miR-4770 promotes colorectal cancer progression by targeting PRKAA2 via m6A modification

doi:10.4251/wjgo.120941

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 18, Issue 10

This Article

(8)

(9)

(0)

(11)

Peer-Review Report of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Supplementary Materials of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Journal Information of This Article

Publication Name

World Journal of Gastrointestinal Oncology

ISSN

1948-5204

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Basic Study

Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.

World J Gastrointest Oncol. Oct 15, 2026; 18(10): 120941
Published online Oct 15, 2026. doi: 10.4251/wjgo.120941

Table 2 The primers used in the present study

	Forward primer (5'-3')	Reverse primer (5'-3')
mir-4770	GTGAGATGACACTGTAGCT	AGTGCAGGGTCCGAGGTATT
METTL3	TGGGGGTATGAACGGGTAGA	TGGTTGAAGCCTTGGGGATT
PRKAA2	TGAGAAGCAGAAGCACGACG	ACTGCCACTTTATGGCCTGTT

Full Size Table

Citation: Yi BS, Lai HB. miR-4770 promotes colorectal cancer progression by targeting PRKAA2 via m6A modification. World J Gastrointest Oncol 2026; 18(10): 120941
URL: https://www.wjgnet.com/1948-5204/full/v18/i10/120941.htm
DOI: https://dx.doi.org/10.4251/wjgo.120941

Yi BS, Lai HB. miR-4770 promotes colorectal cancer progression by targeting PRKAA2 via m6A modification. World J Gastrointest Oncol 2026; 18(10): 120941 [DOI: 10.4251/wjgo.120941]

All content on this site: Copyright © 1993-2026 Baishideng Publishing Group Inc, its licensors, and contributors. All rights are reserved, including those for text and data mining, AI training, and similar technologies. For all open access content, the relevant licensing terms apply.