfamily 4 group A member 2. Molecular docking confirms key compounds’ stable binding with these receptors, highlighting HHQG’s promise for treating liver-related disorders.
- Citation: Ma CL, Zhang X, Bao X, Zhao LY, Cao LL, Ma CY, Zhang T, Hong M, Bao YL, Hu RP. Discussion on the effect of Honghua Qinggan Shisanwei Wan on regulating macrophage polarization and alleviating liver injury. World J Hepatol 2026; 18(6): 118215
- URL: https://www.wjgnet.com/1948-5182/full/v18/i6/118215.htm
- DOI: https://dx.doi.org/10.4254/wjh.118215
With the rapid transformation of global lifestyles and the increasing Westernization of dietary habits, liver injury and its associated immune imbalances have emerged as a significant public health concern. Nonalcoholic fatty liver disease, along with other forms of liver damage, not only directly contributes to the progressive decline of liver function but also demonstrates a complex and intricate relationship with disorders of systemic immune homeostasis (Ristic-Medic et al[1]; Zhuge et al[2]). In this context, an in-depth investigation of the immune response associated with liver injury has become essential for overcoming existing therapeutic limitations.
Hepatic injury is closely related to macrophage polarization (Tacke and Zimmermann[3]; van der Heide et al[4]; Yang et al[5]). Traditionally, macrophages are classified into pro-inflammatory M1 and pro-repair M2 types to explain their roles in inflammation regulation and liver regeneration (Taru et al[6]; Yang et al[7]). However, this classification fails to fully capture the complexity of liver macrophages. Liver macrophages are highly heterogeneous in terms of lineage, space, and time: They include resident Kupffer cells and inflammatory macrophages recruited from peripheral monocytes during injury. Different subpopulations play distinct roles in inflammation initiation, progression, and repair (Ye et al[8]; Zhao et al[9]). Moreover, macrophage phenotypes exist on a continuous spectrum rather than discrete poles, and their functions can be rapidly remodeled by microenvironmental signals - the same cell may exhibit pro-inflammatory or pro-repair characteristics at different time points. Therefore, effective therapeutic strategies should go beyond the simplistic “promote M2” concept and instead consider subpopulation specificity, spatiotemporal dynamics, and molecular markers to precisely regulate the liver’s inflammatory and regenerative processes.
The nuclear receptor subfamily 4 group A (NR4A) receptor family plays distinct roles in the regulation of ma
Honghua Qinggan Shisanwei Wan (HHQG), a traditional formulation in Mongolian medicine, is composed of 13 medicinal ingredients, including safflower and clove, and is noted for its efficacy in clearing liver heat, detoxifying, and alleviating “Yama” disease (Wang et al[13]). Mechanistic pharmacological studies have demonstrated that HHQG can attenuate hepatic monocyte-macrophage infiltration by selectively inhibiting p38 and c-Jun N-terminal kinase mitogen-activated protein kinase phosphorylation cascades, thereby suppressing pro-inflammatory cytokines such as TNF-α and IL-1β (Wang et al[14]). Furthermore, network pharmacology predictions have identified luteolin and quercetin as key bioactive compounds capable of modulating apoptotic pathways and oxidative stress responses through the regulation of (phosphatidylinositol 3-kinase)/protein kinase B and nuclear factor erythroid 2-related factor 2/Kelch-like ECH-associated protein 1 pathways (Tang et al[15]). However, in the context of carbon tetrachloride (CCL4)-induced liver toxicity, the specific molecular mechanism by which HHQG alleviates inflammation and promotes tissue repair through regulating macrophage subsets remains to be further elucidated. In this study, we established complementary in vivo (CCL4-induced hepatic damage) and in vitro [lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages] models of hepatotoxicity to systematically investigate the regulatory effects of HHQG on macrophage polarization and its potential molecular mechanisms for alleviating liver injury, thereby providing a novel theoretical foundation for the modernization of Mongolian medicine.
The HHQG (Batch No. NMG2023-08) was purchased from Inner Mongolia International Mongolian Medicine Hospital (China). The formula for HHQG comprises 13 ingredients: Safflower (60 g), (Carthamus tinctorius L.), cloves (30 g),
CCL4, (≥ 99.5%, CAS No. 56-23-5) was obtained from Shanghai Aladdin Biochemical Technology Co., Ltd., China. Other chemical reagents included 4% paraformaldehyde (paraformaldehyde; BS-0626, Biosharp, China), anhydrous ethanol (gas chromatography grade), xylene (American Chemical Society grade), isopropanol (high performance liquid chromatography grade), chloroform (analytical reagent grade; Tianjin Chemical Reagent Company, China). Biochemical detection kits for aspartate aminotransferase (AST, A052-1-1) and alanine aminotransferase (ALT, C009-2-1) were purchased from Nanjing Jiancheng Bioengineering Institute, China. Histological staining reagents included hematoxylin and eosin (HE, D006-1-1) and Masson’s trichrome (D026-1-1) staining solutions from Beijing Solaibao Technology Co., Ltd., China, and a 3,3’-diaminobenzidine substrate chromogenic kit (DAB-0031) from Fuzhou Maixin Biotechnology Development Co., Ltd., China. For molecular biology analyses, RNAiso Plus total RNA extraction reagent (9108Q) was sourced from Takara, Japan, while FastKing gDNA Erase SuperMix (KR118-02) and FastReal PreMix with SYBR Green (FP207-02) were obtained from Tiangen Biotech, Beijing, China. Immunohistochemical procedures utilized a citric acid antigen retrieval buffer (powdered, MXB-0032) and a ready-to-use ultra-sensitive immunohistochemistry detection kit (SP-9001; Fuzhou Maixin Biotech, China). F4/80 (rat monoclonal, CI: A3-1; ab6640, Abcam MA, United States), TNF-α (rabbit monoclonal, EP557Y; ab183218, Abcam, MA, United States), NR4A1 (mouse monoclonal, 1G11; MA5-32303, Invitrogen, MA, United States), NR4A2 (rabbit polyclonal, EPR30055; ab284615, Abcam, MA, United States), Arg-1 (rabbit monoclonal, EPR6672; ab91279, Abcam, MA, United States), transforming growth factor-β (TGF-β1, rabbit monoclonal, EPR21072; ab215715, Abcam, MA, United States), and YM-1 (goat polyclonal, 1:300; ab93034, Abcam, MA, United States).
All animal procedures were performed per the Guide for the Care and Use of Laboratory Animals issued by the National Research Council. A total of 54 male C57BL/6 mice, aged 6 weeks to 8 weeks and weighing between 20 g and 22 g, were randomly assigned to nine groups. Each group consisted of 6 mice (n = 6 per group), and the sampling time points were set as the 2nd, 5th, and 7th days after the initiation of CCL4 injection, with the groups classified as control group, model group, and HHQG group at each time point. The mice were housed at a temperature of 20 °C to 22 °C and a relative humidity of 55% to 75%. The laboratory maintained a 12-hour light and 12-hour dark cycle to ensure consistent access to water and food. Following a 7-day acclimatization period, mice in the HHQG group were administered HHQG continuously for an additional 7 days via gastric perfusion once daily at a dosage of 0.6165 g/kg, while the mice in the control and model groups were given an equivalent amount of distilled water. On the 7th day, a mixture of CCL4 and olive oil (olive oil:CCL4 = 4:1) was injected into the abdominal cavity of mice from both the model and HHQG groups at a dosage of 0.1 mL/(10 g body weight), whereas the control group received an equivalent volume of normal saline. Blood samples were collected from the eye veins of the mice on the 2nd, 5th, and 7th days following the initiation of CCL4 injection. Finally, the mice were anesthetized and euthanized, and tissue samples were harvested and preserved in liquid nitrogen.
The mouse macrophage cell line RAW264.7 was obtained from the Beijing Beina Chuanglian Biotechnology Research Institute (China, BNCC354753). The source of the cell line is mouse, the CVCL number is CVCL_0493. Cells were cultured in Dulbecco’s modified Eagle medium (Gibco, MA, United States) supplemented with 10% fetal bovine serum (Gibco, MA, United States) in a constant temperature incubator set at 37 °C with 5% CO2. When the cell density reached 80%-90% confluence, a 0.25% trypsin- ethylenediamine tetraacetic acid solution was utilized for digestion and passaging, maintaining a passage ratio of 1:3 to 1:4.
To establish macrophage polarization models, RAW264.7 cells in the logarithmic growth phase were seeded into 6-well plates at a density of 2 × 105 cells per well. After allowing 2-3 hours for complete adhesion, the culture medium was replaced with fresh Dulbecco’s modified Eagle medium containing specific inducers. For M1 polarization, cells were stimulated with LPS at a final concentration of 200 ng/mL and interferon-gamma (IFN-γ) at 100 ng/mL for 24 hours. To induce M2 polarization, IL-4 was added to the culture medium at a final concentration of 40 ng/mL, and cells were incubated for 24 hours. Following induction, cells from all treatment groups were harvested, and total RNA was extracted using the TRIzol reagent. RNA purity and concentration were assessed by agarose gel electrophoresis and spectrophotometric analysis.
RAW264.7 cells in the logarithmic growth phase were digested with 0.25% trypsin- ethylenediamine tetraacetic acid to prepare a single-cell suspension. Cells were seeded into 96-well plates at a density of 5 × 103 cells per well by adding 100 μL of the suspension to each well. The plates were incubated at 37 °C with 5% CO2 for 12 hours to allow for complete cell adhesion.
Following incubation, the original medium was discarded and replaced with fresh medium containing varying concentrations of 50 μg/mL and 100 μg/mL of the treatment reagent. Each treatment group was set up in triplicate (three biological replicates), along with a blank control group (containing only culture medium) and a negative control group (cells without treatment). After a 24-hour treatment period, 10 μL of cell counting kit-8 reagent was added to each well. The plates were gently shaken to ensure uniform mixing and returned to the incubator for a further 4-hour dark incubation at 37 °C. Subsequently, the absorbance at 450 nm was measured using a microplate reader. The optical density values were recorded, and cell viability was calculated based on the absorbance readings.
Liver tissue samples were fixed in 4% paraformaldehyde for 24 hours and subsequently dehydrated using a graded ethanol series (30%, 50%, 70%, 85%, 95%, and 100%), with each step lasting 30 minutes. The tissues were then rendered transparent via immersion in xylene (twice, 15 minutes each) and embedded in paraffin to form paraffin tissue blocks.
The paraffin tissue blocks were sectioned into 4 μm slices, which were dewaxed in xylene (twice, 10 minutes each) and rehydrated through descending concentrations of ethanol: 100% ethanol (twice, 5 minutes each), 95%, 85%, and 70% ethanol (5 minutes each), followed by distilled water. HE staining was subsequently performed on the rehydrated sections. Sections were stained in hematoxylin for 5 minutes, rinsed under tap water for 1 minute, differentiated with 1% hydrochloric acid in ethanol for 10 seconds, and rapidly washed to terminate differentiation. Blueing was performed using an alkaline ammonia solution (pH 8.0) for 2 minutes, followed by a 3-minute rinse under tap water. Eosin staining was then conducted using 0.5% eosin solution for 3 minutes. Following staining, slides were dehydrated in 85%, 95%, and 100% ethanol (3 minutes each), cleared in xylene (twice, 5 minutes each), and mounted using neutral balsam for microscopic examination.
Liver tissue sectioning, dewaxing, and rehydration were performed as described for HE staining. Following rehydration, Masson’s trichrome staining was performed. Initially, sections were stained with hematoxylin for 8 minutes to visualize the cell nuclei, followed by rinsing with tap water for 1 minute. Next, the slices were immersed in 1% hydrochloric acid in ethanol solution for 10 seconds for differentiation, after which the process was terminated by rapid washing with water. Blueing was achieved by immersion in an alkaline ammonia solution (pH 8.0) for 3 minutes, followed by rinsing with tap water for 5 minutes. Subsequently, sections were stained with a mixture of Liqun red and magenta for 15 minutes. After rinsing with distilled water, the slides were incubated in 2% phosphomolybdic acid solution for 10 minutes to differentiate tissue components, with color development monitored during this step. Collagen fibers were then stained using 0.5% aniline blue solution. Finally, stained sections were dehydrated through graded ethanol solutions (85%, 95%, and 100%, 3 minutes each), cleared in xylene (twice, 5 minutes each), and sealed with neutral balsam for microscopic evaluation.
Blood samples were collected from the ophthalmic veins of the mice and were allowed to stand at room temperature for 25 minutes. The samples were then centrifuged at 3500 rpm for 15 minutes, after which the supernatant was carefully collected for subsequent analyses.
Serum ALT and AST activities were quantified according to the kit manufacturer’s instructions. Briefly, the matrix solution was prewarmed to 37 °C and dispensed into a 96-well microplate. A 5 μL aliquot of each serum sample was added to the corresponding wells, followed by thorough mixing and incubation at 37 °C for 30 minutes. Subsequently, 20 μL of 1.0 mmol/L 2,4-dinitrophenylhydrazine solution was added to each reaction well. An additional 5 μL of enzyme-free water was added to the control wells. After mixing, the plate was incubated at 37 °C for another 20 minutes. Subsequently, 200 μL of freshly prepared 0.4 mol/L NaOH solution was added to each well, mixed thoroughly, and allowed to react at room temperature for 15 minutes. Finally, the optical density values of each measuring well and the experimental control well were measured separately using an enzyme-linked immunosorbent assay (ELISA) reader set to a wavelength of 510 nm. Based on a standard curve, the specific activities of ALT and AST in serum were subsequently calculated.
Total RNA was extracted from either cell samples or tissue specimens, and its concentration and purity were determined using standard spectrophotometric methods. The extracted RNA was then reverse-transcribed into cDNA using a reaction mixture containing reverse transcriptase, gene-specific primers, and deionized water. The reverse transcription was carried out under the following conditions: Incubation at 37 °C for 15 minutes, followed by heating to 85 °C for 5 seconds to terminate the reaction, and then cooling to 4 °C. Subsequently, the resulting cDNA served as the template for quantitative real-time polymerase chain reaction (qRT-PCR). The polymerase chain reaction mixture included the cDNA template, specific primers (details in Table 1), TB Green Premix Ex Taq II reagent, and an appropriate amount of deionized water. Amplification was performed using the LightCycler® 480 II real-time polymerase chain reaction system (Roche Diagnostics, Mannheim, Germany).
| Gene | Forward primer | Reverse primer |
| TNF-α | CCCTCACACTCAGATCATCTTCT | GCTACGACGTGGGCTACAG |
| IL-6 | CCAAGAGGTGAGTGCTTCCC | CTGTTGTTCAGACTCTCTCCCT |
| IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
| CCL2 | TTAAAAACCTGGATCGGAACCAA | GCATTAGCTTCAGATTTACGGGT |
| F4/80 | TGACTCACCTTGTGGTCCTAA | CTTCCCAGAATCCAGTCTTTCC |
| TGF-β | CTCCCGTGGCTTCTAGTGC | GCCTTAGTTTGGACAGGATCTG |
| YM-1 | CAGGTCTGGCAATTCTTCTGAA | GTCTTGCTCATGTGTGTAAGTGA |
| IL-10 | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG |
| CX3CR1 | GAGTATGACGATTCTGCTGAGG | CAGACCGAACGTGAAGACGAG |
| NR4A1 | TTGAGTTCGGCAAGCCTACC | GTGTACCCGTCCATGAAGGTG |
| NR4A2 | GTGTTCAGGCGCAGTATGG | TGGCAGTAATTTCAGTGTTGGT |
| INOS | GTTCTCAGCCCAACAATACAAGA | GTGGACGGGTCGATGTCAC |
| β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
The specific amplification protocol was as follows: Initial denaturation at 95 °C for 5 minutes, followed by 40 cycles of denaturation at 95 °C for 15 seconds, and annealing/extension at 60 °C for 30-60 seconds. After amplification, a melting curve analysis was performed to determine the specificity of the amplified product and to eliminate non-specific amplification interference by observing the melting curve. Finally, the relative expression levels of genes were calculated using the comparative threshold (2-ΔΔCT) method.
Paraffin-embedded liver tissue sections were dewaxed and rehydrated for antigen retrieval. Endogenous enzymes were inactivated by treatment with 3% H2O2 at room temperature in the dark. The samples were then blocked with 3% goat serum at room temperature for 45 minutes, followed by the addition of diluted primary antibody dropwise, and incubated overnight at 4 °C. A reaction amplification agent was added dropwise, followed by the addition of a secondary antibody dropwise, and the sections were incubated at room temperature. Color development was achieved using freshly prepared 3,3’-diaminobenzidine chromogenic reagent. The samples were stained with hematoxylin, dehydrated, cleared, sealed with resin, and air-dried before being observed under a microscope. The processes of production, dewaxing, dehydration, and sealing of paraffin sections were consistent with the HE staining method.
Murine hepatic tissues were collected from euthanized C57BL/6 mice (n = 6 per group) under aseptic conditions. Approximately 50-100 mg of liver tissue per sample was promptly frozen in liquid nitrogen within 2 minutes of excision to preserve RNA integrity. Total RNA was isolated using TRIzol™ Reagent combined with DNase I treatment to eliminate genomic DNA contamination. First-strand cDNA synthesis was performed using random hexamer primers and ProtoScript II Reverse Transcriptase. Second-strand synthesis was subsequently performed with the incorporation of deoxyuridine triphosphate to retain strand specificity. Transcript quantification was executed using featureCounts v2.0.3 with Ensembl gene annotation (v102), and differential expression analysis was performed using DESeq2 v1.34.0, with thresholds set at |log2fold change| ≥ 1 and false discovery rate-adjusted P < 0.05.
Gene Ontology (GO) and Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of differentially expressed genes were performed using the DAVID database (https://david.ncifcrf.gov/). Differentially expressed genes were annotated and categorized into three GO domains: Biological processes, molecular functions, and cellular components. Enrichment analysis was conducted using either the hypergeometric test or Fisher’s exact test to identify significantly enriched terms, with statistical significance defined as P < 0.05 or false discovery rate < 0.05. Visualization of enriched GO terms and KEGG pathways was achieved using bar charts, bubble plots, and network graphs generated via an online bioinformatics analysis platform (http://www.bioinformatics.com.cn). Furthermore, a target pathway network was constructed and visualized using Cytoscape software to illustrate the interrelationships among significantly enriched pathways.
Molecular docking analysis was performed using the CB-Dock2 platform (http://cao.labshare.cn/cb-dock/), which employs cavity detection-guided blind docking to predict binding sites and affinities. The three-dimensional structures of the target proteins NR4A1 (PDB ID: 3V3E) and NR4A2 (PDB ID: 6DDA) were retrieved from the Protein Data Bank (http://www.rcsb.org). The 3D structures of the ligands apigenin (CID 5280443), emodin (CID 3220), genistein (CID 5280961), kaempferol (CID 5280863), and quercetin (CID 5280343) were obtained from the PubChem Compound database (https://pubchem.ncbi.nlm.nih.gov). The interaction strength and potential therapeutic relevance of the drugs with the target proteins were assessed by analyzing the docking scores, binding poses, and contact residues.
Statistical analyses were conducted using GraphPad Prism software. All experimental data are presented as mean ± SD, derived from three independent biological replicates. A t-test and Bonferroni-corrected one-way analysis of variance were utilized to ascertain the statistical significance of the differences between groups. The threshold for statistical significance was established at P < 0.05.
For 7 consecutive days, mice were administered high (1.24 g/kg), medium (0.62 g/kg), and low (0.31 g/kg) doses of HHQG via oral gavage. Throughout the treatment period, no signs of irritability, lethargy, toxic reactions, or mortality were observed. Additionally, there were no statistically significant differences in body weight between the HHQG-treated groups and the control group (P > 0.05) (Figure 1A). In liver-derived serum samples from HHQG-treated mice, levels of ALT and AST exhibited no significant changes compared to the control group (P > 0.05) (Figure 1B and C). Additionally, Macroscopic examination of liver tissues from HHQG-treated mice revealed smooth, normal-appearing livers. The histopathological analysis further confirmed the preservation of hepatic lobular architecture, with radially arranged hepatocytes, uniform nuclear and cytoplasmic distribution, and an overall orderly tissue structure (Figure 1D and E), indicating an absence of hepatotoxicity at all tested doses.
Over a 7-day observation period, mice in the CCL4 injury group exhibited a gradual decline in weight gain, whereas those in the HHQG treatment group showed a progressive increase in body weight. By day 7, there was a statistically significant difference in body weight between the HHQG and model groups (P < 0.001). ELISA analysis revealed that, on day 2 post-injury, serum ALT and AST levels in the model group were significantly elevated (P < 0.001), whereas these levels were markedly lower in the HHQG group compared to the model group (P < 0.01). By days 5 and 7 post-injury, ALT and AST levels in both the model and HHQG groups had decreased to levels comparable to those of the control group (P > 0.05) (Figure 2A-C). HE and Masson’s trichrome staining revealed that, on day 2 post-injury, the model group exhibited severe hepatic degeneration and necrosis, hepatocyte edema, inflammatory cell infiltration, and increased collagen fiber synthesis. In contrast, the HHQG treatment group showed significantly reduced liver injury and necrosis compared to the model group. By day 5 post-injury, the model group displayed exacerbated inflammatory cell infiltration and collagen deposition. Conversely, the HHQG group demonstrated marked attenuation of liver injury, reduced inflammatory cell infiltration, and improved collagen deposition. On day 7 post-injury, inflammation and collagen fibers decreased in the model group, though residual collagen fibers persisted. Notably, the HHQG group showed no significant inflammatory response, with near-normal hepatic architecture (Figure 2D and E). At days 2, 5, and 7 post-injury, liver tissues from the model group exhibited significantly elevated levels of TNF-α, CCL2, and IL-1β compared to the control group (P < 0.001). In contrast, HHQG treatment markedly reduced these cytokine levels relative to the model group (P < 0.01). IL-6 levels in the model group were also significantly elevated compared to the control group on days 2 and 5 (P < 0.001), whereas HHQG-treated mice showed a significant average reduction in IL-6 expression (P < 0.001). By day 7, IL-6 levels had normalized across all groups (Figure 2F). These results indicate that HHQG effectively suppresses the expression of TNF-α, CCL2, IL-1β, and IL-6 in CCL4-induced liver injury. Immunohistochemical analysis revealed that TNF-α expression was barely detectable in normal liver tissues. In contrast, the model group exhibited a significant upregulation of TNF-α expression in the periportal damaged areas by day 2 post-injury (P < 0.001 vs control). HHQG treatment significantly reduced TNF-α expression compared to the model group (P < 0.01). By days 5 and 7, TNF-α remained robustly expressed in the model group, whereas it was undetectable in HHQG-treated livers, indicating near-complete resolution of inflammation (Figure 2G).
To elucidate the molecular mechanism of the hepatoprotective effect mediated by HHQG, RNA sequencing was performed on the liver tissues of mice in the model group and the HHQG treatment group. GO functional enrichment and KEGG pathway analysis revealed distinct transcriptional profiles between the two groups. On the second day after modeling, up-regulated genes were enriched in metabolic biological processes such as carbohydrate metabolism, small-molecule metabolic processes, and lipid metabolic processes. The cellular components were mainly located in the extracellular region, cytoskeleton, and nucleus. Molecular functions were significantly associated with oxidoreductase activity and iron ion binding. In contrast, down-regulated genes were enriched in immune-related biological processes, including transition metal ion binding, calcium ion binding, and oxidoreductase activity. The corresponding cellular components were related to the main extracellular region and intracellular ribonucleoprotein complexes, while molecular functions showed decreased transmembrane transporter activity and transporter activity. KEGG pathway analysis further indicated that HHQG intervention significantly activated the peroxisome proliferator-activated receptor (PPAR) signaling pathway, fatty acid decomposition, fatty acid metabolism, and carbon metabolism pathways. Meanwhile, HHQG inhibited the mitogen-activated protein kinase signaling pathway, forkhead box O signaling pathway, and glycerophospholipid metabolism. In conclusion, these findings suggest that HHQG exerts a protective effect against liver injury by coordinately regulating metabolic homeostasis, suppressing excessive immune responses, and modulating key signal transduction pathways, providing a mechanistic basis for its therapeutic application (Figure 3A and B).
Further transcriptome analysis on day 5 post-liver injury revealed that HHQG regulated macrophage polarization-associated gene expression. Compared with the model group, the HHQG group showed 7 upregulated and 17 downregulated genes involved in macrophage polarization. The upregulated genes included Stat5b, Ppargc1a, Nr4A3, Cebpb, Ppargc1b, Nr4A1, and Nr4A2, among which Nr4A1 exhibited the most significant upregulation (10.2-fold increase vs control group) (Figure 3C, Table 2). Transcriptome data also showed that CCR2, Ly6C1, and Ly6C2 were significantly upregulated in the model group compared to the control group (5-fold, 14.6-fold, and 9.5-fold increases, respectively). In contrast, HHQG intervention significantly reduced CCR2, Ly6C1, and Ly6C2 expression by 7-fold, 3.8-fold, and 8.9-fold, respectively, while upregulating Cx3cr1 and Fcgr4 by 9.5-fold and 6-fold (Tables 3 and 4).
| Gene name | D-5 | T-5 | log2 fold change | P value |
| Pparg | 162.46 | 98.41 | -0.7190 | 0.00517415 |
| Stat1 | 723.84 | 320.51 | -1.1774 | 6.01E-11 |
| Csf1 | 355.52 | 200.93 | -0.8192 | 1.19E-05 |
| Stat2 | 1410.80 | 895.83 | -0.6543 | 7.52E-06 |
| Tlr2 | 238.08 | 75.68 | -1.6471 | 1.21E-09 |
| Nfekbie | 105.56 | 51.49 | -1.0276 | 0.00017910 |
| Csf3r | 219.95 | 117.95 | -0.8960 | 0.00092885 |
| Tlr4 | 224.86 | 63.67 | -1.8085 | 1.99E-10 |
| Irf1 | 709.64 | 265.39 | -1.4161 | 1.09E-07 |
| Csf1r | 3924.30 | 1401.87 | -1.4844 | 2.11E-12 |
| Csf2rb | 750.01 | 204.98 | -1.8676 | 9.20E-12 |
| Cd163 | 1221.77 | 394.60 | -1.6296 | 4.51E-25 |
| Csf2ra | 246.42 | 104.53 | -1.2365 | 7.50E-09 |
| Csf2rb2 | 280.50 | 62.45 | -2.1636 | 1.34E-16 |
| CD86 | 217.67 | 107.85 | -1.0108 | 1.42E-05 |
| Arg2 | 23.43 | 8.33 | -1.4792 | 0.00882463 |
| Klf4 | 95.40 | 53.11 | 0.8507 | 0.00486715 |
| Stat5b | 1046.13 | 1806.45 | 0.7879 | 1.93E-10 |
| Ppargc1a | 167.31 | 376.35 | 1.1685 | 5.96E-06 |
| Nr4A3 | 6.19 | 49.79 | 3.0034 | 2.18E-07 |
| Cebpb | 1472.50 | 4302.12 | 1.3658 | 3.08E-09 |
| Ppargc1b | 70.46 | 133.48 | 0.9218 | 0.00012760 |
| Nr4A1 | 70.71 | 722.02 | 3.3517 | 1.15E-06 |
| Nr4A2 | 6.50 | 31.72 | 2.2805 | 0.00035749 |
| Gene name | D-5 | C | log2 fold change | P value |
| CCR2 | 431.029 | 29.565 | 3.8715 | 4.42E-27 |
| Ly6C1 | 65.660 | 12.382 | 2.4093 | 3.90E-09 |
| Ly6C2 | 277.276 | 29.254 | 3.2445 | 6.86E-14 |
| Gene name | D-5 | C | log2 fold change | P value |
| CCR2 | 391.564 | 55.161 | -2.8240 | 1.66E-15 |
| Ly6C1 | 57.467 | 15.409 | -1.9182 | 3.18E-05 |
| Ly6C2 | 254.435 | 28.409 | -3.1597 | 4.95E-14 |
| Cx3cr1 | 36.552 | 347.887 | 3.2465 | 4.77E-06 |
| Fcgr4 | 185.408 | 1113.257 | 2.5863 | 1.19E-26 |
To validate the findings of transcriptomic research and explore the role of macrophage polarization in the liver protection mediated by HHQG, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and immunohistochemical analysis were conducted. The RT-qPCR results indicated that the expression of the macrophage marker F4/80 in the model group was significantly higher than that in the control group on the 2nd, 5th, and 7th days after liver injury (P < 0.0001), while the expression of F4/80 in the HHQG intervention group was significantly lower than that in the model group at all time points (P < 0.001) (Figure 4A).
Regarding the anti-inflammatory cytokines associated with M2 macrophages, qRT-PCR showed that CX3CR1 and YM-1 in the model group temporarily increased on specific days, while IL-10 decreased on the 2nd day and TGF-β remained unchanged. In contrast, HHQG significantly upregulated CX3CR1, TGF-β, YM-1, and IL-10 at all time points (P < 0.05; Figure 4B). Immunohistochemistry confirmed that the basal expression levels of YM-1 and TGF-β were low in the control group, extremely low in the model group at all time points, while the expression in the HHQG group increased significantly on the 2nd and 5th days and remained at a relatively high level on the 7th day (Figure 4C and D).
Immunohistochemical staining of F4/80 revealed that Kupffer cells were evenly distributed in the hepatic sinusoids of mice in the control group. In contrast, in the model group, obvious infiltration of monocytes/macrophages was observed in the periportal area and around the necrotic foci on the 2nd day, and the infiltration in the damaged area intensified by the 5th day. The HHQG intervention group significantly reduced the infiltration at both time points, with only a small number of cells remaining around the portal vein. By the 7th day, inflammation in both groups was alleviated. In the HHQG group, inflammation almost subsided, and macrophages were evenly distributed (Figure 4E).
Further immunohistochemical staining of T-cell immunoglobulin and mucin domain-containing protein 4 (TIMD4) (a marker of tissue-resident Kupffer cells) and CD11b (a marker of monocyte/bone marrow-derived infiltrating macrophages) showed spatial and temporal changes consistent with the above results (Figure 5A). In the control group, TIMD4 was hardly expressed in the hepatic sinusoids, while in the model group, the number of TIMD4-positive cells significantly increased in the necrotic foci and surrounding tissues on the 2nd and 5th days; although there was partial recovery by the 7th day, it was still higher than that in the control group. The HHQG-treated group significantly reduced the number and distribution of TIMD4-positive Kupffer cells at all time points, with particularly obvious recovery on the 2nd and 5th days, and approaching the control level on the 7th day. The expression of CD11b in the model group increased significantly on the 2nd day, reached a peak on the 5th day, and was mainly concentrated around the portal vein and necrotic foci; it decreased with the subsidence of inflammation by the 7th day. HHQG intervention significantly inhibited the recruitment of CD11b+ infiltrating cells (significantly lower than that in the model group at all time points), with only a small number of positive cells remaining around the portal vein (Figure 5B). These results support the macrophage lineage remodeling suggested by transcriptomics and the pro-repair polarization effect mediated by HHQG. Meanwhile, the immunohistochemical results of PPARγ further support the above conclusions. In the model group, the expression of PPARγ was significantly upregulated on the 2nd and 5th days, and although it decreased on the 7th day, it was still higher than that in the control group, suggesting that acute injury increased the activity of PPARγ. In contrast, HHQG treatment significantly reduced the number and staining intensity of PPARγ-positive cells at all time points, especially on the 2nd and 5th days, and by the 7th day, it had returned to a level close to that of the control group (Figure 5C).
Expression of NR4A1 and NR4A2, key regulators of macrophage polarization, was analyzed via qRT-PCR and immunohistochemistry. The qRT-PCR results showed that the expression of NR4A2 in the model group decreased on the second day (P < 0.05). Compared with the control group, HHQG significantly upregulated the expression of NR4A1 and NR4A2 at all time points (P < 0.05) (Figure 6A). Immunohistochemistry revealed decreased nuclear NR4A1/NR4A2 expression in hepatocytes and macrophages of the model group on days 2 and 5, coinciding with tissue necrosis, whereas the HHQG group showed significantly higher expression at these time points, with sustained elevation on day 7 (Figure 6B and C). In a standalone HHQG treatment experiment, qRT-PCR revealed significant NR4A1/NR4A2 upregulation (P < 0.01) (Figure 6D), and immunohistochemistry demonstrated dose-dependent increases in expression with higher HHQG doses (Figure 6E). These results collectively indicate that HHQG inhibits the infiltration of pro-inflammatory macrophages and promotes M2 polarization by up-regulating anti-inflammatory cytokines, which may be related to the activation of NR4A1/NR4A2.
To verify the regulatory effects of HHQG on macrophage polarization and NR4A1/NR4A2, non-cytotoxic doses were first screened via the cell counting kit-8 assay (Figure 7A). Two concentrations, 50 μg/mL and 100 μg/mL, were selected for pre-treating RAW264.7 cells. Subsequently, M1 polarization was induced by LPS + IFN-γ, and M2 polarization was induced by IL-4. The expression of relevant phenotypic genes was detected using RT-qPCR. As shown in Figure 7B, the pro-inflammatory factors inducible nitric oxide synthase, TNF-α, CCL2, and IL-6 were significantly upregulated in the M1 induction group. Figure 7C showed a significant increase in the expression of CX3CR1, YM-1, TGF-β, and IL-10 in the M2 induction group, confirming the successful establishment of the M1 and M2 model.
In the established M1 (LPS + IFN-γ-induced) and M2 (IL-4-induced) macrophage models, RT-qPCR and ELISA results consistently demonstrated that HHQG could significantly regulate the macrophage phenotype towards an anti-inflammatory/repair direction. RT-qPCR results indicated that compared with the M1 model group, HHQG treatment significantly downregulated the mRNA expression of M1 marker gene inducible nitric oxide synthase and pro-inflammatory factors TNF-α, CCL2, and IL-1β (P < 0.01) (Figure 7D), suggesting its inhibition of pro-inflammatory gene transcriptional induction; simultaneously, compared with the M2 model group, HHQG significantly upregulated the mRNA levels of M2 marker YM-1 and anti-inflammatory factors IL-10, TGF-β, and chemokine receptor CX3CR1 (P < 0.01) (Figure 7E), suggesting enhanced M2 phenotype gene expression.
ELISA assays further confirmed the above transcriptional changes at the protein level: HHQG treatment significantly reduced the secretion levels of M1-related pro-inflammatory cytokines TNF-α, CCL2, and IL-1β (P < 0.01) (Figure 8A), while significantly increasing the secretion of M2-related protein Arg1 and anti-inflammatory factors IL-10 and TGF-β (P < 0.01) (Figure 8B). In summary, qPCR and ELISA data consistently support that HHQG can inhibit the M1 pro-inflammatory phenotype and promote the transformation towards the M2 anti-inflammatory/repair phenotype in vitro.
Similarly, the qRT-PCR results indicated that the mRNA levels of NR4A1 and NR4A2 were significantly upregulated in the HHQG treatment group under both M1 (LPS + IFN-γ) and M2 (IL-4) induction conditions, with statistical significance (P < 0.01) (Figure 9). Dose comparison revealed that the 50 μg/mL group exhibited a stronger regulatory effect in inhibiting pro-inflammatory factor expression and promoting anti-inflammatory factor expression compared to the 100 μg/mL group, indicating a non-linear dose-response relationship in the in vitro model (Figure 9).
This study utilized the five main key compounds (apigenin, emodin, genistein, kaempferol, quercetin) of HHQG for treating liver injury obtained from our previous research (Wang et al[16]). Molecular docking technology was employed to simulate the interactions between these key compounds and NR4A1 and NR4A2. The results indicated that in terms of binding affinity, according to the highest Vina scores, apigenin had the lowest Vina score (-8.2) in the NR4A1 system, suggesting the most stable binding with the NR4A1 receptor; quercetin had the lowest Vina score (-8.2) in the NR4A2 system, indicating the strongest binding ability with the NR4A2 receptor. A lower Vina score implies a more stable ligand-receptor binding and a more favorable change in free energy. Regarding the binding cavity volume, the binding cavity volume of ligands related to NR4A1 was 535 Å3, and that of ligands related to NR4A2 was 15818 Å3. A larger volume may provide more binding space and flexibility for ligands but also increase the binding complexity. In terms of the binding center and docking size, the coordinates of the binding center of the NR4A1 system were (-10, -18, 69), and the docking size was (21, 21, 21); the coordinates of the binding center of the NR4A2 system were (-32, 24, 48), and the docking size was (35, 35, 35). These parameters define the spatial range for docking to search for ligand binding sites, and different settings may affect the diversity and accuracy of docking results. Analysis of contact residues showed that each ligand - receptor complex had specific contact residues. For example, in the interaction between NR4A1 and apigenin, there were LEU118A, LEU175A, LEU24A, etc. These residues stabilize the complex structure through various interaction modes. The differences in contact residues between different ligands and receptors reflect the diversity of binding modes. In conclusion, the key compounds of HHQG exhibit differential binding characteristics with NR4A1 and NR4A2 receptors. Apigenin and quercetin have the strongest binding affinities in their corresponding systems respectively. Analysis of contact residues provides clues for understanding the molecular mechanism (Figure 10, Supplementary Table 1). These results contribute to exploring the regulatory mechanism of receptor function and providing a theoretical basis for drug design. In the future, experiments can be conducted for verification and in-depth exploration of the roles of key contact residues.
This study systematically evaluated the protective effect of HHQG in CCL4-induced liver injury, with a focus on its bidirectional regulation of macrophage polarization. It is important to note that although a large body of evidence has emerged in recent years indicating that liver macrophages have significant heterogeneity in terms of lineage, spatial distribution, and temporal dynamics, including both resident Kupffer cells and monocyte-derived macrophages recruited during injury, and exhibit a continuous spectrum of phenotypic plasticity during the initiation, progression, and resolution of inflammation (Wang et al[16]; Yang et al[7]), for the sake of simplicity and quantification, this study still employed the classic M1/M2 framework, mainly using “pro-inflammatory/anti-inflammatory” markers to assess the effect of HHQG. According to this classification, M1 macrophages amplify inflammation and promote cell apoptosis and fibrosis progression in the early stage of liver injury by secreting IL-1β, IL-6, and generating reactive oxygen species (Jin et al[17]; Peng et al[18]; Shu et al[19]; Zhang et al[20]), while the M2 subtype alleviates inflammation and supports repair by releasing IL-10, TGF-β, clearing apoptotic cells, and promoting tissue remodeling (Ko et al[21]; Li et al[22]; Shapouri-Moghaddam et al[23]; Zhang et al[24]). Therefore, the polarization state of macrophages becomes a key determinant in the process of liver injury and provides a potential target for therapeutic intervention.
This study found that HHQG could inhibit the expression of M1-related pro-inflammatory factors and promote the upregulation of M2-related anti-inflammatory and reparative markers, suggesting that it helps to reduce inflammation and promote healing by shifting the functional state of macrophages. However, it should be recognized that the M1/M2 simplified classification cannot fully capture the complex heterogeneity and dynamic transformation of liver macro
This study demonstrated that HHQG could inhibit pro-inflammatory M1 polarization and promote anti-inflammatory/repair-oriented M2 polarization, and molecular docking and expression analysis suggested that its effect was at least partially achieved through NR4A1 and NR4A2. It is worth noting that the different subtypes of the NR4A family have distinct focuses in macrophage regulation. NR4A1 is crucial for the development and homeostasis of specific monocytes, inhibits the M1 pro-inflammatory phenotype, and promotes anti-inflammatory/clearance of apoptotic cells and other repair programs; NR4A2 exhibits clear anti-inflammatory functions in macrophages and participates in metabolic reprogramming; while the function of NR4A3 is highly context-dependent, with reports both of its inhibition of pro-inflammatory genes and promotion of repair, as well as its association with pro-inflammatory phenotypes in certain inflammatory or metabolic states, indicating that it acts more like a buffer factor that adjusts its response based on temporal, spatial, and metabolic contexts within the family. Although in some of our samples or analyses, the expression trend of NR4A3 was consistent with that of NR4A1/2, this study did not include NR4A3 in the systematic docking screening and did not list it as a main basis for the conclusion.
As a classic Mongolian medicine formula, the uniqueness of HHQG lies in the synergistic effect of its complex components, which endows it with more comprehensive therapeutic effects (Bai and Fu[25]). Unlike single-component drugs, HHQG builds a multi-faceted therapeutic network by integrating multiple herbal components, enabling simultaneous intervention in multiple pathological processes such as inflammation, fibrosis, and tissue regeneration. The novel mechanism by which HHQG regulates macrophage polarization provides a new perspective and theoretical basis for integrating traditional Mongolian medicine into modern medical practice. Although this study highlights the potential of HHQG as a candidate drug for liver diseases, the key molecular mechanisms still need to be further confirmed. Based on the changes in expression, molecular docking and pathway association analysis, this study suggests that NR4A1/2 may be involved in its immunomodulatory effects, but the causal relationship has not been directly verified through intervention methods such as gene silencing or overexpression. Subsequent studies should adopt genetic and pharmacological strategies (such as knockdown/knockout, overexpression, subtype-specific ligands or antagonists), time series sampling and single-cell resolution analysis, combined with functional experiments (such as phagocytosis of apoptotic cells, cytokine secretion profiles and metabolic reprogramming assessment), to systematically evaluate the exact role of NR4A1/2/3 in HHQG-mediated macrophage remodeling and liver tissue repair. In conclusion, this study provides a preliminary theoretical framework for the pharmacological mechanism of HHQG and its development as an immunometabolic modulator. Through more refined and function-oriented research in the future, it is expected to reveal the molecular details of its protective effects and promote the translational application of HHQG in the precise treatment of liver diseases.
Although this study highlights the significant therapeutic potential of HHQG as a candidate drug for liver diseases, key mechanistic details remain to be elucidated. However, based on the changes in expression, molecular docking, and pathway association, this study infers that NR4A1/2 is involved in the action of HHQG, but genetic silencing or overexpression of NR4A1/2 has not been implemented to directly verify the causal relationship. Therefore, subsequent studies need to systematically evaluate the exact role of NR4A1/2/3 in HHQG-mediated macrophage remodeling and liver tissue repair through genetic or pharmacological interventions (such as knockdown/knockout, overexpression, specific ligands or antagonists), time series and single-cell resolution analysis, as well as functional tests (such as phagocytosis of apoptotic cells, cytokine release and metabolic reprogramming assessment).
In conclusion, this study not only enhances the prospects of HHQG as a candidate drug for liver diseases but also lays a foundational framework for exploring natural compounds as immunometabolic modulators in the era of precision medicine. Future research is expected to further clarify the molecular mechanisms of the protective effect of HHQG and promote its application in precision medical approaches for liver disease management.
This study demonstrated that HHQG exerted significant hepatoprotective effects in CCL4-induced chronic liver injury mice and in an in vitro macrophage model, without obvious hepatotoxicity. Its action was closely related to the regulation of macrophage polarization-inhibiting M1 and inflammatory factors (TNF-α, CCL2, IL-1β, IL-6), and promoting M2 and anti-inflammatory factors (CX3CR1, YM-1, TGF-β, IL-10). Transcriptome and molecular docking suggested that HHQG activated PPAR/Lipid metabolism, inhibited mitogen-activated protein kinase, and upregulated NR4A1/NR4A2, and some active components might directly act on these nuclear receptors. In conclusion, HHQG alleviated liver inflammation by promoting the transformation of macrophages to a repair phenotype, but further mechanism and clinical validation are still needed.
We sincerely extend our gratitude to the Mongolian Medicine Processing Experiment Center and the Mongolian Medicine Basic Experiment Center at the School of Mongolian Medicine, Inner Mongolia Medical University, for providing the experimental platform for this research.
| 1. | Ristic-Medic D, Bajerska J, Vucic V. Crosstalk between dietary patterns, obesity and nonalcoholic fatty liver disease. World J Gastroenterol. 2022;28:3314-3333. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in CrossRef: 16] [Cited by in RCA: 16] [Article Influence: 4.0] [Reference Citation Analysis (2)] |
| 2. | Zhuge A, Li S, Lou P, Wu W, Wang K, Yuan Y, Xia J, Li B, Li L. Longitudinal 16S rRNA Sequencing Reveals Relationships among Alterations of Gut Microbiota and Nonalcoholic Fatty Liver Disease Progression in Mice. Microbiol Spectr. 2022;10:e0004722. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1] [Cited by in RCA: 83] [Article Influence: 20.8] [Reference Citation Analysis (2)] |
| 3. | Tacke F, Zimmermann HW. Macrophage heterogeneity in liver injury and fibrosis. J Hepatol. 2014;60:1090-1096. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 927] [Cited by in RCA: 879] [Article Influence: 73.3] [Reference Citation Analysis (2)] |
| 4. | van der Heide D, Weiskirchen R, Bansal R. Therapeutic Targeting of Hepatic Macrophages for the Treatment of Liver Diseases. Front Immunol. 2019;10:2852. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 88] [Cited by in RCA: 203] [Article Influence: 29.0] [Reference Citation Analysis (0)] |
| 5. | Yang Y, Jia X, Qu M, Yang X, Fang Y, Ying X, Zhang M, Wei J, Pan Y. Exploring the potential of treating chronic liver disease targeting the PI3K/Akt pathway and polarization mechanism of macrophages. Heliyon. 2023;9:e17116. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 38] [Reference Citation Analysis (0)] |
| 6. | Taru V, Szabo G, Mehal W, Reiberger T. Inflammasomes in chronic liver disease: Hepatic injury, fibrosis progression and systemic inflammation. J Hepatol. 2024;81:895-910. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 236] [Cited by in RCA: 238] [Article Influence: 119.0] [Reference Citation Analysis (0)] |
| 7. | Yang Y, Ni M, Zong R, Yu M, Sun Y, Li J, Chen P, Li C. Targeting Notch1-YAP Circuit Reprograms Macrophage Polarization and Alleviates Acute Liver Injury in Mice. Cell Mol Gastroenterol Hepatol. 2023;15:1085-1104. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 60] [Reference Citation Analysis (1)] |
| 8. | Ye L, Wang L, Kuang G, Zhang Z, Peng Q, He M, Fan J. IL-27 aggravates acute hepatic injury by promoting macrophage M1 polarization to induce Caspase-11 mediated Pyroptosis in vitro and in vivo. Cytokine. 2025;188:156881. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 6] [Cited by in RCA: 7] [Article Influence: 7.0] [Reference Citation Analysis (0)] |
| 9. | Zhao T, Zhong G, Wang Y, Cao R, Song S, Li Y, Wan G, Sun H, Huang M, Bi H, Jiang Y. Pregnane X Receptor Activation in Liver Macrophages Protects against Endotoxin-Induced Liver Injury. Adv Sci (Weinh). 2024;11:e2308771. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 13] [Cited by in RCA: 26] [Article Influence: 13.0] [Reference Citation Analysis (0)] |
| 10. | Patiño-Martínez E, Solís-Barbosa MA, Santana E, González-Domínguez E, Segovia-Gamboa NC, Meraz-Ríos MA, Córdova EJ, Valdés J, Corbí ÁL, Sánchez-Torres C. The Nurr7 agonist Cytosporone B differentially regulates inflammatory responses in human polarized macrophages. Immunobiology. 2022;227:152299. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 12] [Reference Citation Analysis (0)] |
| 11. | Lith SC, Evers TMJ, Freire BM, van Tiel CM, Vos WG, Mashaghi A, de Vries CJM. Nuclear receptor Nur77 regulates immunomechanics of macrophages. Eur J Cell Biol. 2024;103:151419. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 9] [Reference Citation Analysis (0)] |
| 12. | Nakanishi R, Kurauchi Y, Kotani S, Hitora-Imamura N, Seki T, Katsuki H. Structurally Distinct Nurr1 Ligands Exhibit Different Pharmacological Characteristics in Regulating Inflammatory Responses of Microglial BV-2 Cells. Biol Pharm Bull. 2024;47:1937-1945. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 4] [Reference Citation Analysis (0)] |
| 13. | Wang H, Xi Z, Deng L, Pan Y, He K, Xia Q. Macrophage Polarization and Liver Ischemia-Reperfusion Injury. Int J Med Sci. 2021;18:1104-1113. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 15] [Cited by in RCA: 82] [Article Influence: 16.4] [Reference Citation Analysis (0)] |
| 14. | Wang L, Bao Y, Tong H, Zhang K, Cheng Y, Jin H, Shi J, Wang T, Wang H, Chen G, Wang C. Traditional Mongolian medicine (HHQG) attenuates CCl(4)-induced acute liver injury through inhibiting monocyte/macrophage infiltration via the p-P38/p-JNK pathway. J Ethnopharmacol. 2022;293:115152. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 2] [Cited by in RCA: 5] [Article Influence: 1.3] [Reference Citation Analysis (0)] |
| 15. | Tang SM, Deng XT, Zhou J, Li QP, Ge XX, Miao L. Pharmacological basis and new insights of quercetin action in respect to its anti-cancer effects. Biomed Pharmacother. 2020;121:109604. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 552] [Cited by in RCA: 430] [Article Influence: 71.7] [Reference Citation Analysis (3)] |
| 16. | Wang C, Ma C, Gong L, Guo Y, Fu K, Zhang Y, Zhou H, Li Y. Macrophage Polarization and Its Role in Liver Disease. Front Immunol. 2021;12:803037. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 479] [Cited by in RCA: 470] [Article Influence: 94.0] [Reference Citation Analysis (1)] |
| 17. | Jin GL, Liu HP, Huang YX, Zeng QQ, Chen JX, Lan XB, Xin ZM, Xiong BJ, Yue RC, Yu CX. Koumine regulates macrophage M1/M2 polarization via TSPO, alleviating sepsis-associated liver injury in mice. Phytomedicine. 2022;107:154484. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 5] [Cited by in RCA: 58] [Article Influence: 14.5] [Reference Citation Analysis (0)] |
| 18. | Peng J, Li J, Huang J, Xu P, Huang H, Liu Y, Yu L, Yang Y, Zhou B, Jiang H, Chen K, Dang Y, Zhang Y, Luo C, Li G. p300/CBP inhibitor A-485 alleviates acute liver injury by regulating macrophage activation and polarization. Theranostics. 2019;9:8344-8361. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 85] [Cited by in RCA: 90] [Article Influence: 12.9] [Reference Citation Analysis (0)] |
| 19. | Shu B, Zhou YX, Li H, Zhang RZ, He C, Yang X. The METTL3/MALAT1/PTBP1/USP8/TAK1 axis promotes pyroptosis and M1 polarization of macrophages and contributes to liver fibrosis. Cell Death Discov. 2021;7:368. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 12] [Cited by in RCA: 128] [Article Influence: 25.6] [Reference Citation Analysis (4)] |
| 20. | Zhang J, Liu Y, Chen H, Yuan Q, Wang J, Niu M, Hou L, Gu J, Zhang J. MyD88 in hepatic stellate cells enhances liver fibrosis via promoting macrophage M1 polarization. Cell Death Dis. 2022;13:411. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1] [Cited by in RCA: 83] [Article Influence: 20.8] [Reference Citation Analysis (0)] |
| 21. | Ko CY, Lin YY, Achudhan D, Chang JW, Liu SC, Lai CY, Huang YL, Tsai CH, Fong YC, Chen HT, Lee KT, Huang CC, Chang TK, Tang CH. Omentin-1 ameliorates the progress of osteoarthritis by promoting IL-4-dependent anti-inflammatory responses and M2 macrophage polarization. Int J Biol Sci. 2023;19:5275-5289. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 60] [Reference Citation Analysis (0)] |
| 22. | Li K, Yan G, Huang H, Zheng M, Ma K, Cui X, Lu D, Zheng L, Zhu B, Cheng J, Zhao J. Anti-inflammatory and immunomodulatory effects of the extracellular vesicles derived from human umbilical cord mesenchymal stem cells on osteoarthritis via M2 macrophages. J Nanobiotechnology. 2022;20:38. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 7] [Cited by in RCA: 175] [Article Influence: 43.8] [Reference Citation Analysis (1)] |
| 23. | Shapouri-Moghaddam A, Mohammadian S, Vazini H, Taghadosi M, Esmaeili SA, Mardani F, Seifi B, Mohammadi A, Afshari JT, Sahebkar A. Macrophage plasticity, polarization, and function in health and disease. J Cell Physiol. 2018;233:6425-6440. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 4483] [Cited by in RCA: 3920] [Article Influence: 490.0] [Reference Citation Analysis (4)] |
| 24. | Zhang P, Wang J, Miao J, Zhu P. The dual role of tissue regulatory T cells in tissue repair: return to homeostasis or fibrosis. Front Immunol. 2025;16:1560578. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 11] [Reference Citation Analysis (0)] |
| 25. | Bai L, Fu M. Traditional Mongolian medicine: Past, present and future. Chin Herb Med. 2022;14:343-344. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 7] [Reference Citation Analysis (0)] |