Published online Aug 15, 2026. doi: 10.4251/wjgo.122057
Revised: May 16, 2026
Accepted: June 22, 2026
Published online: August 15, 2026
Processing time: 121 Days and 6.5 Hours
The proteasome subunit beta (PSMB) 5 is a core catalytic subunit of the 20S pro
To investigate the subcellular localization of PSMB5, its clinical prognostic value, and functional role in invasion and migration in CRC.
Immunohistochemistry, reverse transcription quantitative real-time polymerase chain reaction, western blot, and subcellular fractionation were used to investigate the PSMB5 expression and localization in CRC tissues (n = 129) and cell lines. The prognostic value was assessed using Kaplan-Meier and Cox regression analyses. The PSMB5 functional role was examined using small interfering RNA-mediated knockdown followed by invasion and migration assays.
PSMB5 was significantly overexpressed in tumor tissue clinical samples compared to adjacent normal mucosa. Additionally, it showed heterogeneous subcellular localization (cytoplasmic, nuclear, or both). The high expression and nuclear localization were strongly associated with aggressive clinicopathological features that included poor differentiation, deep invasion, metastasis, and an advanced tumor, node, metastasis stage. Moreover, nuclear PSMB5 localization was identified using a multivariate analysis as an independent prognostic factor for poor overall survival. In vitro, PSMB5 was overexpressed at both the mRNA and protein levels in CRC cell lines; and its nuclear enrichment was markedly heightened in cell lines with metastatic potential. Functionally, the silencing of PSMB5 robustly inhibited the invasive and migratory capacities of CRC cells.
Nuclear-localized PSMB5, beyond mere overexpression, may serve as a novel independent prognostic biomarker, a functional requirement for invasion/migration, and a potential therapeutic target in CRC.
Core Tip: This is the first study to investigate the subcellular localization of proteasome subunit beta (PSMB) 5 in colorectal cancer (CRC). We demonstrate that nuclear PSMB5 localization, rather than total PSMB5 expression, serves as an independent prognostic biomarker for poor overall survival in CRC patients. Functional assays show that PSMB5 silencing significantly impairs CRC cell invasion and migration. Notably, metastatic CRC cell lines exhibit higher nuclear-to-cytoplasmic PSMB5 ratios than non-metastatic counterparts. These findings establish nuclear-localized PSMB5 as a novel prognostic indicator and a potential therapeutic target in CRC.
- Citation: Xu AP, She SP, Xiao YS, Lang J, Yuan JF, Zeng YF. Nuclear localization of proteasome subunit beta 5 serves as an independent prognostic biomarker and promotes invasion in colorectal cancer. World J Gastrointest Oncol 2026; 18(8): 122057
- URL: https://www.wjgnet.com/1948-5204/full/v18/i8/122057.htm
- DOI: https://dx.doi.org/10.4251/wjgo.122057
Colorectal cancer (CRC) remains a major global health issue, with increasing incidence and mortality rates, particularly in regions with high socioeconomic development[1]. According to the latest global cancer statistics, CRC accounts for approximately 1.9 million new cases and 0.9 million deaths annually worldwide. This makes it the third most commonly diagnosed malignancy and the second leading cause of cancer-related death[1]. In China, it ranks second and fourth in incidence and mortality, respectively[2]. Progress has occurred in the integration of multidisciplinary approaches that include surgery, chemotherapy, targeted therapy, immunotherapy, and personalized medicine[3]; however, resistance to chemotherapy and targeted therapies remains a significant challenge. Therefore, there is an urgent need for reliable and efficient biomarkers in clinical practice.
The ubiquitin-proteasome system (UPS) is a multi-subunit proteolytic complex responsible for ubiquitin-dependent protein degradation in eukaryotic cells[4]. It regulates key cellular processes such as DNA repair, cell proliferation, survival, and differentiation, and drug resistance. It plays a vital role in the maintenance of cellular homeostasis[5,6]. UPS dysregulation can contribute to various diseases, including cancer. The 26S proteasome is the most prevalent form in eukaryotes and it consists of two 19S regulatory particles and a barrel-shaped catalytic core particle, also known as the “20S proteasome”. This complex is composed of four stacked rings, each made of seven subunits, that can be either α (proteasome subunit alpha 1-7) or β-type (PSMB1-7) that share an α/β sandwich-fold structure[7]. An elevated mRNA expression of PSMB subunits has been observed in neoplastic tissues compared to normal tissues[8,9]. Additionally, PSMB8 downregulation has been shown to inhibit proliferation, migration, and invasion of clear cell renal carcinoma cells[10]. PSMB2 has also been shown to play an oncogenic role in glioma and correlate with the immune microenvironment[11]. PSMB2 knockdown is known to suppress proteasome activity, inhibit cell proliferation, promote apoptosis, and block nuclear respiratory factor 1 activation in gastric cancer cells[12]. PSMB4 overexpression is known to enhance breast cancer cell growth and viability, leading to a poor prognosis[13]. These findings collectively underscore the PSMB family’s significant, yet heterogeneous, contributions to tumorigenesis across cancer types.
As a core subunit of the 20S proteasome, PSMB5 is essential for the rate-limiting step during the hydrolysis of ubiquitin-conjugated proteins due to its chymotrypsin-like activity[14,15]. It plays a crucial role in the elimination of misfolded proteins and intracellular protein level regulation[16]. Recent studies have indicated that PSMB5 is upregulated in several cancers[17-19], including hepatocellular, prostate, and breast cancers, and its dysregulation is associated with tumor cell proliferation, metastasis, immunosuppression, and bortezomib (BTZ) resistance[17-20]. Notably, emerging evidence across different cancer types has begun to establish PSMB5 as a promising prognostic marker. For instance, Plakoula et al[21] (2025) demonstrated that lower PSMB5 levels in bone marrow mononuclear cells were associated with prolonged disease-free survival in patients with BTZ-resistant multiple myeloma . Concurrently, an integrative multi-omics study identified PSMB5 as a key prognostic gene in bladder cancer, showing that its knockdown inhibited tumor cell proliferation and migration[22]. Notably, while the oncogenic functions of PSMB5 are emerging, its role in CRC remains largely unexplored. Moreover, the clinical and biological implications of its subcellular localization pattern have not been assessed.
In this study, we aim to comprehensively investigate the clinicopathological and prognostic significance of PSMB5 in CRC, with a particular focus on its subcellular localization, which was a previously overlooked aspect. To accomplish this, we first examined its expression and subcellular distribution in clinical specimens to evaluate their correlation with clinicopathological features and patient prognosis. In addition, we examined these factors in a panel of CRC cell lines to establish an in vitro model. We then employed a loss-of-function approach to validate the PSMB5 functional role in driving CRC cell invasion and migration. Finally, by integrating our results, we synthesized a testable mechanistic model that linked PSMB5 nuclear accumulation to aggressive CRC progression.
A total of 129 paraffin-embedded CRC tissue samples were retrospectively collected between 2016 and 2018 from the Department of Pathology at Jiangxi Provincial People’s Hospital that is affiliated with the First Affiliated Hospital of Nanchang Medical College (Nanchang, China). The patients were followed-up with for 5 years. This study adhered to ethical standards and was approved by the Ethics Committee of Jiangxi Provincial People’s Hospital [Approval No. KeKuai-2024-(15)], with all participants providing informed consent, which granted a waiver of informed consent due to the retrospective nature of the study and the use of de-identified archived tissue specimens.
Seven CRC cell lines (LoVo, SW620, SW480, HCT116, HT29, RKO, and LS174T) and one immortalized normal colorectal epithelial cell line (FHC) were obtained from the Cell Bank of the Chinese Academy of Sciences, Shanghai, China. SW480 and HCT116 were cultured in the Roswell Park Memorial Institute Medium-1640 medium (Hyclone, UT, United States) with 10% fetal bovine serum (FBS; Gibco, NY, United States), whereas SW620, RKO, and LS174T were cultured in the Dulbecco’s Modified Eagle Medium (Hyclone, UT, United States) with 10% FBS. The LoVo and HT29 cells were cultured in F12K and McCOY’s 5A media, respectively, also with 10% FBS. The FHC was maintained in a Dulbecco’s Modified Eagle Medium/F12 medium with 10% FBS. Among these, LoVo and SW620 are derived from metastatic sites, while SW480, HCT116, HT29, RKO, and LS174T were derived from primary tumors. All cell lines were incubated at 37 °C in a humidified atmosphere with 5% CO2.
Immunohistochemistry (IHC) was performed on 129 paraffin-embedded CRC tissue samples. Briefly, 4-μm-thick sections were deparaffinized, rehydrated, and subjected to antigen retrieval in pH 9.0 Tris-ethylenediaminetetraacetic acid buffer using a pressure cooker. The endogenous peroxidase activity was quenched with 3% H2O2. The sections were then incubated with an anti-PSMB5 polyclonal primary antibody (1:300; Abcepta Ltd., Jiangsu Province, China) for 1 hour at room temperature. This was followed by incubation with a horseradish peroxidase-conjugated secondary antibody (Maixin Biotechnology, Fujian Province, China) for 30 minutes at 37 °C. Signal development was performed using diaminobenzidine with hematoxylin counterstaining.
The PSMB5 expression was independently evaluated by three pathologists blinded to clinical data. A semi-quantitative scoring system was employed that integrated the staining intensity and extent according to previously described criteria[23,24]. The intensity was scored as 0 (negative), 1 (weak), 2 (moderate), or 3 (strong). The percentage of positive tumor cells (extent) was scored as 0 (0%), 1 (1%-25%), 2 (26%-50%), 3 (51%-75%), or 4 (76%-100%). The final score (range 0-12) was obtained by multiplying the intensity and extent scores. Based on this, cases were categorized as negative (0-2), weak (3-4), medium (5-8), or strong (9-12). PSMB5 low expression was defined as (-) or (+), i.e., a final score ≤ 4; and PSMB5 high expression was defined as (++) or (+++), i.e., a final score ≥ 5. For the subcellular (nuclear vs cytoplasmic) localization analysis, cases with completely negative PSMB5 expressions (final score = 0) were excluded, as the absence of staining precluded a reliable assessment of the subcellular distribution.
The total RNA was extracted from cells or tissues using TRIzol reagent (Invitrogen, CA, United States) following the manufacturer’s protocol. The RNA concentration and purity were assessed using a Nanodrop spectrophotometer (Thermo Fisher Scientific, NY, United States), and the integrity was verified using agarose gel electrophoresis. For cDNA synthesis, 1 μg of the total RNA was reverse transcribed using the PrimeScript reverse transcription reagent Kit with gDNA Eraser (Takara Bio, Shiga, Japan). Quantitative real-time polymerase chain reaction was subsequently performed using the TB Green Premix Ex Taq II kit (Takara Bio, Shiga, Japan) on a StepOnePlus Real-Time Polymerase Chain Reaction System (Applied Biosystems, CA, United States). Each 20-μL reaction contained 10 μL of premix, 0.8 μL of each primer (10 μmol/L, sequences in Table 1), and 2 μL of cDNA. The thermal cycling protocol consisted of an initial denaturation at 95 °C for 30 seconds, followed by 40 cycles of 95 °C for 5 seconds and 60 °C for 30 seconds. A melting curve analysis was conducted to ensure amplification specificity. All reactions were run in technical triplicate with no-template controls. The relative PSMB5 mRNA expression was calculated using the 2-ΔΔCt method[25], with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the endogenous control.
| Gene name | Primer sequence (5’ → 3’) | Product size (bp) | GenBank accession No. |
| PSMB5 | Forward: AGC TGC TGG AGG AGT TCA TC | 152 | NM_002797.4 |
| Reverse: GGT CCA GGT CCA GAA GTT GT | |||
| GAPDH | Forward: GGA GCG AGA TCC CTC CAA AAT | 197 | NM_002046.7 |
| Reverse: GGC TGT TGT CAT ACT TCT CAT GG |
Whole-cell protein extraction and western blot: To analyze of total protein expression, cells were washed twice with ice-cold PBS and lysed in a radioimmunoprecipitation assaybuffer supplemented with a 0.1% protease inhibitor cocktail and 0.5% phenylmethylsulfonyl fluoride (Keygentec, Jiangsu Province, China). Protein concentrations were quantified using the a bicinchoninic acid assay. Equal amounts of protein (50 μg per lane) were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes (Merck Millipore, Burlington, MA, United States). After blocking with 5% non-fat milk in Tris-buffered saline with Tween-20 for 1 hour at room temperature, the membranes were incubated overnight at 4 °C with the following primary antibodies: Anti-PSMB5 (1:300; Abcepta Ltd., CA, United States) and GAPDH (1:500; Abbkine Scientific Co., Ltd., GA, United States). Following three washes with Tris-buffered saline with Tween-20, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (1:2000; Abbkine Scientific Co., Ltd., GA, United States) for 1 hour at room temperature. Protein bands were visualized using BeyoECL Plus chemiluminescent detection reagents (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s instructions.
Subcellular fractionation: To obtain the cytoplasmic and nuclear protein fractions, the Nuclear and Cytoplasmic Protein Extraction Kit (catalog # P0027; Beyotime Biotechnology, Shanghai, China) was used according to the manufacturer’s instructions. Briefly, approximately 1 × 106 cells were harvested, washed with ice-cold PBS, and resuspended in 200 μL of Cytoplasmic Extraction Reagent A containing 1 mmol/L phenylmethylsulfonyl fluoride. After vigorous vortexing and incubation on ice for 15 minutes, 10 μL of cytoplasmic extraction reagent B was added. The supernatant, containing the cytoplasmic fraction, was collected following centrifugation at 12000 × g for 5 minutes at 4 °C. The remaining pellet was then resuspended in 50 μL of nuclear extraction reagent, vortexed thoroughly, and incubated on ice for 30 minutes with intermittent vortexing. The nuclear fraction was obtained by centrifugation at 12000 × g for 10 minutes at 4 °C. The protein concentration of each fraction was determined using the bicinchoninic acid assay. A western blot analysis was then performed as described in previous subsection, with anti-Lamin B1 (1:1000; Proteintech Group, Inc., IL, United States) used as an additional nuclear loading control.
Loss-of-function studies were the performed to investigate the PSMB5 functional role. To rigorously minimize potential off-target effects, a pool of three distinct small interfering RNAs (siRNAs) specifically targeting human PSMB5 (small interfering PSMB5-pool) was used as the primary knockdown approach (sequences listed in Table 2). A non-targeting control siRNA [designated as “Scramble”] with the sequence 5’-UUCUCCGAACGUGUCACGUdTdT-3’ (where ‘dT’ denotes deoxythymidine) was purchased from GenePharma (Shanghai, China). The siRNA sequences within the pool are proprietary (GenePharma, Shanghai, China) and designed for maximal knockdown efficiency and specificity. For transfection, the CRC cells were seeded and allowed to adhere overnight. Complexes were formed by mixing the siRNA (final concentration 20 nM for the pool or Scramble) with Lipofectamine RNAiMAX transfection reagent (Invitrogen, CA, United States) in an Opti-MEM and then added to the cells. Cells were harvested for RNA and protein extraction 48 hours post-transfection to verify the knockdown efficiency, and for functional assays 72 hours post-transfection.
| siRNA name/ID | Target sequence (DNA notation) | Actual synthesized oligo (5’ → 3’) | Target position |
| siPSMB5-#1 | TCGAATCTATGAGCTTCGAAATA | UCGAAUCUAUGAGCUUCGAAAUAdTdT | 385-407 |
| siPSMB5-#2 | GTGCTTGAAACCTAAGTCATTTG | GUGCUUGAAACCUAAGUCAUUUGdTdT | 538-560 |
| siPSMB5-#3 | GACTGTCATTGGTAATACGGACA | GACUGUCAUUGGUAAUACGGACAdTdT | 935-955 |
| Scramble (siControl) | TTCTCCGAACGTGTCACGTTT | UUCUCCGAACGUGUCACGUdTdT | N/A |
The initial confirmatory experiments using two independent short hairpin RNAs yielded consistent results. The se
We did not select LoVo for the loss-of-function experiments due to its extremely low transfection efficiency (< 15%), despite repeated optimization attempts. Instead, we selected the isogenic pair SW480 (primary CRC tumor-derived) and SW620 (lymph node metastasis-derived from the same patient), which share a similar genetic background and, more importantly, exhibit high transfection efficiency - ensuring robust and reproducible functional data for subsequent invasion and migration assays.
For the Transwell invasion assay, 72 hours post-transfection, 1 × 105 cells in a serum-free medium were seeded into the upper chambers of Matrigel-coated inserts (Corning, NY, United States). A complete medium containing 10% FBS was added to the lower chamber as a chemoattractant. After 24 hours of incubation, cells that invaded through the Matrigel were fixed, stained with 0.1% crystal violet, and counted under a microscope in five random fields.
For the wound healing migration assay, 72 hours post-transfection, a uniform scratch was created in a confluent cell monolayer using a sterile 200-μL pipette tip. The width of the scratch was photographed at 0 hour and 24 hours under a microscope. The migration rate was calculated as the percentage of wound closure.
All functional assays were performed in triplicate and repeated at least three independent times using cells transfected with the small interfering PSMB5-pool or Scramble.
The statistical analyses were performed using the SPSS version 27.0 (Statistical Package for the Social Sciences; IBM Corp., Armonk, NY, United States). Normality of continuous data was assessed using the Shapiro-Wilk test. The Mann-Whitney U test was used to compare the PSMB5 protein expression between the CRC tissues and matched adjacent mucosa tissues. It was also used to compare the expressions among CRC tissues, lymph node metastatic tissues, and distant metastatic tissues. The χ2 test was used to analyze the relationship between PSMB5 expression and clinicopathological parameters. A Kaplan-Meier survival curve analysis was used to evaluate the association between PSMB5 expression and patient prognosis. The Cox proportional hazards regression model was used to identify factors that influenced the CRC prognosis. PSMB5 expression in CRC cell lines was analyzed using a one-way analysis of variance followed by a Tukey’s post hoc test. Differences between the two groups in functional assays were assessed using a Student’s t-test. A two-sided P < 0.05 was considered statistically significant.
To investigate PSMB5 expression in CRC and its clinicopathological relevance, we performed an IHC analysis on a cohort of paraffin-embedded samples that included 129 primary CRC cases with matched adjacent normal mucosa, 56 lymph node metastases, and 4 distant metastases (Table 3). Notably, although 29 distant metastases were clinically documented, only 4 were surgically resected and available for pathological evaluation. The IHC revealed that PSMB5 was localized to both the cytoplasm and nucleus of the CRC cells (Figure 1). Strong immunostaining was observed in primary CRC tissues (Figure 1A and B), whereas the adjacent normal mucosa exhibited minimal or faint staining (Figure 1C). The positive expression rate of PSMB5 in CRC tissues was 97.7%, with strong, moderate, and weak positivity rates of 38.8%, 37.2%, and 21.7%, respectively (Table 3), which was significantly higher than the 30.2% positivity rate in the adjacent normal mucosa (P < 0.01). Moreover, PSMB5 expression was significantly elevated in metastatic lymph node carcinomas (Figure 1D and Table 3, P = 0.04) and showed a non-significant increasing trend in liver metastases (Table 3, P > 0.05) compared to primary tumors (Figure 1A). Among the lymph node metastases, 64.3% exhibited strong positivity (Table 3). All four liver metastasis cases exhibited moderate to strong PSMB5 expression (Figure 1E and F). While the comparison did not reach statistical significance (n = 4, P > 0.05), this small-sample observation suggests that further study in larger cohorts is warranted to examine whether an elevated PSMB5 expression is associated with metastatic progression in CRC. A χ2 analysis demonstrated that high PSMB5 expression was significantly associated with poor tumor differentiation (P = 0.002), deeper invasion depth (P = 0.006), lymph node metastasis (P = 0.001), distant metastasis (P = 0.001), and an advanced tumor, node, and metastasis (TNM) stage (P = 0.001). No significant correlations were found with age (P = 0.458), gender (P = 0.954), or tumor size (P = 0.798; Table 4).
| Parameters | Total number (n = 129) | High expression (n = 98) | Low expression (n = 31) | χ2 value | P value |
| Age (years) | |||||
| < 60 | 55 | 40 | 15 | 0.552 | 0.458 |
| ≥ 60 | 74 | 58 | 16 | ||
| Gender | |||||
| Male | 66 | 50 | 16 | 0.003 | 0.954 |
| Female | 63 | 48 | 15 | ||
| Tumor size (cm) | |||||
| < 5 | 64 | 48 | 16 | 0.065 | 0.798 |
| ≥ 5 | 65 | 50 | 15 | ||
| Differentiation | |||||
| Well/moderate | 105 | 74 | 31 | 9.327 | 0.002a |
| Poor | 24 | 24 | 0 | ||
| Depth of invasion | |||||
| T1-T2 | 21 | 11 | 10 | 7.645 | 0.006a |
| T3-T4 | 108 | 87 | 21 | ||
| Lymph node metastasis | |||||
| No | 73 | 45 | 28 | 18.902 | 0.001a |
| Yes | 56 | 53 | 3 | ||
| Distant metastasis | |||||
| No | 100 | 69 | 31 | 11.834 | 0.001a |
| Yes | 29 | 29 | 0 | ||
| TNM stage | |||||
| I-II | 61 | 33 | 28 | 30.320 | 0.001a |
| III-IV | 68 | 65 | 3 | ||
We then examined the subcellular localization pattern of PSMB5. In poorly differentiated CRC tissues, 62.5% of the cases exhibited predominantly nuclear PSMB5 localization, 29.2% showed combined nuclear and cytoplasmic localization, and only 8.3% showed cytoplasmic localization alone (Table 5). In contrast, in well-differentiated and moderately differentiated tissues, PSMB5 was primarily localized to the cytoplasm (55.9%), with 26.5% showing nuclear localization and 17.7% showing both nuclear and cytoplasmic localization. Nuclear localization of PSMB5 was significantly associated with poor differentiation (P = 0.001), deeper invasion (P = 0.002), lymph node metastasis (P = 0.001), distant metastasis (P = 0.001), and advanced TNM stage (P = 0.001), but not with age, gender, or tumor size (all P > 0.05). These data suggest that the nuclear accumulation of PSMB5 is closely linked to the malignant progression of CRC.
| Parameters | Total number | Cytoplasm (n = 56) | Nucleus (n = 41) | Cytoplasm and nucleus | χ2 value | P value |
| Age (years) | ||||||
| < 60 | 54 | 25 | 19 | 10 | 0.186 | 0.911 |
| ≥ 60 | 72 | 34 | 23 | 15 | ||
| Gender | ||||||
| Male | 65 | 30 | 18 | 17 | 2.233 | 0.442 |
| Female | 61 | 26 | 23 | 12 | ||
| Tumor size (cm) | ||||||
| < 5 | 62 | 31 | 18 | 13 | 1.018 | 0.601 |
| ≥ 5 | 64 | 28 | 24 | 12 | ||
| Differentiation | ||||||
| Well/moderate | 102 | 57 | 27 | 18 | 18.246 | 0.001a |
| Poor | 24 | 2 | 15 | 7 | ||
| Depth of invasion | ||||||
| T1-T2 | 19 | 16 | 2 | 1 | 12.566 | 0.002a |
| T3-T4 | 107 | 43 | 40 | 24 | ||
| Lymph node metastasis | ||||||
| No | 71 | 52 | 11 | 8 | 45.793 | 0.001a |
| Yes | 55 | 7 | 31 | 17 | ||
| Distant metastasis | ||||||
| No | 97 | 55 | 25 | 17 | 17.143 | 0.001a |
| Yes | 29 | 4 | 17 | 8 | ||
| TNM stage | ||||||
| I-II | 59 | 49 | 4 | 6 | 59.797 | 0.001a |
| III-IV | 67 | 10 | 38 | 19 | ||
The prognostic significance of PSMB5 was evaluated using a Kaplan-Meier survival analysis. Among the 129 CRC cases, 98 exhibited high PSMB5 expression (++ to +++) and 31 showed low expression (- to +; Table 4). Patients with high PSMB5 expression had a significantly lower five-year overall survival rate (67.3%) compared to those with low expression (93.5%; P = 0.003, log-rank test; Figure 2A). This result indicated that an elevated PSMB5 expression correlates with poor prognosis. We further assessed the impact of PSMB5 subcellular localization on patient survival. Patients with nuclear PSMB5 expression had a five-year survival rate of 50.0%, and those with both nuclear and cytoplasmic expression had a five-year survival rate of 56.0%. In striking contrast, patients with only cytoplasmic PSMB5 localization exhibited a markedly higher survival rate of 98.3%. Survival outcomes were significantly worse for patients with nuclear or combined localization than for those with cytoplasmic localization alone (P < 0.001, log-rank test; Figure 2B), underscoring the adverse prognostic value of PSMB5 nuclear localization.
A univariate Cox regression analysis identified both a high PSMB5 expression and nuclear localization as significant prognostic factors (P = 0.01 and P = 0.001, respectively; Table 6). A multivariate analysis further confirmed that the nuclear localization of PSMB5, together with other pathological parameters, can serve as an independent prognostic factor of overall survival in CRC patients (P = 0.016; Table 6).
| Parameters | Univariate Cox regression | Multivariate Cox regression | ||||
| HR | 95%CI for HR | P value | HR | 95%CI for HR | P value | |
| Age | 1.716 | 0.836-3.525 | 0.141 | |||
| Gender | 0.829 | 0.422-1.628 | 0.586 | |||
| Tumor size | 0.677 | 0.342-1.340 | 0.263 | |||
| Differentiation | 0.266 | 0.132-0.532 | 0.001b | 0.548 | 0.261-1.151 | 0.112 |
| Depth of invasion | 27.467 | 0.637-1184.629 | 0.085 | |||
| Lymph node metastasis | 3.599 | 1.717-7.543 | 0.001b | 0.325 | 0.120-0.876 | 0.026a |
| Distant metastasis | 7.417 | 3.692-14.898 | 0.001b | 2.521 | 1.071-5.934 | 0.034a |
| TNM stage | 19.904 | 4.760-83.235 | 0.001b | 9.455 | 1.434-62.343 | 0.020a |
| PSMB5 expression | 6.477 | 1.549-27.075 | 0.010a | 0.856 | 0.097-7.515 | 0.888 |
| PSMB5 localization1 | 0.001b | 0.016a | ||||
| PSMB5 localization (1)2 | 41.534 | 5.576-309.408 | 0.001b | 18.069 | 2.137-152.804 | 0.008b |
| PSMB5 localization (2)3 | 33.024 | 5.256-320.203 | 0.001b | 24.432 | 2.754-216.782 | 0.004b |
Collectively, these findings established that an elevated PSMB5 expression and its nuclear localization are hallmarks of aggressive CRC biology and a poor clinical outcome.
To explore the relationship between PSMB5 expression and metastatic propensity in vitro, we analyzed a panel of CRC cell lines with distinct metastatic potentials. The panel included two metastatic cell lines (SW620 and LoVo), five-primary tumor-derived cell lines (RKO, SW480, LS174T, HCT116, and HT29), and one immortalized normal colorectal epithelial cell line (FHC). First, a quantitative real-time polymerase chain reaction analysis revealed that the PSMB5 mRNA levels were substantially elevated in all CRC cell lines compared to the FHC control (Figure 3A). The metastatic cell lines SW620 and LoVo exhibited the highest upregulation, with PSMB5 expression increased by 38.8-fold and 67.0-fold, respectively. The primary cell lines also showed marked overexpression that ranged from 13.9-fold (LS174T) to 30-fold (RKO; Figure 3A). These findings indicate that PSMB5 is transcriptionally upregulated in CRC cells, with a pronounced enrichment in lines that possess metastatic capacity.
This upregulation was confirmed at the protein level using a western blot analysis that detected a specific 28 kDa band corresponding to PSMB5 in all tested cell lines, including FHC (Figure 3B). Consistent with the mRNA data, the PSMB5 protein abundance was notably higher in metastatic cell lines compared to most of the primary lines. Collectively, these results demonstrated a strong positive correlation between PSMB5 expression - both transcriptional and translational - and the metastatic potential of CRC cell lines.
We further asked whether the aggressive phenotype was linked to a specific subcellular distribution of PSMB5. Subcellular fractionation and a western blot analysis revealed distinct compartmentalization patterns (Figure 3C-E, arranged from left to right). While PSMB5 was detectable in both the cytoplasm and nucleus across all of the cell lines (Figure 3C), the metastatic lines SW620 and LoVo exhibited pronounced nuclear accumulation. A quantitative analysis demonstrated that the nuclear-to-cytoplasmic ratio of PSMB5 was significantly higher in these metastatic lines compared to those of the non-metastatic primary lines (RKO, SW480, LS174T, HCT116, HT29) or the normal FHC cells (Figure 3D). This nuclear enrichment was also evident when calculating the percentage of the total PSMB5 protein residing in the nucleus (Figure 3E). Notably, this differential localization occurred independently of the total protein overexpression observed in Figure 3B. This result suggested that nuclear trafficking is a specifically regulated process in aggressive cells.
Collectively, these results demonstrated a strong positive correlation between PSMB5 expression, both transcriptional and translational, and the metastatic potential of CRC cell lines. Additionally, the results further identified the nuclear enrichment of PSMB5 as a distinctive feature of metastatic cells.
Efficient knockdown of PSMB5 mRNA: Transfection with the small interfering PSMB5-pool resulted in an efficient and significant reduction of the PSMB5 mRNA levels in the SW620 and SW480 cells compared to that of the Scramble, as determined by quantitative real-time polymerase chain reaction (Figure 4A).
Concurrent depletion of PSMB5 protein in cytoplasmic and nuclear compartments: This transcriptional knockdown led to a pronounced decrease in PSMB5 protein abundance. A western blot analysis of the whole-cell lysates confirmed the protein level reduction (Figure 4B). Moreover, subcellular fractionation followed by western blotting demonstrated that the PSMB5 protein depletion occurred concurrently in both the cytoplasmic and nuclear fractions (Figure 4C-E). The purity of the fractions was verified by the exclusive presence of the cytoplasmic marker GAPDH and the nuclear marker Lamin B1.
The above results demonstrated that PSMB5, particularly its nuclear localization, was associated with malignant progression and poor prognosis in CRC patients and correlated with metastatic potential in CRC cell lines. Furthermore, we confirmed that the siRNA-mediated knockdown effectively reduced the PSMB5 levels in both the cytoplasmic and nuclear compartments. Based on these findings, we then sought to determine whether PSMB5 functionally contributed to CRC cell invasion and migration.
The results of the Matrigel-coated Transwell assays showed that depletion of PSMB5 significantly attenuated the invasive capacity of both cell lines (Figure 5). Similarly, the wound healing assays revealed that PSMB5 silencing markedly impaired cell migration, as evidenced by a substantially slower wound closure rate (Figure 6). Collectively, these data demonstrated that PSMB5 is a potent promoter of CRC cell invasion and migration in vitro. These key findings were independently corroborated using two distinct short hairpin RNA constructs (Supplementary Figures 1-3).
Metastasis is the primary cause of mortality in CRC[26]. However, effective treatments for metastatic disease remain limited. This therapeutic challenge underscores the urgent need to identify novel biomarkers and drivers of metastatic progression to guide improved diagnostic and therapeutic strategies.
The UPS is the principal pathway for targeted protein degradation in eukaryotic cells, responsible for the turnover of over 80% of intracellular proteins and thus essential for maintaining proteostasis[4]. Beyond protein quality control, the UPS precisely regulates the stability of key proteins involved in critical processes such as DNA repair, cell cycle pro
We showed that an elevated PSMB5 protein expression was significantly associated with aggressive features that included poor differentiation, deep tumor invasion, lymph node and distant metastasis, and an advanced TNM stage. Consequently, patients with high PSMB5 expression exhibited markedly worse overall survival. These findings are consistent with the oncogenic profile of PSMB5 reported in other cancer types[17-20,27]. Complementary experiments in CRC cell lines demonstrated that both mRNA and protein levels of PSMB5 are higher in metastatic cell lines compared to non-metastatic or normal colonic epithelial cells, further reinforcing the link between PSMB5 and aggressive CRC phenotypes.
Notably, our study uncovered a critical layer of regulation beyond mere expression levels: The subcellular localization of PSMB5. We observed that PSMB5 can be localized in the cytoplasm, nucleus, or both compartments in CRC cells. Strikingly, nuclear PSMB5 localization (either alone or combined with cytoplasmic staining) was strongly correlated with more aggressive disease characteristics-such as poorer differentiation, metastasis, and advanced stage-and conferred a significantly worse prognosis compared to purely cytoplasmic localization. Multivariate Cox analysis further identified the nuclear PSMB5 expression as an independent prognostic factor. These results suggest that the nuclear translocation of PSMB5 is not a passive consequence but may actively contribute to CRC malignancy. This finding aligns with a very recent integrative multi-omics study in bladder cancer, which identified PSMB5 as a key prognostic gene and demonstrated that its knockdown inhibits tumor cell proliferation and migration, underscoring the conserved oncogenic role of PSMB5 across different tumor types[22].
To functionally validate the pro-metastatic role of PSMB5 suggested by our clinical data, we performed the loss-of-function experiments in vitro. Silencing PSMB5 expression significantly impaired the invasive and migratory capacities of CRC cells. Collectively, these functional and clinical findings establish PSMB5 as a promoter of CRC cell motility and invasion. Having established its functional necessity, we sought to understand the cellular basis for its association with metastasis.
Importantly, our complementary analysis in CRC cell lines provided a mechanistic clue that bridges the clinical observation and the functional phenotype. We found that metastatic cell lines (SW620, LoVo) not only overexpress PSMB5 but also display a significantly higher nuclear-to-cytoplasmic ratio compared to their non-metastatic counterparts. This cell-autonomous nuclear accumulation recapitulates the nuclear localization pattern observed in the aggressive primary tumors and lymph node metastases. It strongly suggests that the nuclear translocation of PSMB5 is a regulated process associated with the acquisition of metastatic competence, rather than a passive consequence of generalized protein overexpression.
The mechanistic implications of PSMB5 nuclear localization are intriguing. While its canonical role resides in cytoplasmic protein turnover, the nuclear proteasome is known to perform specialized functions, including the spatially and temporally controlled degradation of nuclear regulatory proteins such as transcription factors[28]. For instance, the epithelial-mesenchymal transition (EMT)-transcription factor snail (SNAI1) is a canonical substrate of the UPS, and its targeted degradation has been shown to suppress EMT in gastrointestinal cancers[29]. Consistently, studies in other cancer types have shown that pharmacological targeting of the proteasome complex suppress cancer progression by modulating the stability of EMT regulators such as snail[30]. In our study, we observed that metastatic CRC cell lines and aggressive patient tumors exhibit nuclear enrichment of PSMB5. Conversely, targeted depletion of PSMB5 via siRNA led to a marked reduction of the protein in both nuclear and cytoplasmic compartments, as confirmed by western blotting. Based on these observations together with the established role of the proteasome in regulating EMT-related transcription factors, we speculate cautiously that the nuclear enrichment of PSMB5 might drive the aberrant degradation of certain transcription factors, which could potentially activate gene expression programs conducive to EMT and metastatic dissemination. However, it is important to emphasize that this mechanistic hypothesis is not directly tested in the present study, and the references cited involve different proteins and different cancer types. Nevertheless, the observed correlation between nuclear PSMB5 localization and poor prognosis, raises the hypothesis that systematic identification of PSMB5’s nuclear substrates represent an important direction for future investigation.
One limitation of this study should be acknowledged. Although our clinical and cellular data consistently supported the role of PSMB5 as a prognostic biomarker in CRC, we did not perform in vivo xenograft experiments to validate its function in tumor growth or metastasis. Future studies using animal models, such as subcutaneous or orthotopic xenografts of PSMB5-knockdown CRC cells in nude mice, are warranted to further corroborate the biological significance of PSMB5 in CRC progression.
Additionally, while the precise nuclear substrates remain to be identified, this spatial redistribution suggests a profound rewiring of nuclear proteostasis in advanced CRC. Therefore, future studies aimed at deciphering the exact molecular mechanisms - for instance, by defining the nuclear interactome of PSMB5 via immunoprecipitation mass spectrometry or tracking its dynamics with live-cell imaging - will be crucial to determine whether it promotes metastasis by degrading tumor suppressors or stabilizing oncogenes.
In conclusion, the nuclear localization of PSMB5 - rather than its total expression level - serves as a robust and independent prognostic biomarker in CRC. It is also functionally required for the invasive and migratory capacities of CRC cells. Together, these findings establish nuclear-localized PSMB5 as a promising therapeutic target.
The authors thank Mr. Feng Xiong from Department of Pathology, and Mr. Chang-Hui Xiong from Department of Science and Education, Jiangxi Provincial People’s Hospital, The First Affiliated Hospital of Nanchang Medical College, for their valuable assistance (technical assistance in preparing histological sections and guidance on statistical analysis, respectively).
| 1. | Morgan E, Arnold M, Gini A, Lorenzoni V, Cabasag CJ, Laversanne M, Vignat J, Ferlay J, Murphy N, Bray F. Global burden of colorectal cancer in 2020 and 2040: incidence and mortality estimates from GLOBOCAN. Gut. 2023;72:338-344. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1885] [Cited by in RCA: 1726] [Article Influence: 575.3] [Reference Citation Analysis (12)] |
| 2. | Han B, Zheng R, Zeng H, Wang S, Sun K, Chen R, Li L, Wei W, He J. Cancer incidence and mortality in China, 2022. J Natl Cancer Cent. 2024;4:47-53. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1395] [Cited by in RCA: 1687] [Article Influence: 843.5] [Reference Citation Analysis (5)] |
| 3. | Mangone L, Zizzo M, Nardecchia M, Marinelli F, Bisceglia I, Braghiroli MB, Banzi MC, Damato A, Cerullo L, Pellegri C, Morabito F, Neri A, Fabozzi M, Pinto C, Giorgi Rossi P. Impact of Multidisciplinary Team Management on Survival and Recurrence in Stage I-III Colorectal Cancer: A Population-Based Study in Northern Italy. Biology (Basel). 2024;13:928. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 10] [Reference Citation Analysis (0)] |
| 4. | Ciechanover A. The ubiquitin-proteasome proteolytic pathway. Cell. 1994;79:13-21. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1314] [Cited by in RCA: 1352] [Article Influence: 42.3] [Reference Citation Analysis (0)] |
| 5. | Zhang X, Linder S, Bazzaro M. Drug Development Targeting the Ubiquitin-Proteasome System (UPS) for the Treatment of Human Cancers. Cancers (Basel). 2020;12:902. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 31] [Cited by in RCA: 96] [Article Influence: 16.0] [Reference Citation Analysis (0)] |
| 6. | Chauhan AK, Sun Y, Zhu Q, Wani AA. Timely upstream events regulating nucleotide excision repair by ubiquitin-proteasome system: ubiquitin guides the way. DNA Repair (Amst). 2021;103:103128. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3] [Cited by in RCA: 17] [Article Influence: 3.4] [Reference Citation Analysis (0)] |
| 7. | Nandi D, Tahiliani P, Kumar A, Chandu D. The ubiquitin-proteasome system. J Biosci. 2006;31:137-155. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 605] [Cited by in RCA: 516] [Article Influence: 25.8] [Reference Citation Analysis (0)] |
| 8. | Zhou DM, Liu J, Liu F, Luo GW, Li HT, Zhang R, Chen BL, Hua W. A novel FoxM1-PSMB4 axis contributes to proliferation and progression of cervical cancer. Biochem Biophys Res Commun. 2020;521:746-752. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1] [Cited by in RCA: 8] [Article Influence: 1.1] [Reference Citation Analysis (1)] |
| 9. | Blijlevens M, Komor MA, Sciarrillo R, Smit EF, Fijneman RJA, van Beusechem VW. Silencing Core Spliceosome Sm Gene Expression Induces a Cytotoxic Splicing Switch in the Proteasome Subunit Beta 3 mRNA in Non-Small Cell Lung Cancer Cells. Int J Mol Sci. 2020;21:4192. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 7] [Cited by in RCA: 16] [Article Influence: 2.7] [Reference Citation Analysis (0)] |
| 10. | Hao YF, Shi Y, Zheng JX, Zhao XT, Liu SL, Yang LJ. [Effects of Proteasome 20S Subunit Beta 8 on Proliferation,Migration,and Invasion of Clear Cell Renal Cell Carcinoma Cells via Mitogen-Activated Protein Kinase Kinase/Extracellular Signal-Regulated Kinase Signaling Pathway]. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 2024;46:641-652. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 1] [Reference Citation Analysis (0)] |
| 11. | He W, Zhang Z, Tan Z, Liu X, Wang Z, Xiong B, Shen X, Zhu X. PSMB2 plays an oncogenic role in glioma and correlates to the immune microenvironment. Sci Rep. 2024;14:5861. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 9] [Reference Citation Analysis (0)] |
| 12. | Liu Z, Yu C, Chen Z, Zhao C, Ye L, Li C. PSMB2 knockdown suppressed proteasome activity and cell proliferation, promoted apoptosis, and blocked NRF1 activation in gastric cancer cells. Cytotechnology. 2022;74:491-502. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 11] [Reference Citation Analysis (0)] |
| 13. | Wang H, He Z, Xia L, Zhang W, Xu L, Yue X, Ru X, Xu Y. PSMB4 overexpression enhances the cell growth and viability of breast cancer cells leading to a poor prognosis. Oncol Rep. 2018;40:2343-2352. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 6] [Cited by in RCA: 10] [Article Influence: 1.3] [Reference Citation Analysis (0)] |
| 14. | Baumeister W, Cejka Z, Kania M, Seemüller E. The proteasome: a macromolecular assembly designed to confine proteolysis to a nanocompartment. Biol Chem. 1997;378:121-130. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3] [Cited by in RCA: 8] [Article Influence: 0.3] [Reference Citation Analysis (0)] |
| 15. | Baumeister W, Walz J, Zühl F, Seemüller E. The proteasome: paradigm of a self-compartmentalizing protease. Cell. 1998;92:367-380. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1239] [Cited by in RCA: 1126] [Article Influence: 40.2] [Reference Citation Analysis (0)] |
| 16. | Sheng X, Xia Z, Yang H, Hu R. The ubiquitin codes in cellular stress responses. Protein Cell. 2024;15:157-190. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 4] [Cited by in RCA: 89] [Article Influence: 44.5] [Reference Citation Analysis (0)] |
| 17. | Liu J, Mi J, Liu S, Chen H, Jiang L. PSMB5 overexpression is correlated with tumor proliferation and poor prognosis in hepatocellular carcinoma. FEBS Open Bio. 2022;12:2025-2041. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1] [Cited by in RCA: 14] [Article Influence: 3.5] [Reference Citation Analysis (1)] |
| 18. | Fan J, Du W, Zhang H, Wang Y, Li K, Meng Y, Wang J. Transcriptional downregulation of miR-127-3p by CTCF promotes prostate cancer bone metastasis by targeting PSMB5. FEBS Lett. 2020;594:466-476. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 17] [Cited by in RCA: 28] [Article Influence: 4.0] [Reference Citation Analysis (0)] |
| 19. | Wang CY, Li CY, Hsu HP, Cho CY, Yen MC, Weng TY, Chen WC, Hung YH, Lee KT, Hung JH, Chen YL, Lai MD. PSMB5 plays a dual role in cancer development and immunosuppression. Am J Cancer Res. 2017;7:2103-2120. [PubMed] |
| 20. | Yang Y, Gao Y, Huang J, Yang Z, Luo H, Wang F, Xu J, Cui Y, Ding H, Lin Z, Zhai X, Qu Y, Zhang L, Liu T, Ye L, Niu T, Zheng Y. ISG20L2 suppresses bortezomib antimyeloma activity by attenuating bortezomib binding to PSMB5. JCI Insight. 2022;7:e157081. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 8] [Reference Citation Analysis (0)] |
| 21. | Plakoula E, Kalampounias G, Alexis S, Verigou E, Kourakli A, Zafeiropoulou K, Symeonidis A. Prognostic Value of PSMB5 and Correlations with LC3II and Reactive Oxygen Species Levels in the Bone Marrow Mononuclear Cells of Bortezomib-Resistant Multiple Myeloma Patients. Curr Issues Mol Biol. 2025;47:32. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 2] [Reference Citation Analysis (0)] |
| 22. | Chang Z, Wang J, Cao J, Fan X, Li K, Wang C, Zhang Y, Wang L, Yang J, Chen S, Yang L. Targeting PSMB5-induced PANoptosis in bladder cancer: multi-omics insights and TCM candidate discovery. Front Immunol. 2025;16:1656682. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 1] [Reference Citation Analysis (0)] |
| 23. | Lu D, Dai G, Guo H, Huang LH. [Expression of MAP3K3 in endometrial cancer and its relationship with clinicopathological features and prognosis]. Zhongguo Meitai Gongye Yixue Zazhi. 2021;24:337-432. [DOI] [Full Text] |
| 24. | Conner JR, Hirsch MS, Jo VY. HNF1β and S100A1 are useful biomarkers for distinguishing renal oncocytoma and chromophobe renal cell carcinoma in FNA and core needle biopsies. Cancer Cytopathol. 2015;123:298-305. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 26] [Cited by in RCA: 24] [Article Influence: 2.2] [Reference Citation Analysis (0)] |
| 25. | Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-408. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 158539] [Cited by in RCA: 141675] [Article Influence: 5667.0] [Reference Citation Analysis (14)] |
| 26. | Teng S, Li YE, Yang M, Qi R, Huang Y, Wang Q, Zhang Y, Chen S, Li S, Lin K, Cao Y, Ji Q, Gu Q, Cheng Y, Chang Z, Guo W, Wang P, Garcia-Bassets I, Lu ZJ, Wang D. Tissue-specific transcription reprogramming promotes liver metastasis of colorectal cancer. Cell Res. 2020;30:34-49. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 51] [Cited by in RCA: 90] [Article Influence: 15.0] [Reference Citation Analysis (0)] |
| 27. | Zeng T, Yao L, Zhao K, Cong R, Meng X, Song N. Identification and validation of a five apoptosis-related genes signature for prediction of disease-free survival for testicular germ cell tumors. Transl Androl Urol. 2021;10:1250-1272. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1] [Cited by in RCA: 4] [Article Influence: 0.8] [Reference Citation Analysis (0)] |
| 28. | Collins GA, Goldberg AL. The Logic of the 26S Proteasome. Cell. 2017;169:792-806. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 874] [Cited by in RCA: 760] [Article Influence: 84.4] [Reference Citation Analysis (0)] |
| 29. | Zou S, Ma C, Yang F, Xu X, Jia J, Liu Z. FBXO31 Suppresses Gastric Cancer EMT by Targeting Snail1 for Proteasomal Degradation. Mol Cancer Res. 2018;16:286-295. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 24] [Cited by in RCA: 51] [Article Influence: 5.7] [Reference Citation Analysis (0)] |
| 30. | Jing C, Li X, Zhou M, Zhang S, Lai Q, Liu D, Ye B, Li L, Wu Y, Li H, Yue K, Chen P, Yao X, Wu Y, Duan Y, Wang X. The PSMD14 inhibitor Thiolutin as a novel therapeutic approach for esophageal squamous cell carcinoma through facilitating SNAIL degradation. Theranostics. 2021;11:5847-5862. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 10] [Cited by in RCA: 59] [Article Influence: 11.8] [Reference Citation Analysis (0)] |