miR-4770 promotes colorectal cancer progression by targeting PRKAA2 via m6A modification

Abstract

BACKGROUND

Colorectal cancer (CRC) is a malignant tumor with high incidence, and carries a high risk of morbidity and mortality. Although microRNAs and N6-methyladenosine (m6A) modification have been shown to be involved in the progression of CRC, the specific role of miR-4770 and its m6A-regulated mechanism in CRC is still unclear.

AIM

To investigate whether METTL3-mediated m6A modification regulates miR-4770 expression, and to clarify the functional significance of miR-4770/PRKAA2 axis in the malignant progression of CRC cells.

METHODS

CRC tissue samples and their matched normal counterparts were acquired from ten patients. For in vitro analyses, we used FHC (normal colon epithelial) cells, along with HCT116 and SW480 CRC cells. The amounts of miR-4770, METTL3, PRKAA2, and pri-miR-4770 transcripts were measured via qRT-PCR. Cell viability, migration, and invasion were assessed by MTT and Transwell chamber assays. Western blot analysis was performed to assess PRKAA2 protein abundance and the expression status of important components within the AMPK/mTOR signaling axis. The degree of m6 A modification of pri-miR-4770 and its binding to DGCR8 protein were analyzed by MeRIP and RIP techniques. Dual luciferase reporter assay was used to verify whether PRKAA2 is a direct downstream target of miR-4770. Finally, rescue experiments were carried out by simultaneously inhibiting miR-4770 and knocking down PRKAA2.

RESULTS

In CRC tissues and cell lines, the expression levels of miR-4770 and METTL3 were increased, while the expression of PRKAA2 was decreased. There was a positive correlation between the expression of METTL3 and miR-4770. Knockdown of METTL3 inhibited the expression of miR-4770, reduced the m6A modification level of pri-miR-4770, and reduced the enrichment of pri-miR-4770 and DGCR8 proteins. Conversely, overexpression of METTL3 produced the opposite effect. Functional experiments revealed that inhibiting miR-4770 lowered CRC cell viability, motility, and invasiveness, while forced expression of miR-4770 intensified these aggressive traits. PRKAA2 was identified as a direct target of miR-4770, which negatively modulates its expression at the post-transcriptional level. Downregulating PRKAA2 partly reversed the decreases in CRC cell viability, migration, and invasion that resulted from miR-4770 silencing. Additional experiments in SW480 cells verified that miR-4770 modulates PRKAA2 expression and the activity of the AMPK/mTOR signaling pathway.

CONCLUSION

According to this study, METTL3 likely promotes the processing of miR-4770 in an m6A-dependent manner. Meanwhile, miR-4770 enhances CRC cell viability, migration, and invasion, an effect that is at least partly mediated by direct targeting of PRKAA2 and subsequent regulation of the AMPK/mTOR pathway. The METTL3/miR-4770/PRKAA2 molecular axis could be a potential molecular target for future CRC research on mechanisms and treatment.

Key Words: Colorectal cancer; miR-4770; N6-methyladenosine methylation; METTL3; PRKAA2; Malignant progression

Core Tip: This study investigated the role of miR-4770 in colorectal cancer (CRC) and its regulation by N6-methyladenosine (m6A) modification. The results showed that miR-4770 and METTL3 were upregulated in CRC tissues and cells, whereas PRKAA2 was downregulated. METTL3 may promote the maturation of pri-miR-4770 through m6A modification, thereby increasing miR-4770 expression. Functionally, miR-4770 enhanced CRC cell viability, migration, and invasion by directly targeting PRKAA2 and modulating the AMPK/mTOR signaling pathway. These findings suggest that the METTL3/miR-4770/PRKAA2 axis may provide a potential mechanistic basis for CRC progression.

INTRODUCTION

Worldwide, colorectal cancer (CRC) stands as a leading cause of cancer-related death and is among the most frequently diagnosed malignant diseases[1,2]. Statistically, CRC accounts for over 500000 annual deaths globally. Notably, in developed nations, both the incidence and death rates of CRC have been rising steadily[3,4]. Although the survival rate of CRC patients has improved in recent years with the improvement of screening and treatment methods, most patients have already developed tumor metastasis and drug resistance when diagnosed in the late stage, resulting in poor treatment effect[5,6]. Thus, a thorough understanding of the molecular mechanisms underlying CRC, particularly the regulators involved in its invasion and metastasis, is essential for advancing therapeutic strategies and improving patient outcomes.

It has been established that miRNAs, which are important non-coding RNAs, exert critical control over cancer cell growth, differentiation, programmed cell death, and invasiveness during cancer development and advancement[7-9]. Through interaction with the 3’untranslated regions (3’UTR) of target mRNAs, miRNAs repress gene expression and consequently modulate numerous cancer-associated signaling cascades[10,11]. Multiple studies have shown that miRNAs have a dual role in CRC: Some miRNAs act as tumor suppressor genes (such as miR-143) to play an anti-tumor role, while others act as oncogenes (such as miR-21) to promote tumor progression[12,13]. In this context, miR-4770 has attracted the attention of researchers due to its abnormal expression in various cancers[14], but its specific function in CRC is still unclear, especially whether it is regulated by epigenetic mechanisms has not been fully studied.

Epigenetic regulation, especially N6-methyladenosine (m6A) modification, has played an important role in RNA regulation in recent years[15,16]. m6A modification is a chemical modification widely present in eukaryotic mRNA, which can regulate multiple functions of RNA such as splicing, stability, and translation efficiency[17,18]. The key methyltransferase METTL3 is the main catalytic enzyme of m6A modification and has been found to be closely related to the occurrence and progression of various cancers[19,20]. In CRC, dysregulated METTL3 has been shown to regulate the expression and fate of multiple downstream transcripts through m6A-dependent or m6A-independent mechanisms, thereby affecting tumor cell proliferation, migration, metastasis, and other malignant phenotypes[21-23]. Studies have shown that m6A modification can affect the biological function of miRNA and its role in cancer by regulating the maturation process of pri-miRNA[24]. Mechanistically, METTL3-mediated m6A deposition can mark pri-miRNAs for recognition by the microprocessor component DGCR8, while m6A reader proteins may further facilitate the processing of selected pri-miRNAs into mature miRNAs[25,26]. The question of whether METTL3-mediated m6A methylation governs CRC malignancy by altering miR-4770 expression warrants additional investigation. Another important factor is PRKAA2 (AMPK α2), which critically regulates energy metabolism and has been implicated in the metabolic remodeling that occurs in cancer cells[27]. Studies have shown that PRKAA2 is downregulated in CRC and is closely related to the prognosis of patients[28]. Based on the extensive role of miRNAs in regulating metabolism-related pathways, exploring the relationship between miR-4770 and PRKAA2 is of great significance for understanding its mechanism of action in CRC.

Taken together, the objective of this study is to elucidate the role of miR-4770 in modulating CRC cell motility and invasiveness via m6A-dependent machinery, and to establish how it interacts with PRKAA2. This work not only offers novel perspectives on CRC pathogenesis but also lays a theoretical foundation for potential therapies targeting m6A modifications.

MATERIALS AND METHODS

Patient specimens

A total of 10 paired CRC samples and their corresponding adjacent non-cancerous tissues were retrospectively enrolled in this study. The specimens were derived from CRC patients who underwent curative surgery in our hospital, with diagnosis confirmed by histopathology. The paired non-tumor specimens were collected from macroscopically healthy mucosa located away from the tumor border.

Exclusion criteria included: Preoperative radiotherapy and chemotherapy, recurrent CRC, combined with other malignant tumors, or incomplete clinicopathological data. Patient clinicopathological data are presented in Table 1. Ethical approval for this study was obtained from the hospital’s ethics committee (approval number: 073-01).

Table 1 Clinical and pathological features of colorectal cancer patients, n (%).

Characteristics	CRC patients (n = 10)
Age, years, mean ± SD	65.30 ± 6.15
Sex
Male	6 (60.00)
Female	4 (40.00)
Tumor location
Colon	6 (60.00)
Rectum	4 (40.00)
Adenocarcinoma	10 (100.00)
Differentiation grade
Well/moderate	7 (70.00)
Poor	3 (30.00)
Tumor size, cm	4.68 ± 1.32
T1-T2	4 (40.00)
T3-T4	6 (60.00)
Distant metastasis
No	9 (90.00)
Yes	1 (10.00)
AJCC/TNM stage
I-II	4 (40.00)
III-IV	6 (60.00)

CRC: Colorectal cancer; AJCC: American Joint Committee on Cancer; TNM: Tumor-node-metastasis.

Cell culture and grouping

The in vitro part of this study utilized FHC (normal human colon epithelial) cells, along with HCT116 and SW480 CRC cell lines, all obtained from the ATCC under accession numbers CRL-1831, CCL-247, and CCL-228. According to the supplier’s instructions, FHC cells were grown in a dedicated complete medium for human colonic epithelial cells (Cobioer, China; CBP61139M). For HCT116 and SW480 cells, the culture medium consisted of RPMI 1640 plus 10% fetal bovine serum (FBS, Guangzhou Yujia Biotechnology Co., Ltd., C0893-100 mL). All cell types were maintained at 37 °C in a 5% CO₂ incubator with full humidity and were collected upon reaching the log-phase of growth.

To investigate the roles of miR-4770, METTL3, and PRKAA2, transfection experiments were performed on HCT116 and SW480 cells. To manipulate miR-4770 expression, cells were allocated into four distinct experimental sets: NC inhibitor (negative control inhibitor), miR inhibitor (miR-4770 inhibitor), NC mimic (negative control mimic), and miR mimic (miR-4770 mimic). For METTL3-related experiments, HCT116 cells were divided into: Transfection of negative control siRNA (siNC group), transfection of METTL3 siRNA (si-METTL3 group), transfection of empty vector pcDNA3.1 (NC group), transfection of pcDNA3.1-METTL3 overexpression plasmid (METTL3-oe group). In the PRKAA2 rescue experiment, HCT116 cells were divided into four groups according to the different combinations of miR-4770 inhibitor and PRKAA2 siRNA: NC inhibitor + siNC group, miR inhibitor + siNC group, NC inhibitor + si-PRKAA2 group, miR inhibitor + si-PRKAA2 group.

qRT-PCR

According to the manufacturer's instructions, TRIzol reagent (Guangzhou Yujia Biotechnology Co., Ltd., R0016) was used to extract total RNA from CRC tissues, paired adjacent normal tissues, and FHC, HCT116, and SW480 cells. An ultraviolet spectrophotometer (Thermo Fisher Scientific, 840-317400) was used to assess RNA concentration and purity.

The reverse transcription reaction was done as described in the manual of the kit (Thermo Fisher Scientific, SO131). qRT-PCR was carried out with the SYBR Green kit (Guangzhou Yujia Biotechnology Co., Ltd., D7268S). The PCR program consisted of an initial heating at 95 °C for 10 minutes, followed by 40 cycles of denaturation at 95 °C for 30 seconds, annealing at 60 °C for 30 seconds, and extension at 72 °C for 30 seconds.

Three technical replicates were performed for each sample. The transcript abundance of miR-4770, METTL3, PRKAA2, and pri-miR-4770 was measured in multiple treatment groups (including HCT116 and SW480 cells after transfection). Relative expression of miRNAs was calibrated to U6, and that of mRNAs to GAPDH. Primer sequences for qRT-PCR are listed in Table 2. The comparative 2^-ΔΔCt approach was applied to calculate relative expression levels.

Table 2 The primers used in the present study.

	Forward primer (5'-3')	Reverse primer (5'-3')
mir-4770	GTGAGATGACACTGTAGCT	AGTGCAGGGTCCGAGGTATT
METTL3	TGGGGGTATGAACGGGTAGA	TGGTTGAAGCCTTGGGGATT
PRKAA2	TGAGAAGCAGAAGCACGACG	ACTGCCACTTTATGGCCTGTT

MTT assay

MTT assay was used to assess cell proliferation activity. After seeding at a density of 2 × 10³ cells/well in 96-well plates, cells were cultured for 24 hours, 48 hours, or 72 hours before viability measurement. MTT solution (final concentration 0.5 mg/mL, Guangzhou Yujia Biotechnology Co., Ltd., AF7518) was added to each well, and the plates were incubated for 4 hours. Subsequently, the supernatant was carefully removed, and 150 μL of dimethyl sulfoxide (DMSO, Guangzhou Yujia Biotechnology Co., Ltd., ST038-100 mL) was added to each well to dissolve the formed purple formazan crystals. The OD value of each well was read at 570 nm on a microplate reader, reflecting cell proliferation activity.

Transwell

Cell migration and invasion capabilities were assessed using Transwell chambers. The migration experiment steps were as follows: Into the top compartment (equipped with an 8-μm porous membrane), 200 μL of serum-free cell suspension was added; the bottom compartment was loaded with 600 μL of medium containing 10% FBS, acting as a chemoattractant. Cells were then allowed to incubate for 24 hours at 37 °C in a 5% CO₂ environment. Following incubation, non-migrated cells were wiped away, whereas migrated cells were fixed with 4% paraformaldehyde (Beyotime, P0099) and stained with 0.1% crystal violet (Beyotime, C0121). The number of migrated cells was quantified in five random fields (100 × magnification), and the mean from three independent replicates was calculated for statistical analysis.

Invasion assay: Before cell inoculation, a layer of diluted Matrigel (Guangzhou Yujia Biotechnology Co., Ltd., C0372-1 mL) was pre-coated on the filter membrane and incubated for 30 minutes to solidify. All subsequent steps were identical to those of the migration experiment, but the cells were incubated for 24-48 hours instead of 24 hours.

Western blot

PRKAA2 protein expression in the different experimental arms was evaluated by western blot. Total cellular proteins were extracted with RIPA lysis buffer (L00399, Guangzhou Yujia Biotechnology) from the four groups (NC inhibitor, miR inhibitor, NC mimic, miR mimic), and the concentration was measured using the BCA method. Proteins (30 μg per lane) were subjected to SDS-PAGE and subsequently blotted onto PVDF membranes (Millipore, United States, IPVH00010).

The membrane was blocked with 5% skim milk powder at room temperature for 1 hour, and then added with primary antibodies: PRKAA2 (Abcam, ab3760, 1:5000), p-AMPK (Abcam, ab133448, 1:1000), AMPK (Abcam, ab32047, 1:5000), p-mTOR (CST, #2971, 1:1000), mTOR (Abcam, ab32028, 1:1000), incubated overnight at 4 °C. The next day, HRP-labeled secondary antibodies (goat anti-rabbit IgG H&L/HRP, BIOSS, bs-0295G-HRP, 1:3000) were added at room temperature and incubated for 1 hour. After that, ECL reagent (Thermo Fisher Scientific, 32106) was used for chemiluminescence visualization. GAPDH (Proteintech, 81640-5-RR, 1:10000) served as a loading control for calculating relative expression.

MeRIP

The m6A modification level of pri-miR-4770 in siNC, si-METTL3, NC, and METTL3-oe cells was assessed using methylated RNA immunoprecipitation (MeRIP). RNA was extracted from all cell groups, subjected to DNase treatment to remove genomic DNA, and its concentration measured via NanoDrop. 200 µg of total RNA was incubated with m6A antibody (Abcam, ab151230), and then the RNA-antibody complex was incubated with protein A/G magnetic beads (Millipore, 16-663) for 4 hours to enrich m6A-modified RNA fragments. After extensive washing, the pulled-down RNA was recovered with TRIzol, and the abundance of pri-miR-4770 was quantified by qRT-PCR (normalized to GAPDH).

RIP

Binding of pri-miR-4770 to DGCR8 in different treatment groups was assessed via RIP experiments. Cells from the siNC, si-METTL3, NC, and METTL3-oe groups were harvested and disrupted in RIP lysis buffer to obtain protein-RNA lysates. To pull down RNA fragments interacting with DGCR8, the lysates were exposed to anti-DGCR8-coated magnetic beads (Abcam, ab191875) and kept at 4 °C for an overnight incubation. After the overnight incubation, the beads were subjected to multiple washes using RIP wash buffer (Millipore, 17-700) to remove unrelated bound materials, and RNA was subsequently extracted from the immunoprecipitated pellets. The extracted RNA was used to detect the enrichment level of pri-miR-4770 using qRT-PCR. The control group was treated in parallel with IgG antibodies to exclude the interference of non-specific binding.

Dual luciferase reporter gene experiment

To verify the targeting relationship between miR-4770 and PRKAA2, a dual-luciferase reporter gene experiment was used. First, the wild-type (WT) and mutant (MUT) vectors were generated by inserting the 3’UTR fragment PRKAA2 (which carries the predicted miR-4770 binding site) into the pMIR-REPORT luciferase reporter plasmid. The WT or MUT reporter vector and miR-4770 mimics (or NC) were simultaneously introduced into HEK293T cells. A dual-luciferase detection kit (Promega, E1910) was used to assess luciferase signals at 48 hours post-transfection. The regulatory effect of miR-4770 on PRKAA2 3'UTR was evaluated by detecting the firefly to Renilla luciferase activity ratio. If miR-4770 targets PRKAA2, the firefly luciferase activity will be significantly reduced in the WT vector group, while there will be no significant change in the MUT vector group.

Data analysis

Statistical evaluation was performed using GraphPad Prism 8.0.2. Results are shown as mean values with their SD. At least three independent biological replicates were performed for every experiment, and the replicate counts are provided in the corresponding legends.

The Shapiro-Wilk method was applied to evaluate whether the data followed a normal distribution. When data followed a normal distribution, differences between two groups were assessed by an unpaired two-tailed t-test. Non-normally distributed data were subjected to the Mann-Whitney U test or other non-parametric approaches. To compare multiple groups, we used one-way ANOVA and subsequent Tukey’s multiple comparisons test. A threshold of P < 0.05 indicated a significant difference.

RESULTS

METTL3 regulates miR-4770 expression and its m6A modification

The qRT-PCR analysis showed that the expression of METTL3 was significantly up-regulated in CRC tissues compared with normal tissues (Figure 1A). METTL3 expression was found to be positively correlated with that of miR-4770, as shown by additional correlation analysis (Figure 1B).

Figure 1 The regulation of METTL3 on miR-4770 expression and N6-methyladenosine modification level. A: The expression of METTL3 in colorectal cancer (CRC) tissues and normal tissues was detected by qRT-PCR; B: The expression of miR-4770 was positively correlated with METTL3 in CRC tissues; C-E: The expression of METTL3 (C), miR-4770 (D) and pri-miR-4770 (E) was detected in siNC, si-METTL3, NC and METTL3-oe cells (qRT-PCR); F: RIP assay was used to detect the binding level of pri-miR-4770 and DGCR8 in the above four groups of cells; G: MeRIP assay was used to detect the N6-methyladenosine modification level of pri-miR-4770 in the above four groups of cells. Data were expressed as mean ± SD. ^aP < 0.01 vs normal group; ^bP < 0.05 and ^cP < 0.01 vs siNC group; ^dP < 0.01 vs NC group. Clinical tissue analyses were based on 10 paired CRC and adjacent normal tissues, whereas in vitro experiments were performed with three independent biological replicates. CRC: Colorectal cancer.

At the cellular level, METTL3 expression was significantly down-regulated by si-METTL3 and up-regulated by METTL3-oe, compared with the respective controls. (Figure 1C). The expression trend of miR-4770 was consistent with this: The si-METTL3 group exhibited a marked reduction, whereas the METTL3-oe group showed a pronounced elevation (Figure 1D). On the contrary, the expression of pri-miR-4770 showed the opposite trend: Its expression was significantly up-regulated after METTL3 silencing, while its expression was down-regulated after METTL3 overexpression (Figure 1E).

The results of RIP showed that the depletion of METTL3 (si-METTL3) led to a significant reduction in pri-miR-4770 pull-down. compared with siNC group. METTL3-oe led to significantly higher pri-miR-4770 pull-down levels than those seen in the NC group (Figure 1F). MeRIP analysis further confirmed that pri-miR-4770 m6A levels were significantly lower in the si-METTL3 group than in the siNC group. Compared with the NC group, METTL3 overexpression significantly increased its m6A modification level (Figure 1G).

In summary, these findings suggest that through enhancing the m6A modification of pri-miR-4770, METTL3 promotes its maturation to miR-4770, leading to positive regulation of miR-4770 in CRC.

miR-4770 abundance in CRC and its functional role in regulating cell viability

Compared with non-cancerous tissues, CRC tissues had significantly higher miR-4770 expression as determined by qRT-PCR (Figure 2A). In line with this, miR-4770 levels in HCT116 cells were likewise significantly greater than those seen in normal colonic epithelial FHC cells (Figure 2B).

Figure 2 The expression of miR-4770 in colorectal cancer and its effect on cell viability, migration and invasion. A: The expression of miR-4770 in colorectal cancer (CRC) tissues and adjacent normal tissues was detected by qRT-PCR; B: The expression of miR-4770 in FHC and HCT116 cells was detected by qRT-PCR; C: The expression of miR-4770 in the NC inhibitor, miR inhibitor, NC mimic, and miR mimic groups was detected by qRT-PCR; D: CCK-8 method was used to detect the proliferation activity of the above four groups of cells at 24 hours, 48 hours, and 72 hours; E and F: Transwell assay was used to evaluate the migration (E) and invasion (F) abilities of the above four groups of cells. Scale: 100 μm. The data were expressed as mean ± SD. ^aP < 0.01 vs normal group; ^bP < 0.01 vs FHC group; ^cP < 0.05 and ^dP < 0.01 vs NC inhibitor group; ^eP < 0.05 and ^fP < 0.001 vs NC mimic group. Clinical tissue analysis included 10 paired CRC and adjacent normal tissues, and in vitro experiments were performed with three independent biological replicates. CRC: Colorectal cancer.

In order to study its function, we effectively regulated the expression of miR-4770 by transfection: Relative to the NC inhibitor group, the miR inhibitor group showed a marked reduction in miR-4770 levels; conversely, compared with the NC mimic group, the miR mimic group exhibited a substantial increase in miR-4770 expression (Figure 2C).

The CCK-8 results indicated that cell viability progressively rose over time in every group. Viability was significantly reduced in the miR inhibitor group vs the NC inhibitor control, whereas it was significantly elevated in the miR mimic group vs the NC mimic control (Figure 2D).

Suppression of miR-4770 led to a significant reduction in migrating cell counts, as revealed by transwell experiments, while overexpression significantly increased it (Figure 2E). Invasion experiments also confirmed that miR-4770 knockdown reduced the number of invasive cells, and overexpression enhanced invasive ability (Figure 2F).

In summary, miR-4770 is overexpressed in CRC and enhances cell viability, migration, and invasion, suggesting a potential oncogenic regulatory role in CRC progression.

Validation of PRKAA2 expression and its miR-4770-mediated targeted regulation

We used qRT-PCR, western blotting, and dual-luciferase reporter assays to further explore the regulatory link between miR-4770 and PRKAA2. PRKAA2 transcript levels were markedly lower in CRC tissues than in adjacent normal tissues, as shown by qRT-PCR (Figure 3A). A strong inverse relationship between miR-4770 and PRKAA2 levels was verified by correlation analysis (Figure 3B).

Figure 3 Verification of the targeting relationship between PRKAA2 and miR-4770. A: The mRNA levels of PRKAA2 in colorectal cancer (CRC) tissues and normal tissues were determined by qRT-PCR; B: The expression of the two in CRC tissues was negatively correlated; C: The expression of PRKAA2 was detected by qRT-PCR in four groups of cells: NC inhibitor, miR inhibitor, NC mimic and miR mimic; D: Western blot was used to detect the level of PRKAA2 protein in the above four groups of cells; E: Predicting the target binding sequence of miR-4770 and PRKAA2; F: Dual luciferase reporter assay verified the direct targeting relationship between the two. Data were expressed as mean ± SD. ^aP < 0.01 vs normal group; ^bP < 0.01 vs NC inhibitor group; ^cP < 0.05 vs NC mimic group; ^dP < 0.01 vs miR-4770 NC group. Clinical tissue analyses included 10 paired CRC and adjacent normal tissues, and in vitro experiments were performed with three independent biological replicates. CRC: Colorectal cancer.

In vitro experiments showed that inhibition of miR-4770 significantly up-regulated PRKAA2 mRNA (vs NC inhibitor), while overexpression of miR-4770 down-regulated its expression (vs NC mimic) (Figure 3C). Consistent with the mRNA data, western blotting showed elevated PRKAA2 protein following miR-4770 inhibition and reduced protein levels upon miR-4770 overexpression (Figure 3D).

Bioinformatics predicted the presence of a binding site linking miR-4770 and PRKAA2 3′UTR (Figure 3E). Overexpression of miR-4770 significantly diminished the luciferase activity driven by the WT sequence, as shown by dual-luciferase assay (WT) reporter gene, whereas no significant effect was observed on the MUT construct (MUT) (Figure 3F).

In summary, miR-4770 directly targets and negatively regulates PRKAA2, suggesting that it may promote CRC progression at least in part by inhibiting PRKAA2.

PRKAA2 mediates the role of miR-4770 on cell growth, migration and invasion

Rescue experiments, involving PRKAA2 siRNA under conditions of miR-4770 inhibition or non-inhibition, were carried out to better characterize PRKAA2’s involvement in the regulatory cascade triggered by miR-4770. The extent of PRKAA2 depletion was validated as verified by qRT-PCR: PRKAA2 levels were substantially lower in the si-PRKAA2 group than in the siNC control (Figure 4A).

Figure 4 miR-4770 regulates the viability, migration and invasion of HCT116 cells through PRKAA2. A: QRT-PCR was used to detect the mRNA expression of PRKAA2 in siNC group and si-PRKAA2 group; B: CCK-8 method was used to detect the proliferation activity of four groups of cells at 24 hours, 48 hours and 72 hours: NC inhibitor + siNC, miR inhibitor + siNC, NC inhibitor + si-PRKAA2, miR inhibitor + si-PRKAA2; C and D: Transwell assay was used to evaluate the migration (C) and invasion (D) abilities of the above four groups of cells. Scale: 100 μm. The data are expressed as mean ± SD and are derived from three independent biological replicates. ^aP < 0.01 vs siNC group; ^bP < 0.05 and ^cP < 0.01 vs NC inhibitor + siNC group; ^dP < 0.05 and ^eP < 0.01 vs miR inhibitor + siNC group; ^fP < 0.05 and ^gP < 0.01 vs NC inhibitor + si-PRKAA2 group.

According to CCK-8 measurements, cell viability in each group increased over time (24 hours, 48 hours, 72 hours). The miR inhibitor + siNC group exhibited significantly lower viability than the NC inhibitor + siNC group, while that of the NC inhibitor + si-PRKAA2 group was significantly increased. Notably, cells co-treated with miR inhibitor and si-PRKAA2 showed a marked increase in viability relative to those receiving miR inhibitor alone (Figure 4B).

According to the Transwell migration results (Figure 4C), inhibiting miR-4770 led to a significant reduction in migrated cells relative to the NC inhibitor + siNC control, whereas knockdown of PRKAA2 alone substantially elevated migratory activity. It was further found that co-silencing PRKAA2 could partially reverse the decreased migration ability caused by miR-4770 inhibition, but its migration level was still did not reach the values seen in the NC inhibitor + si-PRKAA2 group.

The invasion experiment (Figure 4D) showed a similar trend: Inhibition of miR-4770 significantly weakened cell invasion ability, and knockdown of PRKAA2 significantly enhanced invasion; co-transfection of si-PRKAA2 partially restored the inhibitory effect of miR-4770 inhibition on invasion, but did not reach the level of NC inhibitor + si-PRKAA2 group. These findings confirm that PRKAA2, as a downstream effector molecule of miR-4770, mediates its regulatory function on CRC cell viability, migration and invasion.

Verification of the regulatory interaction between miR-4770 and PRKAA2 within SW480 cells

In HCT116 and SW480 cells, inhibition of miR-4770 significantly up-regulated p-AMPK/total AMPK and down-regulated p-mTOR/total mTOR ratios, while overexpression of miR-4770 showed the opposite trend. No notable alterations were observed in total AMPK or mTOR protein levels, indicating that miR-4770 mainly affects the phosphorylation activation level of the pathway rather than the total protein expression (Supplementary Figure 1). To corroborate the regulatory influence of universality effect in CRC cell lines, we performed parallel verification in SW480 cells.

qRT-PCR analysis confirmed that compared with normal colonic epithelial FHC cells, miR-4770 and METTL3 transcript levels in HCT116 and SW480 cells was significantly increased, and the levels of PRKAA2 was markedly decreased (Figure 5A).

Figure 5 Expression of miR-4770 in colorectal cancer cells and its regulation of PRKAA2. A: The mRNA levels of miR-4770, METTL3 and PRKAA2 in FHC, HCT116 and SW480 cells were detected by qRT-PCR; B and C: In SW480 cells, qRT-PCR was used to detect the expression of miR-4770 (B) and PRKAA2 (C) in each group, which were divided into NC inhibitor, miR inhibitor, NC mimic and miR mimic; D: Western blot was used to detect the level of PRKAA2 protein in the above four groups of SW480 cells. Data are expressed as mean ± SD and are derived from three independent biological replicates. Statistical difference: ^aP < 0.01 vs FHC group; ^bP < 0.05 and ^cP < 0.01 vs NC inhibitor group; ^dP < 0.01 vs NC mimic group.

Despite a similar pattern across cell lines, SW480 cells showed marginally reduced expression compared with HCT116 cells. Efficient delivery of the constructs into SW480 cells was verified by qRT-PCR. We observed that the levels of miR-4770 in the miR inhibitor group were significantly elevated in vs the control group, while the abundance of miR-4770 in cells subjected to miR mimic group was significantly increased (Figure 5B).

Subsequently, the expression of PRKAA2 was detected. The results of qRT-PCR showed that inhibition of miR-4770 significantly up-regulated the expression of PRKAA2, while overexpression of miR-4770 significantly inhibited the expression of PRKAA2 (Figure 5C). Consistently, western blot analysis showed that PRKAA2 protein levels were increased in the miR inhibitor group and decreased in the miR mimic group (Figure 5D).

Taken together, these findings confirm that miR-4770 negatively regulates PRKAA2 expression and regulates AMPK/mTOR pathway activity in CRC cells, and this regulatory axis is reproducible in different CRC cell lines.

DISCUSSION

The present investigation delineated both the function and the underlying regulatory network of miR-4770 in CRC: via PRKAA2 targeting, miR-4770 markedly promoted CRC cell proliferation, migration, and invasion. Mechanistically, METTL3 potentially facilitates miR-4770 maturation via m6A modification, thereby enhancing its cancer-promoting effect. These findings suggest that miR-4770 promotes CRC progression in a m6A-dependent manner, enriching the understanding of miRNA in cancer biology. In addition, this study confirmed the direct regulatory relationship between miR-4770 and PRKAA2, providing a potential target for therapeutic strategies targeting this axis.

In agreement with earlier reports, the current work reinforces the notion that miRNAs serve as critical regulators during CRC progression. Prior investigations have established that a range of miRNAs - including miR-21, miR-143, and miR-155 - can alter the proliferation, motility, and invasiveness of colorectal and other cancer cells by controlling the levels of specific downstream genes[29,30]. For example, miR-21 significantly drives CRC cell growth and invasion through inhibiting the tumor suppressor PTEN[31]. In line with these findings, miR-4770 also exhibited a similar effect. The current work found that miR-4770 significantly boosts the malignant behavior of CRC cells by inhibiting PRKAA2. However, what distinguishes this study is revealing the specific regulatory pathway of miR-4770. We found that METTL3 promotes the maturation and function of miR-4770 through m6A modification, thereby increasing its stability and activity in cells. This discovery enriches the understanding of how m6A modification regulates miRNA biosynthesis and function. Unlike previous studies that focused on the effect of m6A on mRNA translation and stability[32], this study highlights the new role of m6A in miRNA regulation - especially in cancer progression by affecting the maturation process of miRNA.

More importantly, this study found that miR-4770 can reduce the activity of AMPK signaling pathway by directly targeting PRKAA2 expression. As an α2 catalytic subunit of AMPK, PRKAA2 has an essential function in modulating cellular energy metabolism. Down-regulation of its expression will weaken the tumor suppressor function of AMPK, thereby promoting CRC celluar proliferation and invasive abilities. The above results indicate that miR-4770 may participate in the modulation of cell metabolism during CRC progression by directly targeting PRKAA2 and inhibiting AMPK signaling. This finding enriches the understanding of the regulatory network of the AMPK signaling pathway (a pathway essential for maintaining cell energy homeostasis). At the same time, the results further support the functional role of PRKAA2 in CRC, and suggest that the miR-4770/PRKAA2 axis may serve as a valuable target for future CRC treatment strategies.

This study has some limitations. First, although paired CRC and adjacent tissues provide preliminary clinical evidence, the sample size is small and long-term follow-up data are lacking, which precludes reliable survival analysis and clinicopathological correlation assessment. Larger independent cohorts and public databases (such as TCGA) are necessary to further confirm the clinical and prognostic relevance of the METTL3/miR-4770/PRKAA2 axis. Second, functional experiments are mainly based on in vitro models, and thus require in vivo verification using xenograft or orthotopic tumor models to clarify the biological significance of the axis in the tumor microenvironment. Third, although MeRIP and RIP assays suggest that METTL3 is involved in the m6A-related maturation of miR-4770, the specific m6A modification sites and corresponding reader proteins remain to be identified. Future studies should integrate site-specific m6A mapping, mutational analysis, reader protein characterization, in vivo models, and larger clinical cohorts to fully elucidate the molecular mechanisms and translational significance of this regulatory axis in CRC.

CONCLUSION

Taken together, our findings establish that miR-4770 drives CRC advancement, at least partially through direct interaction with PRKAA2 and subsequent modulation of the AMPK/mTOR cascade. Furthermore, METTL3 was found to mediate the up-regulation of miR-4770 expression through m6A-related regulatory mechanisms. These findings provide new insights into the role of miRNAs in CRC progression and tumor metabolism. Notably, the miR-4770/PRKAA2 axis may serve as a potential target for future mechanistic and therapeutic studies in CRC.