BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Gastroenterol. Sep 28, 2026; 32(36): 121753
Published online Sep 28, 2026. doi: 10.3748/wjg.121753
OH-CATH30 targets CD40 to suppress NF-κB signaling and promote arachidonic acid metabolic reprogramming in acute pancreatitis
Ke-Liang Li, Yue Zhao, Qi-Hang Guo, Ji-Yu Zhang, Bing-Rong Liu, Department of Gastroenterology and Hepatology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, Henan Province, China
Wei-Jie Shang, Department of Human Anatomy and Histology & Embryology, Faculty of Basic Medical Science, Kunming Medical University, Kunming 650500, Yunnan Province, China
Hai-Tao Liu, Henan Institute for Drug and Medical Device Inspection, Zhengzhou 450008, Henan Province, China
Xue-Lin Jia, Education Office, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, Henan Province, China
ORCID number: Ke-Liang Li (0000-0001-5883-5455); Yue Zhao (0000-0002-6564-251X); Ji-Yu Zhang (0000-0003-1919-4418); Bing-Rong Liu (0000-0001-6101-8675).
Author contributions: Li KL, Zhao Y, Shang WJ, Jia XL, and Liu BR designed the research study; Li KL, Guo QH, Liu HT, and Zhang JY performed the research; Li KL, Shang WJ, and Guo QH analyzed the data; Li KL wrote the manuscript; Liu BR revised the manuscript; Jia XL and Liu BR supervised the study. All authors have read and approved the final manuscript.
Supported by Zhongyuan Talent Program, No. ZYYCYU202012113; Key R&D Program of Henan Province, No. 231111311600; and Outstanding Foreign Scientist Studio Project of Henan Province, No. GZS2020006.
Institutional animal care and use committee statement: All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of the Experimental Animal Center of Zhengzhou University, No. ZZU-LAC20240531.
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: The data underlying this article are available from the corresponding author on reasonable request.
Corresponding author: Bing-Rong Liu, MD, PhD, Department of Gastroenterology and Hepatology, The First Affiliated Hospital of Zhengzhou University, No. 1 Jianshe East Road, Zhengzhou 450052, Henan Province, China. fccliubr@zzu.edu.cn
Received: April 1, 2026
Revised: April 25, 2026
Accepted: May 29, 2026
Published online: September 28, 2026
Processing time: 146 Days and 23.8 Hours

Abstract
BACKGROUND

Acute pancreatitis (AP) currently lacks targeted therapeutic interventions. The antimicrobial peptide OH-CATH30 is derived from Ophiophagus hannah venom and has exhibited potential anti-inflammatory effects; however, its precise mechanism of action in AP remains unclear. We hypothesized that OH-CATH30 targets CD40 to modulate inflammatory signaling and metabolic pathways in AP.

AIM

To investigate the therapeutic mechanisms of OH-CATH30 in AP and its role in targeting CD40.

METHODS

In vitro and in vivo AP models were established. Multi-omics analyses, molecular docking, co-immunoprecipitation, and functional validation were performed. Cell viability, apoptosis, cytokine levels, histopathology, and serum enzyme levels were assessed.

RESULTS

In vitro, OH-CATH30 enhanced cell viability, reduced apoptosis, and inhibited pro-inflammatory cytokine production. In vivo, it improved pancreatic histopathology and reduced serum amylase and lipase levels. Multi-omics integration identified CD40 as a pivotal node that links nuclear factor-kappa B signaling with arachidonic acid metabolism. Molecular docking predicted a binding energy of -8.7 kcal/mol between OH-CATH30 and CD40, which was confirmed by co-immunoprecipitation. Its underlying mechanism was elucidated. Thus, OH-CATH30 inhibits the CD40-tumor necrosis factor receptor-associated factor 6-transforming growth factor beta-activated kinase 1-nuclear factor-kappa B pathway, promotes M1-to-M2 macrophage phenotypic shift, and reduces cyclooxygenase-2/5-lipoxygenase expression. CD40 overexpression negated these protective effects, whereas CD40 knockdown mimicked them.

CONCLUSION

OH-CATH30 mitigates AP by targeting CD40 and orchestrating both inflammatory and metabolic reprogramming. Thus, it is a promising therapeutic candidate. Further validation is warranted in severe disease models and clinical settings.

Key Words: Acute pancreatitis; OH-CATH30; CD40; Nuclear factor-kappa B signaling; Macrophage polarization; Anti-inflammatory peptide; Arachidonic acid metabolism

Core Tip: This study identifies CD40 as a pivotal therapeutic target in acute pancreatitis. The antimicrobial peptide OH-CATH30 binds to CD40 and suppresses the CD40-tumor necrosis factor receptor-associated factor 6-transforming growth factor beta-activated kinase 1-nuclear factor-kappa B signaling cascade. This inhibition drives macrophage polarization from pro-inflammatory M1 to anti-inflammatory M2 phenotype and corrects arachidonic acid metabolic dysregulation. These findings establish CD40 as a central node that links inflammatory signaling and metabolic reprogramming in acute pancreatitis. Thus, OH-CATH30 is a promising multi-functional therapeutic candidate for this devastating inflammatory disease.



INTRODUCTION

Acute pancreatitis (AP) is a prevalent and potentially life-threatening gastrointestinal condition characterized by the rapid onset of inflammation in pancreatic tissue[1,2]. Recently, global AP incidence has risen significantly, with case counts showing a 59% escalation from 1.73 million in 1990 to 2.75 million in 2021[3-5]. Concurrently, the pancreatitis-associated mortality rate has increased 78.7% from 68500 to 122400 fatalities[3-5]. AP is often precipitated by factors such as gallstones, excessive alcohol consumption, hypertriglyceridemia, or other causes that prematurely activate digestive enzymes, which leads to the autodigestion of the pancreas and the triggering of a series of inflammatory responses that may progress to systemic complications[1,6,7]. AP pathogenesis is complex, and its underlying mechanisms include abnormal protease activation[8], oxidative stress[9], and dysregulated immune responses[10]. Furthermore, disease severity varies from mild self-limiting episodes to severe AP associated with persistent organ failure[11,12]. Despite advancements in supportive care, specific and effective pharmacological treatments remain limited, which highlights the critical need for developing novel therapeutic agents[13,14].

Recently, bioactive peptides have been identified as promising therapeutic candidates owing to their high specificity, low toxicity, and capacity to target multiple pathological processes[15-17]. Peptides derived from natural sources such as venoms have exhibited significant potential in modulating immune and inflammatory responses[18-20]; thus, they provide novel approaches for treating complex diseases such as AP. Among these, OH-CATH30 is an antimicrobial peptide isolated from king cobra venom (Ophiophagus hannah). It has garnered interest for its antimicrobial properties and immunomodulatory potential[21-24]. Previously, OH-CATH30 mitigated excessive inflammation without inducing immune suppression[20,25-27]. For example, it improved survival rates in murine infection models by precisely modulating chemokine and cytokine production[20]. Furthermore, nanoparticle-encapsulated OH-CATH30 significantly induced the anti-inflammatory cytokine interleukin (IL)-10 while concurrently suppressing pro-inflammatory mediators[25]. These characteristics indicate its potential applicability in treating inflammatory diseases such as AP.

CD40 is a member of the tumor necrosis factor receptor superfamily and acts as a critical molecular link between inflammatory signaling and metabolic reprogramming in AP. Upon activation, CD40 engages with tumor necrosis factor receptor-associated factor 6 (TRAF6) and transforming growth factor beta-activated kinase 1 (TAK1) to trigger the canonical nuclear factor-kappa B (NF-κB) pathway, which drives the transcription of pro-inflammatory cytokines and amplifies the inflammatory cascade[28]. Concurrently, NF-κB activation upregulates key enzymes in arachidonic acid (AA) metabolism such as cyclooxygenase-2 (COX2) and 5-lipoxygenase (5-LOX), which promotes the synthesis of pro-inflammatory lipid mediators such as prostaglandins and leukotrienes[29,30]. This CD40-NF-Κb-AA metabolic axis creates a self-sustaining inflammatory loop that exacerbates pancreatic injury. Notably, clinical observations have shown elevated serum soluble CD40 ligand levels in patients with severe AP, which highlights the pathological significance of this pathway[31,32]. Therefore, targeting CD40 to simultaneously suppress NF-κB-driven inflammation and AA metabolic dysregulation is a rational therapeutic strategy for AP.

Macrophages are pivotal in regulating the AP-associated inflammatory environment[33,34]. These versatile immune cells are capable of polarizing into either pro-inflammatory M1 or anti-inflammatory M2 phenotypes, and they significantly impact disease progression and resolution[35,36]. M1 macrophage predominance intensifies tissue damage by releasing cytokines such as tumor necrosis factor-α (TNF-α), IL-6, and IL-1β[37], whereas a shift towards M2 polarization facilitates tissue repair and suppresses inflammation[38-40]. Consequently, strategies aimed at modulating macrophage polarization have been identified as promising therapeutic interventions for AP[41].

In this study, we aimed to elucidate the potential therapeutic effects of OH-CATH30 in AP by examining its impact on the intersection of inflammatory signaling and metabolic dysregulation. Through an integrated multi-omics approach, we identified CD40 as a pivotal regulatory node that connects NF-κB-mediated inflammation with AA metabolism. Furthermore, we explored whether OH-CATH30 targets CD40 and influences the downstream CD40-NF-κB axis, macrophage polarization, and metabolic reprogramming. We believe that these findings would provide mechanistic insights into the coordinated regulation of immune and metabolic pathways, which could be harnessed for therapeutic interventions in AP.

MATERIALS AND METHODS
Peptide preparation

OH-CATH30 was deduced and characterized from the complementary DNA (cDNA) sequence of the venom gland of Ophiophagus hannah[42]. The OH-CATH30 peptide (sequence: KFFKKLKNSVKKRAKKFFKKPRVIGVSIPF) was synthesized with > 95% purity by Hefei Synth Biotechnology Co. Ltd. (Hefei, China) using solid-phase peptide synthesis[21]. Stock solutions were prepared by dissolving the peptide in sterile phosphate-buffered saline (PBS) at a concentration of 1 mmol/L, aliquoted, and stored at -80 °C to avoid repeated freeze-thaw cycles.

Mus musculus

All animal procedures were approved by the Institutional Animal Care and Use Committee of the Experimental Animal Center at Zhengzhou University, No. ZZU-LAC20240531 and were performed in strict adherence to the Guidelines for the Care and Use of Laboratory Animals. Male C57BL/6 mice (age, 6-8 weeks; weight, 20 ± 2 g) with specific pathogen-free status were procured from Beijing Sibefu Biotechnology Co. Ltd. (Beijing, China). The mice were housed in ventilated cages that accommodated 3-5 mice/cage under the following controlled conditions: 12-hour light/dark cycle (lights on at 07:00); 22 ± 2 °C temperature; and 55% ± 10% relative humidity. They were provided ad libitum access to standard rodent chow containing 4%-6% fat and sterilized water. Following a 7-day acclimatization period, the animals were stratified based on body weight and randomly allocated to experimental groups. Animals that met humane endpoints were euthanized using CO2 narcosis, followed by cervical dislocation. All remaining animals were euthanized 24 hours after the administration of the final cerulein injection for tissue and blood collection.

AP mouse modeling protocol

AP was induced via intraperitoneal injection of cerulein (HY-A0190, MedChemExpress, Monmouth Junction, NJ, United States) at the dose of 100 μg/kg body weight per injection. The cerulein-induced AP mouse model was established by administering 10 hourly intraperitoneal injections to induce increasingly sustained pancreatic inflammation for mimicking human severe AP pathophysiology[43]. The control mice received equivalent volumes of sterile PBS on the same schedule.

OH-CATH30 treatment protocol

OH-CATH30 was solubilized in sterile PBS and delivered through intraperitoneal injection at the dosage of 30 μg/kg of mouse body weight[20,21] and injection volume of 10 μL/g. The treatment regimen was initiated immediately after the sixth cerulein administration and was continued every 24 hours for three consecutive days.

CD40-knockdown

When cells reach approximately 40% confluence, the lentivirus target sequence CCAAAGGATAATGAGATGTTA (sh-CD40 Lentivirus, HanBio Biotechnology, Shanghai, China) was mixed with polybrene and added to the cell culture medium for infection. Mice were injected intraperitoneally with 5 × 1011 vg of AAV-shCD40 (provided by OBIO Biotechnology, Shanghai, China) in 150 μL of PBS. The injections were administered 72 hours prior to AP induction to permit the adequate expression of the short hairpin RNA.

Flow cytometry analysis of macrophages

Pancreatic tissue was freshly harvested, finely minced, and subjected to enzymatic digestion using collagenase IV (0.5 mg/mL) and DNase I (0.2 mg/mL) for 30 minutes at 37 °C to generate single-cell suspensions. Fc receptor blocking was achieved using CD16/32, following which the cells were labeled for 30 minutes at 4 °C with the fluorescently conjugated antibodies F4/80-FITC, CD11b-APC-Cy7, CD86-PE (M1), and CD206-PerCP-Cy5.5 (M2) along with the Zombie Aqua viability dye. Data acquisition was performed using a FACSCanto II flow cytometer, and the data were analyzed using FlowJo software. Live macrophages were identified as F4/80+CD11b+ cells and were gated to quantify the expression of CD86+ (M1) and CD206+ (M2) subsets.

Cell culture and treatment

The mouse pancreatic acinar cell line 266-6 (ATCC CRL-2151) was cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum and maintained at 37 °C in a 5% CO2 humidified incubator. The 266-6 cells were propagated using standard Dulbecco’s Modified Eagle Medium (31600, Solarbio, Beijing, China) supplemented with penicillin-streptomycin (P1400, Solarbio, Beijing, China). Subculturing was performed at 70%-80% confluence using 0.25% Trypsin-EDTA (T1300, Solarbio, Beijing, China). The cell lines were authenticated through short tandem repeat profiling and confirmed to be mycoplasma-free via polymerase chain reaction (PCR) testing. The AP cell model was established by treating the cells with 10-4 mmol/L cholecystokinin (CCK) for 24 hours.

Cell viability assay

Cell viability was assessed using the cell counting kit-8 (CA1210, Solarbio, Beijing, China). Cells were plated in 96-well plates at a density of 1 × 104 cells/well in 100 μL of complete medium and incubated overnight at 37 °C with 5% CO2. After the administration of the respective treatments, 10 μL of cell counting kit-8 reagent was added to each well, and the plates were incubated for 2 hours at 37 °C. Absorbance was measured at 450 nm using a microplate reader (Bio-Rad Model 680, Hercules, CA, United States).

Cell proliferation assay

Cell proliferation was assessed using the BeyoClick™ EdU Cell Proliferation Kit with diaminobenzidine (C0085S, Beyotime, Shanghai, China). The cells were incubated with 10 μM EdU for 2 h at 37 °C, followed by fixation with 4% paraformaldehyde for 15 minutes. Subsequently, the cells were permeabilized with 0.5% Triton X-100 in PBS for 10 minutes. Then, click reaction was performed using Alexa Fluor 488 azide for 30 minutes in the absence of light. Nuclear counterstaining was performed using 1 μg/mL DAPI. Fluorescent images were acquired using an Olympus IX73 fluorescence microscope (Tokyo, Japan). EdU-positive cells were quantified in five randomly selected fields per sample (≥ 500 cells/group) using ImageJ software.

Apoptosis assay

Apoptotic cells were detected using the Colorimetric TUNEL Apoptosis Assay Kit (C1091, Beyotime, Shanghai, China). After fixation and permeabilization, the cells were incubated at 37 °C for 60 minutes under dark conditions with a TUNEL reaction mixture comprising terminal deoxynucleotidyl transferase and fluorescein-dUTP. Nuclear staining was performed for 5 minutes with 1 μg/mL Hoechst 33342. The apoptotic rate was quantified as the percentage of TUNEL-positive cells, which was assessed using a Nikon Eclipse Ti2 microscope (Tokyo, Japan) by analyzing five independent fields per sample. A positive control was prepared by treating cells with DNase I at 100 U/mL for 10 minutes to induce DNA fragmentation.

Transcriptome sequencing and analysis

TRIzol Reagent (15596026CN, Thermo Fisher, Waltham, MA, United States) was used to extract total RNA with RNA integrity number ≥ 7.0, which was verified using an Agilent 2100 Bioanalyzer. Strand-specific libraries were prepared through a series of steps including oligo (dT) magnetic bead selection, cDNA synthesis with dUTP incorporation, and adapter ligation with the MGIEasy RNA Library Prep Kit (MGI Tech, Shenzhen, China). These libraries were amplified into DNA nanoballs and sequenced on the DNBSEQ-T7 platform to produce 150 base pair paired-end reads that yielded a minimum of 20 million clean reads/sample.

The clean reads were aligned to the mouse genome (GRCm39) using HISAT2 version 2.0.5. Gene expression levels were quantified as fragments per kilobase of transcript per million mapped reads using feature Counts version 1.5.0-p3. Differential expression analysis was performed with DESeq2 version 1.20.0 by applying the following threshold: Adjusted P value ≤ 0.05 and |log2 fold change| ≥ 1. Functional enrichment analysis of the differentially expressed genes (DEGs) was performed using clusterProfiler version 3.8.1 for Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways with an adjusted P value < 0.05.

Untargeted metabolomics analysis

Metabolites were extracted from 200 mg of frozen tissue using a methanol-acetonitrile-water solution (2:2:1, v/v/v) with L-2-chlorophenylalanine. The extraction involved 10 minutes of ultrasonic treatment on ice, followed by centrifugation at 12000 × g for 15 minutes at 4 °C. The supernatants were lyophilized and reconstituted in acetonitrile-water (1:1, v/v) and analyzed using a Thermo Q Exactive Focus-Orbitrap mass spectrometry (MS) paired with a Waters ACQUITY UPLC BEH C18 column (100 mm × 2.1 mm, 1.7 μm). The mobile phases comprised 0.1% formic acid in water (A) and acetonitrile (B) with gradient elution at 0.4 mL/minute for approximately 16 minutes. The MS parameters were as follows: M/z range of 70-1050; resolution of 70000 for MS and 17500 for MS/MS; and collision energies of 20-40 eV for positive and negative modes. Data were processed using Progenesis QI with identification through HMDB/METLIN. Differential metabolites (DMs) were identified with variable importance in projection (VIP) score ≥ 1, fold change ≥ 1.5, and P value < 0.05. KEGG pathway analysis was performed using MetaboAnalyst 5.0.

Multi-omics integration analysis

For the integration analysis, DEGs were selected based on an adjusted P value ≤ 0.05 and absolute log2(fold change) ≥ 1, whereas DMs were chosen with a VIP score ≥ 1, fold change ≥ 1.5, and P value < 0.05. Pearson correlation coefficients between DEGs and DMs were computed using R software (version 4.2.1) with a significance threshold set at an absolute correlation coefficient (|r|) of ≥ 0.8 and P value < 0.01. A protein-protein interaction network was constructed using the STRING database (version 11.5) with a confidence score ≥ 0.7. Hub genes were identified through degree centrality analysis using the CytoHubba plugin. The network was visualized in Cytoscape (version 3.9.1) using a force-directed layout, where node size was proportional to the degree value, and color indicated the direction of regulation (up or down). Functional enrichment analysis of the protein-protein interaction network was performed using the ClueGO plugin for KEGG pathways with the significance threshold P value < 0.05.

Molecular docking of OH-CATH30 and CD40

The full-length CD40 and OH-CATH30 peptide structures were predicted using AlphaFold2[44] and visualized using PyMOL version 2.5. Crystallographic water molecules were excised, and hydrogen atoms were incorporated using AutoDockTools version 1.5.7. Gasteiger charges were systematically assigned to all atoms. The binding pocket was delineated with central coordinates (x = 15.19, y = 53.90, Z = 16.92) and dimensions 22 × 22 × 22 Å, which encompassed the critical residues Asp84, Glu114, and Glu117. Molecular docking was performed using AutoDock Vina version 1.2.3 with the following default parameters: Exhaustiveness set at 64, num_modes at 10, and an energy_range of 3 kcal/mol. The optimal binding pose was selected based on the binding energy threshold of ≤ -8 kcal/mol. The docked complex was visualized using PyMOL version 2.5 to elucidate the overall binding mode. To ensure reproducibility, three independent docking runs were performed.

Western blotting analysis

Cells were lysed using RIPA buffer supplemented with 1 mmol/L PMSF (36978, Thermo Fisher, Waltham, MA, United States) and a phosphatase inhibitor cocktail (P0044, Sigma-Aldrich, Darmstadt, Germany). Protein concentrations were quantified using the BCA Protein Assay Kit (P0012, Beyotime, Shanghai, China). Next, equal protein quantities (50 μg) were resolved via 10% sodium-dodecyl sulfate gel electrophoresis and transferred onto polyvinylidene fluoride membranes (IPFL00010, Sigma-Aldrich, Darmstadt, Germany), which were blocked with 5% non-fat milk in TBST for 1 hour, followed by overnight incubation at 4 °C with the following primary antibodies: CD40 (1:1000, AF5336, Affinity, Melbourne, Australia), TRAF6 (1:1000, AF5376, Affinity, Melbourne, Australia), TAK1 (1:1000, AF6019, Affinity, Melbourne, Australia), NF-κB p65 (1:1000, AF6795, Affinity, Melbourne, Australia), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:5000, AF7021, Affinity, Melbourne, Australia). After washing thrice with TBST, the membranes were incubated with a horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibody (1:5000, S0001, Affinity, Melbourne, Australia) for 1 hour at room temperature. Protein bands were detected using the enhanced chemiluminescence reagent (P0018S, Beyotime, Shanghai, China) and imaged using the ChemiDoc XRS+ system (Bio-Rad). Band intensities were quantified using ImageJ software and normalized against that of GAPDH.

Co-immunoprecipitation

Cells were treated in 10-cm dishes, washed twice with ice-cold PBS, and lysed in 1 mL lysis buffer on ice for 20 minutes. The lysates were centrifuged at 12000 × g for 15 minutes at 4 °C, and soluble supernatants were collected. Protein concentrations were quantified and equalized using a BCA assay. Next, 500 μL of each protein sample was pre-cleared with 50 μL protein A/G agarose beads at 4 °C for 1 hour with gentle rotation, followed by centrifugation at 3000 × g for 5 minute at 4 °C. Then, a 50-μL aliquot was saved as the input. The remaining lysate was incubated overnight at 4 °C with 2 μg control IgG (RA1009, China), anti-CD40 antibody (AF5336, China), or FITC-OH-CATH30 with gentle rotation. The beads were washed five times, mixed with 50 μL 2× SDS loading buffer, and boiled at 100 °C for 10 minutes. After centrifugation at 12000 × g for 5 minute at 4 °C, the supernatants were collected and subjected to sodium-dodecyl sulfate gel electrophoresis, followed by western blotting detection of CD40 and FITC-OH-CATH30.

Quantitative real-time PCR analysis

Total RNA was extracted using the TRIzol reagent to achieve an A260/A280 ratio in the 1.8-2.1 range. cDNA was synthesized from 1 μg of RNA using an RT mix with DNase (R2020S, China). Quantitative PCR was performed using a 20-μL reaction system comprising 10 μL of SYBR Premix Ex Taq II, 0.4 μL each of the forward and reverse primers (10 μM), and 2 μL of the cDNA template. The amplification conditions were as follows: Initial denaturation at 95 °C for 30 seconds, followed by 40 cycles of 95 °C for 5 seconds and 60 °C for 30 seconds. Melting curve analysis was performed to confirm the specificity of the amplicons. Relative gene expression was calculated using the 2-ΔΔCt method with GAPDH as the internal reference. The following primer sequences were used: Amylase1 (forward: 5’-GACGAACTGCTATTATCCACCTG-3’, reverse: 5’-GTTGCACCTGTTCACCATGTC-3’), lipase (forward: 5’-ATGCGAAACACGGT TTTCCTG-3’, reverse: 5’-GTAGCTGGTACTCCAGTGGG-3’), and GAPDH (forward: 5’-TGTGTCCGTCGTGGATCTGA-3’, reverse: 5’-CCTGCTTCACCACCTTCTTGA-3’).

Enzyme-linked immunosorbent assay assays for cytokine detection

The cytokines were quantified using Elabscience mouse enzyme-linked immunosorbent assay (ELISA) kits by specifically targeting IL-1β (E-EL-M0037, China), IL-6 (E-EL-M0044, China), TNF-α (E-EL-M3063, China), and IL-18 (E-EL-M0730, China). Mouse serum samples were centrifuged at 3000 × g for 10 minutes at 4 °C. Next, 100 μL of the standards and diluted samples were introduced into pre-coated wells and incubated at 37 °C for 90 minutes. After washing, they were sequentially incubated with a biotinylated detection antibody and an HRP-avidin conjugate at 37 °C for 60 and 30 minutes, respectively. The TMB substrate was added, and color was allowed to develop for 15 minutes in the dark, after which the reaction was terminated using 2M H2SO4. Absorbance was measured at 450 nm. Cytokine concentrations were determined using four-parameter logistic standard curves with ≥ 0.99 at a range of 12.5-2000 pg/mL.

Hematoxylin and eosin staining

Mouse pancreatic tissues were fixed in 4% paraformaldehyde for 24 hours, embedded in paraffin, and sectioned at 4-μm thickness. These sections were deparaffinized in xylene (3 × 5 minutes) and rehydrated through graded ethanol (100% to 70%) to distilled water. After staining with Harris hematoxylin for 5 minutes, the sections were differentiated with 1% hydrochloric acid-ethanol for 30 seconds, rinsed under running water for 5 minutes, and counterstained with 0.5% eosin for 2 minutes. Then, the slides were dehydrated using graded ethanol, cleared with xylene, and mounted with neutral balsam. The pancreatic structure was examined using a light microscope.

Immunohistochemistry

The deparaffinized tissue sections were subjected to antigen retrieval in a citrate buffer (pH 6.0) facilitated by microwave heating for 5 minutes. To inhibit endogenous peroxidase activity, the sections were treated with 3% hydrogen peroxide (H2O2) for 10 minutes at ambient temperature. Subsequently, non-specific binding was minimized by blocking with 5% bovine serum albumin for 30 minutes. Then, the sections were incubated overnight at 4 °C with primary antibodies, namely, CD40 (dilution 1:100, AF5336, Affinity, Melbourne, Australia) and NF-κB p65 (dilution 1:200, AF5006, Affinity, Melbourne, Australia). After thorough washing with PBS, the sections were exposed to the HRP-conjugated secondary antibody (dilution 1:200, S0001, Affinity, Melbourne, Australia) for 30 minutes at room temperature. Immunoreactivity was visualized using diaminobenzidine as substrate, and the sections were counterstained with hematoxylin. Quantification of positive staining was performed using Image-Pro Plus software by assessing the integrated optical density values.

AA detection using ELISA

Serum samples were subjected to centrifugation at 3000 × g for 10 minutes at 4 °C. Pancreatic tissues were homogenized in a 1:9 (w/v) ratio with PBS and centrifuged at 12000 × g for 10 minutes at 4 °C. AA was quantified using the Elabscience competitive ELISA kit (E-EL-0051, China). Then, 50 μL of standards ranging from 1.56-100 ng/mL or samples were incubated with 50 μL of the detection antibody at 37 °C for 60 minutes. After washing, 100 μL of HRP-avidin was added and incubated for 30 minutes. Then, the TMB substrate was added, followed by incubation in the dark for 15 minutes. Next, the reaction was terminated with H2SO4, and absorbance was measured at 450 nm.

Kit-based detection of COX2 and 5-LOX levels in cells and pancreatic tissues

COX2 and 5-LOX levels in cells and pancreatic tissues were measured using commercial ELISA kits. Pancreatic tissue samples were processed as described in the previous section. Cultured cells were suspended in 200 μL PBS/106 cells, lysed using ultrasonication, and centrifuged at 1500 × g for 10 minutes at 2-8 °C. The supernatants were collected. COX2 was quantified using a mouse PTGS2/COX2 ELISA kit (E-EL-M0959, Elabscience, China) at 450 nm at a detection range of 0.16-10 ng/mL. 5-LOX was measured using a mouse LOX ELISA kit (SBJ-M0399, Nanjing Senbeijia Biotechnology Co., Ltd., Nanjing, China) at 450 nm at a detection range of 12-400 pg/mL.

Statistical analysis

All data were analyzed using GraphPad Prism 9.0 and R 4.2.1 software. Normality was assessed using Shapiro-Wilk test and variance homogeneity using Levene’s test. The data are reported as mean ± SD where applicable. For parametric data, one-way ANOVA was followed by Tukey’s HSD for multiple comparisons. Correlation analyses were performed using Pearson or Spearman correlation coefficients. Multivariate analyses including principal component analysis and partial least squares-discriminant analysis were performed to assess group separation. Variables with VIP score > 1 in partial least squares-discriminant analysis were deemed significant contributors. Statistical significance was set at P < 0.05.

RESULTS
OH-CATH30 ameliorates CCK-induced pancreatic acinar cell injury by restoring cellular homeostasis

We elucidated the protective effects of OH-CATH30 by establishing a CCK-induced injury model using 266-6 pancreatic acinar cells. Cytotoxicity evaluations showed that OH-CATH30 did not significantly impact the viability of normal 266-6 cells at 0-500 nM for approximately 24 hours (Figure 1A), which suggested minimal intrinsic cytotoxicity.

Figure 1
Figure 1 OH-CATH30 attenuates cholecystokinin-induced injury in pancreatic acinar cells (266-6). A: Cell viability of 266-6 cells treated with increasing concentrations of OH-CATH30 (0-500 nM) for 24 hours, assessed using cell counting kit-8 assay; B: Cells were pretreated with 100 nM cholecystokinin (CCK) for 24 hours to induce injury, followed by treatment with OH-CATH30 at indicated concentrations. Cell viability was measured using cell counting kit-8 assay; C-E: Effects of 100 nM OH-CATH30 on cholecystokinin -injured 266-6 cells: (C) Amylase1 and (D) lipase levels in culture supernatants; (E) lactate dehydrogenase activity; F and G: Cell proliferation detected using EdU incorporation assay. Representative images (F) and quantification (G) show increased proliferation after OH-CATH30 treatment. Scale bar = 50 μm; H and I: Apoptosis detected using TUNEL staining. Representative images (H) and quantification (I) show reduced apoptosis following OH-CATH30 treatment. Scale bar = 50 μm. All data are presented as mean ± SD (n = 3 independent experiments). Statistical analysis was performed using one-way ANOVA followed by Tukey’s HSD post hoc test. aP < 0.05 vs control, bP < 0.05 vs cholecystokinin alone (0 nM OH-CATH30). CCK: Cholecystokinin; LDH: Lactate dehydrogenase.

Stimulation with CCK (100 nM for 24 hours) significantly reduced cell viability compared with that of the control group (P < 0.05), which confirmed successful establishment of the model. Treatment with OH-CATH30 (100-500 nM) partially restored cell viability. The effect was most pronounced at 100 and 200 nM (Figure 1B). Therefore, 100 nM was selected as the OH-CATH30 concentration for subsequent experiments. Further analyses showed that OH-CATH30 significantly reduced amylase1 and lipase levels and lactate dehydrogenase (LDH) activity in the culture supernatants (Figure 1C-E), which suggested an attenuation of acinar cell injury and reduction of cellular damage.

Furthermore, EdU incorporation assays indicated that OH-CATH30 substantially increased cell proliferation (Figure 1F and G), whereas TUNEL staining showed significant decrease in proportion of apoptotic cells (Figure 1H and I). Taken together, these results suggest that OH-CATH30 effectively mitigates CCK-induced injury in pancreatic acinar cells by enhancing cell viability, minimizing enzyme-related damage, promoting proliferation, and inhibiting apoptosis.

OH-CATH30 attenuates cerulein-induced AP in vivo by suppressing inflammatory responses and pancreatic injury

The temporal dynamics of inflammation in cerulein-induced AP were initially characterized by quantifying pro-inflammatory cytokines in serum at 0, 12, 24, 48, 72, and 96 hours post-final cerulein administration. In murine serum, IL-1β, IL-6, IL-18, and TNF-α levels significantly increased at 12 hours and peaked between 24 and 48 hours before subsequently declining (Figure 2A-D). Therefore, the 24-hour mark was selected for further analyses. OH-CATH30 therapeutic efficacy was assessed in vivo after cerulein induction. OH-CATH30 treatment significant reduced serum IL-1β, IL-6, IL-18, and TNF-α levels compared with those in the AP group (Figure 2E-H), which suggested the effective attenuation of systemic inflammatory responses.

Figure 2
Figure 2 OH-CATH30 attenuates cerulein-induced acute pancreatitis in mice. A-D: Time-course analysis of serum pro-inflammatory cytokines in cerulein-induced acute pancreatitis (AP) mice. Mice were euthanized at 0, 12, 24, 48, 72, and 96 hours after the last cerulein injection (n = 3 per time point). Serum levels of interleukin (IL)-1β (A), IL-6 (B), IL-18 (C), and tumor necrosis factor-α (D) were measured using ELISA. aP < 0.05 vs 0 hour, bP < 0.05 vs 12 hours, cP < 0.05 vs 24 hours, dP < 0.05 vs 48 hours, and eP < 0.05 vs 72 hours; E-M: Therapeutic effects of OH-CATH30 on AP mice. Mice were randomly assigned to three groups: Control (phosphate-buffered saline only), AP (10 hourly cerulein injections), and AP + OH-CATH30 (30 μg/kg i.p. every 12 hours for 3 days, starting immediately after sixth cerulein injection). Pancreatic tissues and serum were collected 24 hours after final cerulein injection. aP < 0.05 vs control, bP < 0.05 vs acute pancreatitis group. Serum levels of IL-1β, IL-6, IL-18, and tumor necrosis factor-α measured using ELISA (E-H); serum amylase and lipase activities (I and J); lactate dehydrogenase activity in pancreatic tissue homogenates (K); representative hematoxylin and eosin-stained pancreatic sections (L) and corresponding histological scores (M). Scale bar = 100 μm. All data are presented as mean ± SD (n = 6 mice/group). Statistical analysis was performed using one-way ANOVA followed by Tukey’s HSD post hoc test. IL: Interleukin; TNF-α: Tumor necrosis factor-α; AP: Acute pancreatitis; LDH: Lactate dehydrogenase.

Furthermore, biochemical markers of pancreatic injury showed pronounced improvement after OH-CATH30 treatment. Serum amylase and lipase activities significantly decreased (Figure 2I and J) along with reduction in LDH activity in pancreatic tissue homogenates (Figure 2K). Histopathological evaluation further corroborated these findings. AP mice exhibited pronounced acinar disorganization, immune cell infiltration, edema, and hemorrhage, whereas OH-CATH30 treatment substantially alleviated these pathological changes and reduced histological injury scores (Figure 2L and M). Overall, these results suggest that OH-CATH30 confers significant protection against AP in vivo, primarily by suppressing systemic inflammation and mitigating pancreatic tissue damage.

Transcriptomic profiling shows that OH-CATH30 modulates inflammatory signaling pathways in AP

We elucidated the gene expression profiles in pancreatic tissues from control, AP, and OH-CATH30-treated cohorts by performing transcriptomic sequencing. Differential expression analysis indicated substantial transcriptional modifications in the AP group. A significant number of genes exhibited pronounced upregulation or downregulation in the AP group relative to those of the Control group (Figure 3A). In contrast, OH-CATH30 treatment partially mitigated these transcriptional changes (Figure 3B), which suggested a restorative effect on the AP-associated transcriptional dysregulation.

Figure 3
Figure 3 Transcriptomic profiling shows that OH-CATH30 modulates inflammatory signaling pathways in acute pancreatitis. A and B: Volcano plots depicting differentially expressed genes in pancreatic tissues from (A) acute pancreatitis (AP) vs control and (B) OH-CATH30 vs AP comparisons. Red and blue dots represent significantly upregulated and downregulated genes, respectively (adjusted P ≤ 0.05, |log2(fold change)| ≥ 1). Gray dots indicate non-significant changes; C and D: Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of differentially expressed genes; C: Top enriched pathways in AP vs control; D: Pathways significantly modulated by OH-CATH30 treatment; E: Heatmap showing relative abundance of infiltrating immune cell types in each sample, estimated using CIBERSORT algorithm; F: Bar plot depicting average immune cell composition in control, AP, and OH-CATH30-treated groups. All data are derived from transcriptomic sequencing of pancreatic tissues (n = 4 biological replicates per group). AP: Acute pancreatitis; KEGG: Kyoto Encyclopedia of Genes and Genomes.

KEGG pathway enrichment analysis showed significant involvement of multiple inflammation-related signaling pathways in AP (Figure 3C). Notably, the NF-κB signaling pathway exhibited prominent enrichment. These pathways were significantly modulated after OH-CATH30 treatment (Figure 3D), which highlights its role in regulating inflammatory signaling. We further investigated immune cell dynamics by analyzing immune cell infiltration using the CIBERSORT algorithm, which showed variability in the relative abundance of infiltrating immune cell types across samples (Figure 3E). Quantitative analysis indicated that AP was associated with a shift towards a pro-inflammatory immune cell profile, which was partially ameliorated by OH-CATH30 treatment (Figure 3F). Collectively, these findings suggest that OH-CATH30 exerts comprehensive regulatory effects on AP-associated transcriptional programs, and the NF-κB signaling pathway was identified as a critical mechanistic axis.

Metabolomic profiling shows that OH-CATH30 reprograms AA metabolism in AP

We examined the OH-CATH30 treatment-associated metabolic changes by performing an untargeted metabolomic analysis on pancreatic tissues from control, AP, and OH-CATH30-treated groups. Principal component analysis showed a clear distinction between the three groups, which indicated the unique metabolic profiles induced by AP (Figure 4A). The AP samples exhibited significant divergence from the control group, which reflected substantial metabolic disruption. In contrast, the OH-CATH30-treated samples formed an intermediate cluster, which suggested partial metabolic recovery.

Figure 4
Figure 4 Metabolomic profiling identifies arachidonic acid metabolism as a key pathway modulated by OH-CATH30 in acute pancreatitis. A: Principal component analysis score plot of pancreatic tissue metabolomes from control, acute pancreatitis (AP), and OH-CATH30-treated groups. Clear separation among groups indicates significant metabolic alterations induced by AP and partial restoration by OH-CATH30; B: Volcano plot displaying differentially abundant metabolites in AP vs control comparison. Each point represents a metabolite; red and blue dots indicate significantly upregulated and downregulated metabolites, respectively (variable importance in projection > 1, |log2(fold change)| ≥ 1, P < 0.05). Gray dots represent metabolites with no significant change; C: Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of metabolites showed significant reversal after OH-CATH30 treatment. Bubble size represents the number of metabolites enriched in each pathway, and color indicates the significance level (P value). Arachidonic acid metabolism was identified as the most significantly modulated pathway. All data are derived from untargeted metabolomic analysis of pancreatic tissues (n = 4 biological replicates per group). AP: Acute pancreatitis; VIP: Variable importance in projection.

DM analysis showed that 650 metabolites exhibited significant alterations in the AP group compared with those of the control group (Figure 4B). Of these, 120 metabolites (18.5%) were notably reversed following OH-CATH30 treatment. Among these, lipids and inflammatory mediators constituted the primary categories. We further elucidated the OH-CATH30-influenced metabolic pathways by performing KEGG pathway enrichment analysis. AA metabolism was identified as the most significantly enriched pathway among the metabolites reversed by OH-CATH30 treatment (Figure 4C). Additionally, other pathways such as pyrimidine metabolism, glycolysis/gluconeogenesis, and phenylalanine metabolism were affected to a lesser degree.

In the context of the pivotal role of AA metabolism in the production of inflammatory lipid mediators, these findings indicate that OH-CATH30 may partially exert its anti-inflammatory effects by modulating this pathway. The observed metabolic reprogramming is consistent with the identified transcriptional alterations (Figure 3), particularly with respect to the modulation of inflammation-associated genes and pathways. Collectively, these metabolomic results highlight the significance of AA metabolism as a primary pathway influenced by OH-CATH30. These findings provide a metabolic foundation for the anti-inflammatory effects of OH-CATH30 and support a further integrated multi-omics analysis.

Integrative multi-omics analysis identifies CD40 as a hub linking inflammatory signaling and AA metabolism with validation through molecular docking

We linked the transcriptomic and metabolomic findings and accurately identified the molecular targets of OH-CATH30 by performing an integrative correlation analysis. We built a global gene-metabolite network based on significant correlations between DEGs and DMs (|r| ≥ 0.8, P < 0.01). This network showed extensive connections between genes (green nodes) and metabolites (blue nodes) and indicated a complex “inflammatory-metabolic” regulatory landscape in AP (Supplementary Figure 1A). The dense network indicated significant crosstalk between transcriptional and metabolic pathways, and inflammation-related genes and lipid metabolites were found to be central to the network.

Next, we refined the network by concentrating on genes and metabolites that exhibited the highest correlation strengths and occupied the most central topological positions. This refined network illuminated several key gene-metabolite pairs (Supplementary Figure 1B). Among these, CD40 was identified as a notable central hub gene. CD40 showed robust correlations with multiple AA metabolism-related metabolites, and this pathway was identified as the most significantly enriched in our metabolomic analysis (Figure 4C). Given that CD40 is a well-established upstream activator of the NF-κB signaling pathway, which was prominently enriched in our transcriptomic analysis (Figure 3C and D), this correlation suggested a potential mechanistic link via the interaction of CD40-mediated inflammatory signaling with AA metabolic dysregulation, leading to exacerbation of the inflammatory response in AP.

As CD40 plays a pivotal role in linking inflammation and metabolism, we postulated that OH-CATH30 might interact with CD40. We evaluate this hypothesis by performing molecular docking simulations of the potential interaction. The simulations showed that OH-CATH30 stably docked into the extracellular domain of CD40 with a predicted binding energy of -8.7 kcal/mol (Supplementary Figure 1C). Notably, the key interacting residues included Lys12 of OH-CATH30, which formed a hydrogen bond with Glu117 of CD40 (2.8 Å), and Arg14, which engaged in a salt bridge with Asp84 (3.2 Å) in addition to several hydrophobic interactions. These findings highlight the role of CD40 as a central node that connects NF-κB-mediated inflammation and AA metabolism. Hence, we propose it as a molecular target of OH-CATH30.

OH-CATH30 inhibits CD40 expression and NF-κB activation in pancreatic acinar cells and AP mice

After identifying CD40 as a potential OH-CATH30 target through multi-omics integration and molecular docking analyses, we investigated the modulatory effects of OH-CATH30 on CD40/NF-κB signaling within experimental models of AP. CD40 and NF-κB p65 protein expression levels were evaluated using western blotting analysis. Stimulation of 266-6 cells with CCK significantly upregulated CD40 and NF-κB p65 protein expression compared with that observed in the control group (Figure 5A-C). Notably, this upregulation was substantially attenuated by OH-CATH30 treatment at 100 nM, which significantly reduced the expression of both proteins relative to that of the CCK-stimulated group (Figure 5B and C). Similar results were obtained in vivo in pancreatic tissues from cerulein-induced AP mice. They showed significant increase in CD40 and NF-κB p65 protein levels compared with those of the controls (P < 0.05). However, these elevated levels substantially diminished after OH-CATH30 administration (Figure 5D-F).

Figure 5
Figure 5 OH-CATH30 inhibits CD40 expression and nuclear factor-kappa B activation in pancreatic acinar cells and acute pancreatitis mice. A-C: Western blotting analysis of CD40 and nuclear factor-kappa B (NF-κB) p65 protein expression in 266-6 cells. Representative immunoblots(A); densitometric quantification of CD40 (B) and NF-κB p65 (C) normalized to that of glyceraldehyde-3-phosphate dehydrogenase. Cells were treated with control, cholecystokinin (100 nM), or cholecystokinin + OH-CATH30 (100 nM); D-F: Western blotting analysis of CD40 and NF-κB p65 protein expression in mouse pancreatic tissues. Representative immunoblots(D); quantitative analysis of CD40 (E) and NF-κB p65 (F) protein levels normalized to that of glyceraldehyde-3-phosphate dehydrogenase. Mice were assigned to control, acute pancreatitis, or acute pancreatitis + OH-CATH30 (30 μg/kg) groups; G-I: Immunohistochemical staining of CD40 and NF-κB p65 in pancreatic tissue sections. Representative images showing CD40 and NF-κB p65 expression (brown staining) (G); scale bar = 50 μm. Quantitative analysis of integrated optical density for CD40 (H) and NF-κB p65 (I) staining. All data are presented as mean ± SD [n = 3 independent experiments (A-C) or n = 6 mice per group (D-I)]. Statistical analysis was performed using one-way ANOVA followed by Tukey’s HSD post hoc test. aP < 0.05 vs control, bP < 0.05 vs cholecystokinin or acute pancreatitis group. NF-κB: Nuclear factor-kappa B; AP: Acute pancreatitis; CCK: Cholecystokinin; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Immunohistochemical staining results additionally validated these findings. AP model mouse pancreatic tissues showed robust positive signals for CD40 and NF-κB p65. This was indicated by brown staining and was primarily observed in acinar cells and infiltrating inflammatory cells (Figure 5G). However, OH-CATH30 treatment significantly reduced the intensity and distribution of this positive staining, as evidenced by a pronounced decrease in integrated optical density values (Figure 5H and I). These results indicate that OH-CATH30 effectively inhibits CD40/NF-κB signaling pathway activation in both cellular and animal models of AP.

CD40 is a functional target of OH-CATH30: Validation of the CD40-TRAF6-TAK1-NF-κB axis

Given that OH-CATH30 inhibits CD40/NF-κB pathway activation, we investigated its potential interaction with CD40 and whether CD40 mediates its protective role in AP by performing co-immunoprecipitation using FITC-tagged OH-CATH30. Immunoprecipitation with an anti-FITC antibody, followed by immunoblotting with an anti-CD40 antibody showed a distinct band for CD40 (approximately 31 kDa), which suggested that FITC-tagged OH-CATH30 bound to the CD40 protein (Figure 6A).

Figure 6
Figure 6 CD40 is a functional target of OH-CATH30: Validation of CD40-tumor necrosis factor receptor-associated factor 6-transforming growth factor beta-activated kinase 1-nuclear factor-kappa B axis. A: Co-immunoprecipitation assay confirming binding between FITC-labeled OH-CATH30 and CD40 protein. Cell lysates were immunoprecipitated with anti-FITC antibody or control IgG, followed by immunoblotting with anti-CD40 antibody; B: Western blotting analysis of CD40 pathway proteins (CD40, tumor necrosis factor receptor-associated factor 6, transforming growth factor beta-activated kinase 1, nuclear factor-kappa B p65) in 266-6 cells under indicated conditions: Control (untreated); cholecystokinin (CCK) (100 nM CCK for 24 hours); OH-CATH30 (100 nM OH-CATH30 after CCK injury); OH-CATH30 + CD40 (LV-CD40 transfection prior to CCK injury and OH-CATH30 treatment); sh-CD40 (LV-sh-CD40 knockdown prior to CCK injury). Glyceraldehyde-3-phosphate dehydrogenase functioned as loading control; C: Western blotting analysis of CD40 pathway proteins in mouse pancreatic tissues from indicated groups: Control (phosphate-buffered saline only); acute pancreatitis (AP) (cerulein-induced); OH-CATH30 (30 μg/kg after AP induction); OH-CATH30 + CD40 (AAV-CD40 tail vein injection prior to AP induction and OH-CATH30 treatment); sh-CD40 (AAV-sh-CD40 injection prior to AP induction without OH-CATH30 treatment); D and E: Representative images (D) and quantification (E) of EdU incorporation assay to assess cell proliferation in 266-6 cells. Scale bar = 50 μm; F and G: Representative images (F) and quantification (G) of TUNEL staining to detect apoptosis in 266-6 cells. Scale bar = 50 μm; H and I: Representative hematoxylin and eosin-stained pancreatic sections (H) and corresponding histological scores (I) from mice. Scale bar = 100 μm. All data are presented as mean ± SD [n = 3 independent experiments (A-G) or n = 6 mice per group (H and I)]. Statistical analysis was performed using one-way ANOVA followed by Tukey’s HSD post hoc test. aP < 0.05 vs control, bP < 0.05 vs cholecystokinin or acute pancreatitis group, cP < 0.05 vs OH-CATH30 group, dP < 0.05 vs OH-CATH30 + CD40 group. TRAF6: Tumor necrosis factor receptor-associated factor 6; TAK1: Transforming growth factor beta-activated kinase 1; NF-κB: Nuclear factor-kappa B; CCK: Cholecystokinin; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; AP: Acute pancreatitis.

We elucidated the functional significance of this interaction by analyzing the downstream CD40-TRAF6-TAK1-NF-κB signaling pathway using both loss- and gain-of-function methodologies. In 266-6 cells, CCK-induced injury significantly increased CD40, TRAF6, TAK1, and NF-κB p65 protein expression levels compared with those of the control group (Figure 6B; Supplementary Figure 2A-D). This upregulation was substantially attenuated by OH-CATH30 treatment. Notably, CD40 overexpression (OH-CATH30 + CD40) prior to OH-CATH30 treatment effectively reversed this attenuation, and the protein levels of all four signaling molecules approached those in the CCK-injured cells. In contrast, CD40 knockdown (sh-CD40) alone was sufficient to inhibit the CCK-induced pathway activation, which mimicked the effect of OH-CATH30 treatment (Figure 6B).

Consistent results were obtained in vivo. Pancreatic tissues from AP mice exhibited substantially elevated CD40, TRAF6, TAK1, and NF-κB p65 expression, which was significantly attenuated by OH-CATH30 treatment (Figure 6C and Supplementary Figure 2E-H). AAV-mediated CD40 overexpression (OH-CATH30 + CD40) prior to OH-CATH30 treatment abrogated this protective effect and restored pathway protein expression, whereas CD40 knockdown alone (sh-CD40) substantially reduced AP-induced pathway activation (Figure 6C). Next, we examined whether CD40 modulation affects OH-CATH30-mediated cellular protection. EdU incorporation assays showed that CCK injury significantly reduced the proportion of proliferating 266-6 cells compared with that in the control group, as evidenced by the normalized mean fluorescence intensity (Figure 6D and E). This reduction was restored by OH-CATH30 treatment. The pro-proliferative effect of OH-CATH30 was abolished by CD40 overexpression, whereas CD40 knockdown alone significantly enhanced proliferation compared with that in the CCK group (Figure 6D and E). In contrast, TUNEL staining showed that OH-CATH30 substantially reduced CCK-induced apoptosis (Figure 6F and G), but this effect was reversed by CD40 overexpression and mimicked by CD40 knockdown.

Finally, hematoxylin and eosin staining of pancreatic sections showed that OH-CATH30 substantially ameliorated AP-induced acinar structure disruption, immune cell infiltration, and edema, as evidenced by the notably reduced histological scores (Figure 6H and I). This protective effect was substantially attenuated by CD40 overexpression. Notably, CD40 knockdown alone significantly improved pancreatic pathology compared with that of the AP group, as evidenced by the achievement of scores comparable to those of OH-CATH30-treated mice. Collectively, these results indicate that OH-CATH30 binds to CD40 and suppresses the downstream CD40-TRAF6-TAK1-NF-κB signaling cascade. These findings establish CD40 as a critical functional target that mediates the therapeutic effects of OH-CATH30 in AP.

CD40-dependent effects of OH-CATH30 on inflammation, macrophage polarization, and AA metabolism

Having established CD40 as a functional target of OH-CATH30, we investigated whether CD40 mediates the broader anti-inflammatory and metabolic effects of OH-CATH30 in AP. Specifically, we focused on serum inflammatory cytokines, macrophage polarization, and AA metabolism because these are processes that are intimately associated with CD40 signaling and AP pathogenesis. ELISA analysis of serum cytokines showed that mice with AP exhibited significantly elevated IL-1β, IL-6, TNF-α, and IL-18 levels compared with those of control mice (Figure 7A-D). However, OH-CATH30 treatment significantly reduced these pro-inflammatory cytokines. This suppressive effect was negated by CD40 overexpression via adeno-associated virus (AAV-CD40), and cytokine levels reverting to those observed in the AP group. In contrast, CD40 knockdown alone (AAV-shCD40) substantially diminished the AP-induced cytokine elevation and mimicked the effect of OH-CATH30 treatment (Figure 7A-D).

Figure 7
Figure 7 CD40-dependent effects of OH-CATH30 on inflammation, macrophage polarization, and arachidonic acid metabolism. A-D: Serum levels of pro-inflammatory cytokines interleukin (IL)-1β (A), IL-6 (B), tumor necrosis factor-α (C), and IL-18 (D) measured used ELISA in mice from indicated groups: Control, acute pancreatitis (AP), AP + OH-CATH30, AP + OH-CATH30 + CD40 overexpression (AAV-CD40), and AP + CD40 knockdown (AAV-shCD40); E-G: Flow cytometric analysis of macrophage polarization in pancreatic tissues. Representative dot plots showing CD86+ (M1) and CD206+ (M2) macrophage populations among F4/80+CD11b+ cells (E); quantification of M1 (CD86+) and M2 (CD206+) macrophage percentages (F and G); H-J: Arachidonic acid (AA) metabolism in pancreatic tissues. AA levels measured using ELISA (H); protein expression of cyclooxygenase-2 (I) and 5-lipoxygenase (J) in tissue homogenates; K-M: AA metabolism in 266-6 cells. AA levels measured using ELISA (K); protein expression of cyclooxygenase-2 (L) and 5-lipoxygenase (M) in cell lysates. Cell groups: Control, cholecystokinin (CCK), CCK + OH-CATH30, CCK + OH-CATH30 + CD40 overexpression, and CCK + CD40 knockdown (sh-CD40). All data are presented as mean ± SD [n = 6 mice per group (A-J) or n = 3 independent experiments (K-M)]. Statistical analysis was performed using one-way ANOVA followed by Tukey’s HSD post hoc test. aP < 0.05 vs control, bP < 0.05 vs cholecystokinin or acute pancreatitis group, cP < 0.05 vs OH-CATH30 group, and dP < 0.05 vs OH-CATH30 + CD40 group. IL: Interleukin; TNF-α: Tumor necrosis factor-α; AP: Acute pancreatitis; COX2: Cyclooxygenase-2; 5-LOX: 5-lipoxygenase.

Flow cytometric analysis of pancreatic macrophages (characterized as F4/80+CD11b+ cells) showed that AP induction resulted in a shift towards a pro-inflammatory M1 phenotype, as evidenced by an increase in CD86+ cell and decrease in CD206+ cell proportions compared with those of the control samples (Figure 7E-G). However, OH-CATH30 treatment effectively counteracted this imbalance by reducing the M1 macrophage populations and increasing the M2 populations. The OH-CATH30-induced polarization shift was significantly attenuated by CD40 overexpression. In contrast, CD40 knockdown alone facilitated M2 polarization and inhibited M1 polarization, which mirrored the effects of OH-CATH30 treatment (Figure 7E-G).

As AA metabolism is pivotal for the production of inflammatory lipid mediators, we investigated AA concentrations and the expression of its principal metabolic enzymes COX2 and 5-LOX. In pancreatic tissues, AP induction significantly increased AA content and upregulated COX2 and 5-LOX protein expression (Figure 7H-J). However, OH-CATH30 treatment substantially mitigated these alterations. Furthermore, CD40 overexpression negated this protective effect and restored AA levels and enzyme expression to comparable levels in AP, whereas CD40 knockdown alone suppressed the AP-induced AA metabolic changes (Figure 7H-J). Similar results were observed in 266-6 cells. CCK injury elevated AA levels and upregulated COX2 and 5-LOX; however, these effects were reversed by OH-CATH30 treatment, negated by CD40 overexpression, and replicated by CD40 knockdown (Figure 7K-M).

These findings indicate that OH-CATH30 exerts comprehensive protective effects in AP by targeting CD40 and inhibiting the downstream CD40-TRAF6-TAK1-NF-κB signaling pathway. This action results in the attenuation of systemic inflammation, promotion of anti-inflammatory macrophage polarization, and reprogramming of dysregulated AA metabolism.

DISCUSSION

AP is a severe inflammatory condition with limited treatment options and primarily confined to supportive care[45]. This study shows that the antimicrobial peptide OH-CATH30 is an effective treatment for cerulein-induced AP through CD40 targeting. This action suppresses the CD40-TRAF6-TAK1-NF-κB signaling pathway, reprograms AA metabolism, and changes macrophage polarization (Figure 8). These results indicate that OH-CATH30 is a promising therapeutic candidate and highlight the role of CD40 in linking inflammatory signaling and metabolic changes in AP.

Figure 8
Figure 8 Schematic model of OH-CATH30 ameliorating acute pancreatitis by targeting CD40. OH-CATH30 binds to CD40, which suppresses the downstream CD40-tumor necrosis factor receptor-associated factor 6-transforming growth factor beta-activated kinase 1-nuclear factor-kappa B signaling cascade in cerulein-induced acute pancreatitis mice model. This inhibition reduces pro-inflammatory cytokine production, drives M1-to-M2 macrophage phenotypic shift, and downregulates cyclooxygenase-2/5-lipoxygenase to inhibit arachidonic acid metabolism and synthesis of pro-inflammatory lipid mediators. These synergistic effects attenuate pancreatic and systemic inflammation, alleviate pancreatic injury, and ameliorate acute pancreatitis pathogenesis. IL: Interleukin; TNF-α: Tumor necrosis factor-α; NF-κB: Nuclear factor-kappa B.

Our in vitro studies showed that OH-CATH30 exhibited low cytotoxicity at concentrations ≤ 500 nM and effectively protected pancreatic acinar cells from CCK-induced damage by enhancing cell viability, reducing enzyme release, limiting LDH activity, promoting proliferation, and preventing apoptosis. In vivo, OH-CATH30 significantly reduced inflammation, lowered pancreatic enzyme levels, and improved tissue damage in mouse models of cerulein-induced AP. These results highlight the therapeutic potential of OH-CATH30 in AP, which complements its known anti-inflammatory effects in sepsis and wound healing[20].

We used an integrated transcriptomic and metabolomic approach to gain further mechanistic insights in addition to mere descriptive phenotyping. Transcriptomic profiling showed that OH-CATH30 broadly reversed AP-associated gene expression changes, with particular emphasis on pathways related to inflammation such as NF-κB and MAPK signaling. This observation is consistent with the established role of NF-κB as a central regulator of inflammation in AP[46,47]. Metabolomic analysis further identified AA metabolism as the most significantly altered pathway following OH-CATH30 treatment, which highlights its notable pathophysiological relevance. AA metabolites such as prostaglandins and leukotrienes function as potent amplifiers of the inflammatory cascade in AP by facilitating vasodilation, increased vascular permeability, and neutrophil recruitment[29]. The intersection of transcriptional and metabolic alterations led us to pose a more fundamental question: Are inflammation and metabolic dysregulation in AP independent parallel processes, or are they mechanistically interconnected? The resolution of this inquiry was achieved through integrative correlation analysis.

We constructed a gene-metabolite network based on significant correlations between DEGs and differentially abundant metabolites and found extensive crosstalk between inflammatory signaling and AA metabolism. In this network, CD40 acted as a central hub gene, as evidence by its strong correlations with multiple AA metabolism related metabolites. This observation is mechanistically significant for several reasons. First, CD40 is a well-established upstream activator of NF-κB signaling, which is a pathway that was prominently enriched in our transcriptomic analysis. Second, CD40 is expressed on multiple cell types implicated in AP pathogenesis including acinar cells, macrophages, and endothelial cells. Third, CD40 signaling is known to exert a critical proinflammatory role in both pancreatitis and its pulmonary complications[31,32], and clinical observations have shown that serum soluble CD40 levels are significantly elevated in patients with severe AP. Thus, the identification of CD40 as a node that bridges inflammation and metabolism provided a compelling mechanistic hypothesis that CD40-driven inflammatory signaling might couple with AA metabolic dysregulation to amplify the inflammatory response in AP; conversely, targeting CD40 could simultaneously correct both processes.

Molecular docking simulations have substantiated the interaction between OH-CATH30 and the extracellular domain of mouse CD40. This structural prediction was empirically corroborated through co-immunoprecipitation assays, which showed that FITC-labeled OH-CATH30 associated with the CD40 protein, thereby confirming CD40 as a legitimate molecular target of OH-CATH30. The binding affinity observed is analogous to that of established peptide-receptor interactions, which indicates a stable and specific interaction that may support the therapeutic effects noted.

Functional studies validated the inhibition of CD40/NF-κB signaling pathway activation by OH-CATH30 in both CCK-injured acinar cells and cerulein-induced AP mouse models. Notably, this regulatory effect extended to the downstream components of the CD40 signaling cascade, namely, TRAF6 and TAK1, both of which were similarly downregulated following OH-CATH30 treatment. The CD40-TRAF6-TAK1 axis constitutes a canonical signaling pathway through which CD40 engagement triggers NF-κB activation and the subsequent expression of inflammatory genes[28]. Through loss- and gain-of-function approaches, we found that CD40 overexpression negated the inhibitory effects of OH-CATH30 on this signaling cascade, whereas CD40 knockdown alone mimicked OH-CATH30-mediated pathway suppression. These findings confirm that CD40 is not merely associated with this pathway but is functionally essential for the inhibitory effects of OH-CATH30 on this inflammatory cascade. The observation that CD40 knockdown alone replicates the effects of OH-CATH30 is particularly significant because it indicates that CD40 inhibition alone is sufficient to achieve therapeutic benefits. This finding holds potential implications for other inflammatory diseases where CD40 signaling is implicated.

We further validated the functional significance of CD40 targeting through cellular and histopathological analyses. CD40 overexpression counteracted the OH-CATH30-induced enhancement of acinar cell proliferation and apoptosis protection, whereas CD40 knockdown independently replicated these protective effects. Similarly, in vivo studies showed that CD40 overexpression diminished the therapeutic efficacy of OH-CATH30 on pancreatic histopathology, whereas CD40 knockdown alone substantially reduced tissue damage. These findings identify CD40 as a pivotal mediator of the protective effects of OH-CATH30 in AP. The observation that CD40 knockdown alone achieved approximately 70% of the therapeutic effect of OH-CATH30 treatment indicates that CD40 is a primary target of the peptide, even if not potentially its sole target.

In addition to pathway regulation, we investigated whether targeting CD40 with OH-CATH30 leads to a broader modulation of inflammatory and metabolic processes. OH-CATH30 treatment significantly reduced serum levels of pro-inflammatory cytokines such as IL-1β, IL-6, TNF-α, and IL-18. These effects were reversed by CD40 overexpression and replicated by CD40 knockdown. As NF-κB functions as a crucial transcriptional regulator of these cytokines[47,48], these findings align with the suppression of the CD40-NF-κB signaling axis.

Macrophage polarization is pivotal in influencing the inflammatory progression of AP, with M1 macrophages intensifying tissue damage through persistent pro-inflammatory cytokine production, whereas M2 macrophages aid in resolving inflammation and promoting tissue repair[49]. OH-CATH30 induced a transition from pro-inflammatory M1 (CD86+) to anti-inflammatory M2 (CD206+) macrophage phenotype. This shift was dependent on CD40, as evidenced by its reversal upon CD40 overexpression and replication upon CD40 knockdown. This immunomodulatory effect likely plays a significant role in the therapeutic efficacy of OH-CATH30 and aligns with the emerging evidence that targeting macrophage polarization is a promising strategy in AP treatment[39,41,50].

In concurrence with our metabolomic findings, OH-CATH30 significantly reduced AA levels and inhibited the expression of its key metabolic enzymes COX2 and 5-LOX in both pancreatic tissues and acinar cells. These effects were similarly dependent on CD40, which further substantiates the presence of a CD40–AA metabolic axis in AP pathogenesis. As AA metabolites such as prostaglandins and leukotrienes are potent inflammatory mediators, this metabolic regulation likely contributes to the overall anti-inflammatory effects of OH-CATH30. Recently, NF-κB has been indicated as a crucial upstream regulator of AA metabolism, and NF-κB inhibition may modulate AA metabolic pathways[30]. The intersection of CD40-mediated inflammatory signaling and AA metabolism is particularly significant because it implies that OH-CATH30 targets a central node that orchestrates both transcriptional and metabolic reprogramming in AP.

This study has several limitations. It uses cerulein-induced AP models that do not represent severe necrotizing pancreatitis. It does not assess the impact of OH-CATH30 on major AP complications such as pancreatic necrosis or systemic inflammatory response. The exact binding site of OH-CATH30 on CD40 is unknown. Moreover, human clinical samples were not used for validation. Finally, the partial efficacy of OH-CATH30 in CD40-deficient settings suggests additional targets or mechanisms. We plan to address these issues in future studies by exploring necrotizing pancreatitis models and validating the findings with clinical samples.

CONCLUSION

In conclusion, this study shows that OH-CATH30 mitigates AP by targeting CD40, leading to the inhibition of the CD40-TRAF6-TAK1-NF-κB signaling pathway, reprogramming of AA metabolism, and promotion of the polarization of anti-inflammatory macrophages. These findings highlight the pivotal role of CD40 in integrating inflammatory signaling with metabolic alterations in AP and indicate that antimicrobial peptides are promising multifunctional anti-inflammatory therapies for inflammatory diseases. Although the cerulein-induced model effectively replicates key features of mild-to-moderate edematous AP in humans, caution is warranted when generalizing these results to severe necrotizing pancreatitis.

References
1.  Zerem E, Kurtcehajic A, Kunosić S, Zerem Malkočević D, Zerem O. Current trends in acute pancreatitis: Diagnostic and therapeutic challenges. World J Gastroenterol. 2023;29:2747-2763.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 144]  [Cited by in RCA: 110]  [Article Influence: 36.7]  [Reference Citation Analysis (0)]
2.  Mederos MA, Reber HA, Girgis MD. Acute Pancreatitis: A Review. JAMA. 2021;325:382-390.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 822]  [Cited by in RCA: 730]  [Article Influence: 146.0]  [Reference Citation Analysis (1)]
3.  Ghiță AI, Pahomeanu MR, Negreanu L. Epidemiological trends in acute pancreatitis: A retrospective cohort in a tertiary center over a seven year period. World J Methodol. 2023;13:118-126.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 9]  [Cited by in RCA: 17]  [Article Influence: 5.7]  [Reference Citation Analysis (2)]
4.  Iannuzzi JP, King JA, Leong JH, Quan J, Windsor JW, Tanyingoh D, Coward S, Forbes N, Heitman SJ, Shaheen AA, Swain M, Buie M, Underwood FE, Kaplan GG. Global Incidence of Acute Pancreatitis Is Increasing Over Time: A Systematic Review and Meta-Analysis. Gastroenterology. 2022;162:122-134.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 631]  [Cited by in RCA: 581]  [Article Influence: 145.3]  [Reference Citation Analysis (0)]
5.  Li T, Qin C, Zhao B, Li Z, Zhao Y, Lin C, Wang W. Global and regional burden of pancreatitis: epidemiological trends, risk factors, and projections to 2050 from the global burden of disease study 2021. BMC Gastroenterol. 2024;24:398.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5]  [Cited by in RCA: 55]  [Article Influence: 27.5]  [Reference Citation Analysis (0)]
6.  Beyer G, Hoffmeister A, Lorenz P, Lynen P, Lerch MM, Mayerle J. Clinical Practice Guideline—Acute and Chronic Pancreatitis. Dtsch Arztebl Int. 2022;119:495-501.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 25]  [Cited by in RCA: 32]  [Article Influence: 8.0]  [Reference Citation Analysis (2)]
7.  Song Y, Lee SH. Recent Treatment Strategies for Acute Pancreatitis. J Clin Med. 2024;13:978.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 27]  [Reference Citation Analysis (0)]
8.  Zhu ZD, Yu T, Liu HJ, Jin J, He J. SOCE induced calcium overload regulates autophagy in acute pancreatitis via calcineurin activation. Cell Death Dis. 2018;9:50.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 45]  [Cited by in RCA: 55]  [Article Influence: 6.9]  [Reference Citation Analysis (0)]
9.  Cai Y, Yang F, Huang X. Oxidative stress and acute pancreatitis (Review). Biomed Rep. 2024;21:124.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 19]  [Reference Citation Analysis (0)]
10.  Li H, Xie J, Guo X, Yang G, Cai B, Liu J, Yue M, Tang Y, Wang G, Chen S, Guo J, Qi X, Wang D, Zheng H, Liu W, Yu H, Wang C, Zhu SJ, Guo F. Bifidobacterium spp. and their metabolite lactate protect against acute pancreatitis via inhibition of pancreatic and systemic inflammatory responses. Gut Microbes. 2022;14:2127456.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 64]  [Cited by in RCA: 97]  [Article Influence: 24.3]  [Reference Citation Analysis (0)]
11.  Gliem N, Ammer-Herrmenau C, Ellenrieder V, Neesse A. Management of Severe Acute Pancreatitis: An Update. Digestion. 2021;102:503-507.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 104]  [Cited by in RCA: 88]  [Article Influence: 14.7]  [Reference Citation Analysis (0)]
12.  Basile G, Vacante M, Corsaro A, Evola FR, Maugeri G, Barchitta M, Biondi A, Musumeci G, D'Agata V, Evola G. Treatment of acute pancreatitis. Minerva Surg. 2025;80:236-257.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
13.  van den Berg FF, Boermeester MA. Update on the management of acute pancreatitis. Curr Opin Crit Care. 2023;29:145-151.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 32]  [Article Influence: 10.7]  [Reference Citation Analysis (1)]
14.  Thakur S, Kaur R, Bhatia L, Bansal R, Singh A, Singh J. Acute Pancreatitis: Clinical Profile of 60 Patients. Cureus. 2023;15:e51234.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 3]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
15.  Li C, Xiong Y, Fu Z, Ji Y, Yan J, Kong Y, Peng Y, Ru Z, Huang Y, Li Y, Yang Y, He L, Tang J, Wang Y, Yang X. The direct binding of bioactive peptide Andersonin-W1 to TLR4 expedites the healing of diabetic skin wounds. Cell Mol Biol Lett. 2024;29:24.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 93]  [Cited by in RCA: 92]  [Article Influence: 46.0]  [Reference Citation Analysis (0)]
16.  Wu YT, Ru ZQ, Peng Y, Fu Z, Jia QY, Kang ZJ, Li YS, Huang YB, Yin SG, Guo K, Liu NX, Feng CA, Tang J, Zhang BY, Yang Z, Wang Y, Yang XW. Peptide Cy (RL-QN15) accelerates hair regeneration in diabetic mice by binding to the Frizzled-7 receptor. Zool Res. 2024;45:1287-1299.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 87]  [Reference Citation Analysis (0)]
17.  Jia Q, Fu Z, Li Y, Kang Z, Wu Y, Ru Z, Peng Y, Huang Y, Luo Y, Li W, Hu Y, Sun X, Wang J, Deng Z, Wu C, Wang Y, Yang X. Hydrogel Loaded with Peptide-Containing Nanocomplexes: Symphonic Cooperation of Photothermal Antimicrobial Nanoparticles and Prohealing Peptides for the Treatment of Infected Wounds. ACS Appl Mater Interfaces. 2024;16:13422-13438.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 94]  [Reference Citation Analysis (0)]
18.  Yeung AT, Gellatly SL, Hancock RE. Multifunctional cationic host defence peptides and their clinical applications. Cell Mol Life Sci. 2011;68:2161-2176.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 482]  [Cited by in RCA: 472]  [Article Influence: 31.5]  [Reference Citation Analysis (0)]
19.  Szerszunowicz I, Kozicki S. Plant-Derived Proteins and Peptides as Potential Immunomodulators. Molecules. 2023;29:209.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 15]  [Reference Citation Analysis (0)]
20.  Li SA, Xiang Y, Wang YJ, Liu J, Lee WH, Zhang Y. Naturally occurring antimicrobial peptide OH-CATH30 selectively regulates the innate immune response to protect against sepsis. J Med Chem. 2013;56:9136-9145.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 51]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
21.  Li SA, Lee WH, Zhang Y. Efficacy of OH-CATH30 and its analogs against drug-resistant bacteria in vitro and in mouse models. Antimicrob Agents Chemother. 2012;56:3309-3317.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 65]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
22.  Zhao F, Lan XQ, Du Y, Chen PY, Zhao J, Zhao F, Lee WH, Zhang Y. King cobra peptide OH-CATH30 as a potential candidate drug through clinic drug-resistant isolates. Zool Res. 2018;39:87-96.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 24]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
23.  Li SA, Liu J, Xiang Y, Wang YJ, Lee WH, Zhang Y. Therapeutic potential of the antimicrobial peptide OH-CATH30 for antibiotic-resistant Pseudomonas aeruginosa keratitis. Antimicrob Agents Chemother. 2014;58:3144-3150.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 32]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
24.  Jiao X, Dong X, Shan H, Qin Z. Assessing the Efficacy of PLGA-Loaded Antimicrobial Peptide OH-CATH30 Microspheres for the Treatment of Bacterial Keratitis: A Promising Approach. Biomolecules. 2023;13:1244.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 8]  [Reference Citation Analysis (0)]
25.  Sun T, Zhan B, Zhang W, Qin D, Xia G, Zhang H, Peng M, Li SA, Zhang Y, Gao Y, Lee WH. Carboxymethyl chitosan nanoparticles loaded with bioactive peptide OH-CATH30 benefit nonscar wound healing. Int J Nanomedicine. 2018;13:5771-5786.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 35]  [Cited by in RCA: 61]  [Article Influence: 7.6]  [Reference Citation Analysis (0)]
26.  Huang Y, Liu C, Fu Z, Li C, Wu Y, Jia Q, Liu X, Kang Z, Li Y, Ni D, Wei Z, Ru Z, Peng Y, Liu X, Li Y, Xiao Z, Tang J, Wang Y, Yang X. The combination of RL-QN15 and OH-CATH30 promotes the repair of acne via the TLR2/NF-κB pathway. Eur J Pharmacol. 2025;989:177233.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 7]  [Reference Citation Analysis (0)]
27.  Jiao X, Liu B, Dong X, Wang S, Cai X, Zhang H, Qin Z. Exploring PLGA-OH-CATH30 Microspheres for Oral Therapy of Escherichia coli-Induced Enteritis. Biomolecules. 2024;14:86.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 8]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
28.  Tang T, Cheng X, Truong B, Sun L, Yang X, Wang H. Molecular basis and therapeutic implications of CD40/CD40L immune checkpoint. Pharmacol Ther. 2021;219:107709.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 214]  [Article Influence: 35.7]  [Reference Citation Analysis (0)]
29.  Korbecki J, Rębacz-Maron E, Kupnicka P, Chlubek D, Baranowska-Bosiacka I. Synthesis and Significance of Arachidonic Acid, a Substrate for Cyclooxygenases, Lipoxygenases, and Cytochrome P450 Pathways in the Tumorigenesis of Glioblastoma Multiforme, Including a Pan-Cancer Comparative Analysis. Cancers (Basel). 2023;15:946.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 31]  [Reference Citation Analysis (1)]
30.  Qin X, Tan Z, Li Q, Zhang S, Hu D, Wang D, Wang L, Zhou B, Liao R, Wu Z, Liu Y. Rosiglitazone attenuates Acute Kidney Injury from hepatic ischemia-reperfusion in mice by inhibiting arachidonic acid metabolism through the PPAR-γ/NF-κB pathway. Inflamm Res. 2024;73:1765-1780.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 8]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
31.  Frossard JL, Kwak B, Chanson M, Morel P, Hadengue A, Mach F. Cd40 ligand-deficient mice are protected against cerulein-induced acute pancreatitis and pancreatitis-associated lung injury. Gastroenterology. 2001;121:184-194.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 31]  [Cited by in RCA: 33]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
32.  Vosters O, Beuneu C, Goldman M, Verhasselt V. N-acetylcysteine derivative inhibits CD40-dependent proinflammatory properties of human pancreatic duct cells. Pancreas. 2008;36:363-368.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 3]  [Article Influence: 0.2]  [Reference Citation Analysis (0)]
33.  Liu X, Luo W, Chen J, Hu C, Mutsinze RN, Wang X, Zhang Y, Huang L, Zuo W, Liang G, Wang Y. USP25 Deficiency Exacerbates Acute Pancreatitis via Up-Regulating TBK1-NF-κB Signaling in Macrophages. Cell Mol Gastroenterol Hepatol. 2022;14:1103-1122.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 34]  [Reference Citation Analysis (0)]
34.  An Y, Tu Z, Wang A, Gou W, Yu H, Wang X, Xu F, Li Y, Wang C, Li J, Zhang M, Xiao M, Di Y, Hou W, Cui Y. Qingyi decoction and its active ingredients ameliorate acute pancreatitis by regulating acinar cells and macrophages via NF-κB/NLRP3/Caspase-1 pathways. Phytomedicine. 2025;139:156424.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 26]  [Article Influence: 26.0]  [Reference Citation Analysis (0)]
35.  Jiang J, Wang R, Song P, Peng Q, Jin X, Li B, Ni J, Shen J, Bao J, Wu Z, Ge X, Wang X, Hu G. Lactate Facilitates Pancreatic Repair Following Acute Pancreatitis by Promoting Reparative Macrophage Polarization. Cell Mol Gastroenterol Hepatol. 2025;19:101535.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 20]  [Cited by in RCA: 17]  [Article Influence: 17.0]  [Reference Citation Analysis (0)]
36.  Hu N, Zhang X, Zhang X, Guan Y, He R, Xue E, Zhang X, Deng W, Yu J, Wang W, Shi Q. Inhibition of Notch activity suppresses hyperglycemia-augmented polarization of macrophages to the M1 phenotype and alleviates acute pancreatitis. Clin Sci (Lond). 2022;136:455-471.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 23]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
37.  Liu X, Yu J, Liu J, Zhou Q, Yang L, Dai Q, Li J, Lan C, Deng D. Norcholic Acid Promotes M1 Macrophage Polarization in Acute Pancreatitis by Activating the Wnt/β-Catenin Pathway. Front Biosci (Landmark Ed). 2025;30:39259.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 2]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
38.  Wang R, Jiang J, Song P, Peng Q, Jin X, Li B, Shen J, Han X, Ni J, Hu G. Kinsenoside alleviates experimental acute pancreatitis by suppressing M1 macrophage polarization via the TLR4/STAT1 signaling pathway. J Ethnopharmacol. 2025;345:119551.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 8]  [Reference Citation Analysis (0)]
39.  Yuan C, Xu X, Wang N, Zhu Q, Zhang J, Gong W, Ding Y, Xiao W, Chen W, Lu G, Yao G, Pan J, Wu K. Paeonol protects against acute pancreatitis by inhibiting M1 macrophage polarization via the NLRP3 inflammasomes pathway. Biochem Biophys Res Commun. 2022;600:35-43.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 23]  [Reference Citation Analysis (0)]
40.  Ding F, Liu G, Gao F, Zheng Z, Hong Y, Chen Y, Weng S. Adropin attenuates pancreatitisassociated lung injury through PPARγ phosphorylationrelated macrophage polarization. Int J Mol Med. 2023;52:95.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 14]  [Article Influence: 4.7]  [Reference Citation Analysis (0)]
41.  Li H, Du R, Xiang A, Liu Y, Guan M, He H. Bone marrow mesenchymal stem cell-derived exosomal miR-181a-5p promotes M2 macrophage polarization to alleviate acute pancreatitis through ZEB2-mediated RACK1 ubiquitination. FASEB J. 2024;38:e70042.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 8]  [Cited by in RCA: 7]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
42.  Zhao H, Gan TX, Liu XD, Jin Y, Lee WH, Shen JH, Zhang Y. Identification and characterization of novel reptile cathelicidins from elapid snakes. Peptides. 2008;29:1685-1691.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 87]  [Cited by in RCA: 101]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
43.  Pandol SJ, Saluja AK, Imrie CW, Banks PA. Acute pancreatitis: bench to the bedside. Gastroenterology. 2007;132:1127-1151.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 517]  [Cited by in RCA: 470]  [Article Influence: 24.7]  [Reference Citation Analysis (4)]
44.  Du K, Huang H. Design of a humanized CD40 agonist antibody with specific properties using AlphaFold2 and development of an anti-PD-L1/CD40 bispecific antibody for cancer immunotherapy. Transl Oncol. 2025;52:102247.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 3]  [Reference Citation Analysis (0)]
45.  Huang Y, Badurdeen DS. Acute Pancreatitis Review. Turk J Gastroenterol. 2023;34:795-801.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 35]  [Reference Citation Analysis (0)]
46.  Guo Q, Jin Y, Chen X, Ye X, Shen X, Lin M, Zeng C, Zhou T, Zhang J. NF-κB in biology and targeted therapy: new insights and translational implications. Signal Transduct Target Ther. 2024;9:53.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1527]  [Cited by in RCA: 1512]  [Article Influence: 756.0]  [Reference Citation Analysis (2)]
47.  Wang Q, Zhang X, Han C, Lv Z, Zheng Y, Liu X, Du Z, Liu T, Xue D, Li T, Wang L. Immunodynamic axis of fibroblast-driven neutrophil infiltration in acute pancreatitis: NF-κB-HIF-1α-CXCL1. Cell Mol Biol Lett. 2025;30:57.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 20]  [Reference Citation Analysis (0)]
48.  Wang Z, Liu J, Li F, Ma S, Zhao L, Ge P, Wen H, Zhang Y, Liu X, Luo Y, Yao J, Zhang G, Chen H. Mechanisms of Qingyi Decoction in Severe Acute Pancreatitis-Associated Acute Lung Injury via Gut Microbiota: Targeting the Short-Chain Fatty Acids-Mediated AMPK/NF-κB/NLRP3 Pathway. Microbiol Spectr. 2023;11:e0366422.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 55]  [Reference Citation Analysis (0)]
49.  Ge Z, Chen Y, Ma L, Hu F, Xie L. Macrophage polarization and its impact on idiopathic pulmonary fibrosis. Front Immunol. 2024;15:1444964.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 105]  [Reference Citation Analysis (0)]
50.  Peng Y, Zhou M, Yang H, Qu R, Qiu Y, Hao J, Bi H, Guo D. Regulatory Mechanism of M1/M2 Macrophage Polarization in the Development of Autoimmune Diseases. Mediators Inflamm. 2023;2023:8821610.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 147]  [Reference Citation Analysis (0)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade A, Grade B, Grade B

Novelty: Grade B, Grade B, Grade B

Creativity or innovation: Grade B, Grade B, Grade B

Scientific significance: Grade A, Grade A, Grade B

P-Reviewer: Tang Y, PhD, Research Assistant Professor, China; Zhao Y, Academic Fellow, China S-Editor: Wu S L-Editor: A P-Editor: Lei YY

Write to the Help Desk