BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2026. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Diabetes. Jan 15, 2026; 17(1): 112942
Published online Jan 15, 2026. doi: 10.4239/wjd.v17.i1.112942
Fractional carbon dioxide laser-induced photothermal activation of mesenchymal stem cell-derived exosomes accelerates diabetic wound healing by enhancing angiogenesis
Jin-Yuan Chen, Zhe Ji, Yu-Ting Wang, Qiang Li, Pei-Sheng Jin, Xue-Yang Li, Department of Plastic Surgery, Affiliated Hospital of Xuzhou Medical University, Xuzhou 221006, Jiangsu Province, China
Jin-Yuan Chen, Zhe Ji, Hao-Nan Wang, Chen-Chen Zhu, The First Clinical Medical College, Xuzhou Medical University, Xuzhou 221004, Jiangsu Province, China
Kang Guo, Department of Burn and Plastic Surgery, Shangqiu First People’s Hospital, Shangqiu 476000, Henan Province, China
Tao Li, Department of Medical Cosmetology, Caoxian People’s Hospital, Heze 274400, Shandong Province, China
Xiang-Bin Zhao, Department of Burn and Plastic Surgery, Second Affiliated Hospital of Xuzhou Medical University, Xuzhou 221006, Jiangsu Province, China
ORCID number: Xue-Yang Li (0009-0005-3731-1691).
Co-first authors: Jin-Yuan Chen and Zhe Ji.
Co-corresponding authors: Pei-Sheng Jin and Xue-Yang Li.
Author contributions: Chen JY and Ji Z drafted the manuscript, they contributed equally to this article, they are the co-first authors of this manuscript; Chen JY, Ji Z, Guo K, Wang HN, Zhu CC, and Wang YT performed the experiments; Chen JY, Li Q, Jin PS, and Li XY designed the research; Chen JY, Ji Z, Li T, Zhao XB, and Li XY analyzed the data; Jin PS and Li XY critically revised the manuscript, they contributed equally to this article, they are the co-corresponding authors of this manuscript; and all authors have read and approved the final manuscript.
Supported by the National Natural Science Foundation of China, No. 82172224; Xuzhou Health Commission Science and Technology Project, No. XWKYHT20220136; and Xuzhou Health Commission Youth Project, No. XWKYHT20220145.
Institutional review board statement: This study was approved by the Medical Ethics Committee of Affiliated Hospital of Xuzhou Medical University, approval No. XYFY2018-KL027.
Institutional animal care and use committee statement: All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of Xuzhou Medical University, No. 202302T009.
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: The data and the code that support the findings of this study are available at reasonable request from the corresponding authors.
Corresponding author: Xue-Yang Li, Associate Professor, Department of Plastic Surgery, Affiliated Hospital of Xuzhou Medical University, Huai-hai West Road, Xuzhou 221006, Jiangsu Province, China. lmlxy240923@163.com
Received: August 11, 2025
Revised: September 29, 2025
Accepted: November 13, 2025
Published online: January 15, 2026
Processing time: 157 Days and 1.1 Hours

Abstract
BACKGROUND

Exosomes (Exos) derived from mesenchymal stem cells (MSCs) have emerged as a promising therapeutic option for diabetic wound healing owing to their strong pro-angiogenic potential. Nevertheless, their relatively low bioactivity remains a major barrier to successful clinical application. Fractional CO2 laser therapy offers a precise and controllable form of photothermal stimulation that may potentiate exosome activity without the need for additional exogenous agents, possibly promoting more effective diabetic wound repair.

AIM

To investigate the mechanisms through which low-energy fractional Exos derived from CO2 laser-preconditioned adipose-derived MSCs (Ad-MSCs) (CO2 laser-Exos) promote the healing of diabetic wounds.

METHODS

Ad-MSCs were subjected to a single exposure of fractional CO2 laser at energy densities of 30 mJ/cm2, 40 mJ/cm2, or 50 mJ/cm2. Infrared thermography was employed to monitor temperature fluctuations in the culture medium. To determine the optimal energy level, western blotting was performed to assess heat shock protein 90 expression, while apoptosis was analyzed by flow cytometry. Exos were subsequently isolated through ultracentrifugation, and sphingosine-1-phosphate (S1P) concentrations within the Exos were measured using enzyme-linked immunosorbent assay. The therapeutic efficacy and underlying mechanisms of CO2 laser-Exos were further investigated through a series of in vitro and in vivo experiments.

RESULTS

Following a single exposure to fractional CO2 laser, the culture medium temperature increased rapidly and then gradually declined. Among the tested groups, Ad-MSCs treated with 40 mJ/cm2 demonstrated the highest heat shock protein 90 expression and exhibited reduced apoptosis. in vitro, CO2 laser-Exos markedly promoted the proliferation, migration, and tube formation of human umbilical vein endothelial cells, while their S1P content was higher than that of unconditioned Exos. Under high-glucose conditions, human umbilical vein endothelial cells showed increased expression of S1P receptor 1 (S1PR1). Silencing S1PR1 significantly impaired the pro-angiogenic activity of CO2 laser-Exos and suppressed the expression of phosphorylated protein kinase B, hypoxia-inducible factor 1 alpha, and vascular endothelial growth factor-A. In vivo, compared with Exos, CO2 laser-Exos substantially accelerated diabetic wound healing by promoting neovascularization within the wound bed.

CONCLUSION

Low-energy fractional CO2 laser irradiation augments the biological activity of MSC-derived Exos through photothermal stimulation. These Exos, in turn, enhance endothelial cell functions by activating the S1PR1/protein kinase B/hypoxia-inducible factor 1 alpha signaling pathway, ultimately accelerating the repair of diabetic wounds.

Key Words: Fractional carbon dioxide; Photothermal effect; Mesenchymal stem cells; Exosomes; Sphingosine-1-phosphate; Diabetic wound

Core Tip: In this study, adipose-derived mesenchymal stem cells were preconditioned with low-energy fractional carbon dioxide laser irradiation, utilizing a controlled photothermal effect to enhance the bioactivity of their secreted exosomes. These exosomes exhibited elevated levels of sphingosine-1-phosphate and significantly promoted endothelial cell proliferation, migration, and tube formation through activation of the sphingosine-1-phosphate receptor 1 protein kinase B/hypoxia-inducible factor 1 alpha signaling pathway, ultimately accelerating diabetic wound healing in vivo.



INTRODUCTION

Diabetes is a chronic and multifaceted metabolic disorder often associated with severe complications, among which chronic non-healing wounds are especially prevalent and clinically significant[1,2]. Such wounds not only cause profound deterioration in patients’ quality of life but also generate considerable medical and socioeconomic burdens[3]. Among the various pathological factors, impaired local angiogenesis is recognized as a major barrier to wound repair[4]. Consequently, strategies aimed at promoting neovascularization are essential for the effective management of diabetic wounds.

Exosomes (Exos) derived from mesenchymal stem cells (MSCs) have attracted growing interest in regenerative medicine because of their low immunogenicity and potential as a cell-free therapeutic modality[5,6]. These nanoscale vesicles are enriched with bioactive components, including proteins, lipids, mRNA, and miRNA, which can be transferred to recipient cells to mediate diverse biological functions[7,8]. Increasing evidence indicates that Exos can promote chronic wound healing primarily by enhancing angiogenesis[9,10]. Nevertheless, the inherently limited bioactivity of native MSC-derived Exos restricts their therapeutic efficacy. Recent studies demonstrate that preconditioning MSCs with physical, chemical, or biological stimuli markedly improves the functional properties of their secreted Exos, thereby enhancing regenerative outcomes. For example, Exos obtained from pioglitazone-preconditioned MSCs display superior pro-angiogenic activity compared with untreated counterparts, ultimately accelerating diabetic wound repair[11].

In recent years, photothermal therapy has gained recognition as a promising strategy for wound repair due to its noninvasive nature, low risk, and precise controllability. Among the various photothermal approaches, fractional CO2 laser therapy has attracted particular interest because of its unique wavelength (10600 nm), which is efficiently absorbed by water and rapidly converted into localized thermal energy, thereby triggering cellular heat stress responses[12,13]. Evidence indicates that low-energy fractional CO2 laser irradiation activates the mitochondrial reactive oxygen species (ROS) signaling pathway in adipose-derived MSCs (Ad-MSCs), leading not only to enhanced secretion of pro-angiogenic factors but also to improved regenerative potential[14]. Nevertheless, the contribution of Exos derived from CO2 laser-preconditioned Ad-MSCs (CO2 laser-Exos) to diabetic wound healing remains largely unexplored.

Previous studies have shown that the sphingosine-1-phosphate (S1P) content in Exos is markedly higher than that in the corresponding conditioned media[15]. S1P, a bioactive sphingolipid produced by phosphorylation of sphingosine through sphingosine kinases, plays crucial roles in angiogenesis and endothelial barrier regulation[16,17]. Whether pretreatment with low-energy fractional CO2 laser can further enrich S1P within Exos and thereby enhance their angiogenic potential has yet to be determined. In this study, we first quantified S1P levels in CO2 laser-derived Exos (CO2 laser-Exos) and control Exos using enzyme-linked immunosorbent assay (ELISA). Functioning as an extracellular signaling molecule, S1P mediates its effects primarily through a family of G protein-coupled receptors, S1P receptor 1 (S1PR1)-5[18]. In endothelial cells, its biological activity is mainly governed by S1PR1, S1PR2, and S1PR3[19]. Notably, binding of S1P to S1PR1 has been reported to activate the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signaling cascade, thereby stimulating endothelial cell proliferation, migration, and tube formation, all of which are central to the angiogenic process[20]. Furthermore, the PI3K/AKT pathway can induce the expression of hypoxia-inducible factor-1α (HIF-1α), a pivotal transcription factor regulating pro-angiogenic genes such as vascular endothelial growth factor (VEGF), which is essential for neovascularization[21].

Therefore, this study sought to determine whether low-energy fractional CO2 laser irradiation could enhance the biological activity of Ad-MSC-derived Exos through photothermal stimulation, thereby improving endothelial cell function and promoting angiogenesis in the context of diabetic wound healing. In addition, we investigated the role of the S1PR1/AKT/HIF-1α signaling pathway in mediating the pro-repair effects of CO2 laser-Exos.

MATERIALS AND METHODS
Isolation, culture, and characterization of Ad-MSCs

Adipose tissue samples were collected from three non-obese female donors (body mass index < 25 kg/m2; age range: 20-35 years) who underwent abdominal dermolipectomy at the Department of Plastic Surgery, Xuzhou Medical University Affiliated Hospital. The inclusion criteria were: Age between 18 years and 45 years; body mass index of 18.5-24.9 kg/m2; absence of metabolic, inflammatory, autoimmune, or infectious diseases as verified by medical history and laboratory testing; and either non-smoker status or cessation of smoking for at least six months. Written informed consent was obtained from all donors. The study protocol was approved by the Medical Ethics Committee of Xuzhou Medical University Affiliated Hospital, approval No. XYFY2018-KL027. Ad-MSCs were isolated following a standard protocol previously described in the literature[22]. Cells were cultured in Dulbecco’s Modified Eagle medium (DMEM; Gibco, United States) supplemented with 10% fetal bovine serum (Gibco, United States) at 37 °C in a 50 mL/L CO2 incubator. Upon reaching 80%-90% confluence, cells were subcultured at a 1:2 ratio. Cell morphology was monitored under an inverted microscope (Olympus, Japan). Phenotypic characterization of Ad-MSCs was performed by flow cytometry, assessing the expression of CD105, CD90, CD44, CD106, CD31, and CD34 (Elabscience, China). Furthermore, their multi-lineage differentiation potential was confirmed using osteogenic and adipogenic differentiation kits (Oricell, China), with differentiation evaluated by Alizarin Red and Oil Red O staining.

Preconditioning of Ad-MSCs and evaluation of photothermal effects

When Ad-MSCs reached approximately 80% confluence, they were subjected to a single session of fractional CO2 laser irradiation using the UltraPulse Encore CO2 laser system (Lumenis, United States). The laser wavelength was fixed at 10600 nm, with the following parameters: Micro DeepFX mode, irradiation area of 10 mm × 10 mm, spot density of 5%, frequency of 300 Hz, and pulse energies of 30 mJ, 40 mJ, and 50 mJ. To minimize the influence of serum on laser-induced cellular responses, Ad-MSCs were pre-incubated in serum-free medium overnight prior to irradiation. During laser exposure, the culture dish lid was removed, and the laser handpiece was positioned 3.5 cm above the dish[14]. Control cells were maintained under identical conditions without irradiation. Temperature changes in the culture medium were monitored in real time using an infrared thermal imaging system (Uni-T, China) to evaluate the photothermal effects. After 24 hours, apoptosis in the NC, 30 mJ/cm2, 40 mJ/cm2, and 50 mJ/cm2 groups was assessed using the Annexin V-FITC/PI apoptosis detection kit (Beyotime, China). In addition, Western blot analysis was performed to measure the expression of heat shock protein 90 (HSP90; Proteintech, China), which was used to determine the optimal laser energy density for subsequent experiments.

Exosome isolation and characterization

Supernatants from control and low-energy fractional CO2 laser-preconditioned Ad-MSCs were collected after 48 hours of culture in serum-free medium and centrifuged to remove cellular debris. The initial centrifugation was performed at 5000 × g for 60 minutes at 4 °C, followed by a second centrifugation at 10000 × g for 30 minutes. The resulting supernatant was then passed through a 0.22 μm filter (Micropore, United States) to eliminate residual particles, and the conditioned medium was designated as Ad-MSCs-AS. Exos were subsequently isolated by ultracentrifugation at 100000 × g for 180 minutes at 4 °C using a Beckman Coulter ultracentrifuge (Beckman Coulter, United States). The resulting exosomal pellet was resuspended in sterile phosphate-buffered saline (PBS) and stored at -80 °C for further experiments. Protein concentrations of isolated Exos were quantified using a bicinchoninic acid protein assay kit (Beyotime, China). Exosome morphology was examined by transmission electron microscopy (TEM; Hitachi, Japan), and particle size distribution was assessed using nanoparticle tracking analysis (NTA). To further confirm exosome identity, the surface markers CD63 and tumor susceptibility gene 101 (HuaBio, China) were detected by Western blot analysis.

Exosome uptake

Exos derived from untreated and laser-preconditioned Ad-MSCs were labeled with the red fluorescent dye PKH26 (KeygenBio, China) and co-cultured with human umbilical vein endothelial cells (HUVECs) for 24 hours. After incubation, cells were fixed with 4% paraformaldehyde for 10 minutes, and nuclei were counterstained with DAPI in the dark at room temperature for 30 minutes. The internalization of Exos by HUVECs was then visualized using a laser scanning confocal microscope (Olympus, Japan).

ELISA assay

S1P levels were quantified in four groups using an S1P ELISA kit (Beyotime, China): (1) Normal control (NC, supernatant from untreated Ad-MSCs); (2) Activated supernatant from laser-irradiated Ad-MSCs; (3) Exos; and (4) CO2 laser-Exos. To ensure complete release of S1P from exosomal samples, three freeze-thaw cycles were performed prior to measurement. All subsequent steps were carried out strictly according to the manufacturer’s instructions.

Culturing and treatment of HUVECs

HUVECs were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and maintained in DMEM supplemented with 10% fetal bovine serum. To mimic high-glucose (HG) conditions in vitro, HUVECs were cultured in serum-free DMEM containing 25 mmol/L glucose for 48 hours, while the normal glucose (NG) group was cultured in serum-free DMEM with 5.5 mmol/L glucose. To evaluate the involvement of the PI3K/AKT signaling pathway in CO2 laser-Exos-mediated angiogenesis, HUVECs were pretreated with either the AKT phosphorylation inhibitor LY294002 or the activator SC79 (MedChem Express, United States).

Transfection of HUVECs

HUVECs were seeded in 6-well plates and transfected once cell confluence reached 70%-80%. The S1PR1 shRNA (shS1PR1) plasmid was synthesized by Sevier Biotechnology (Wuhan, Hubei Province, China) and transfected into HUVECs using Lipofectamine™ 3000 reagent (Invitrogen, United States) according to the manufacturer’s protocol. After 24 hours, puromycin (Beyotime, China) was added to the culture medium for selection, and stable S1PR1-knockdown HUVEC lines were established. The efficiency of S1PR1 knockdown was confirmed by Western blot analysis of protein expression. The specific shS1PR1 sequence is provided in Table 1.

Table 1 The sequences of sphingosine-1-phosphate receptor 1 shRNA.
ID
Sequence (5’-3’)
shS1PR1 1GCGGGAAGGGAGTATGTTTGTCTCGAGACAAACATACTCCCTTCCCGC
shS1PR1 2GCAATAACTTCCGCCTCTTCCCTCGAGGGAAGAGGCGGAAGTTATTGC
shS1PR1 3GGATCATGTCCTGCTGCAACTCGAGTTGCAGCAGGACATGATCC
Cell viability and proliferation assays

Cell viability was evaluated using the Cell Counting Kit-8 (CCK-8; Servicebio, China). HUVECs were seeded in 96-well plates and treated with either Exos or CO2 laser-Exos. After 48 hours of incubation, 10 μL of CCK-8 solution was added to each well, followed by a 1-hour incubation at 37 °C. Absorbance was then measured at 450 nm using a microplate reader (Multiskan GO, Thermo Fisher, United States). Cell proliferation was further assessed using a 5-ethynyl-2’-deoxyuridine (EdU) assay kit (Beyotime, China). HUVECs were seeded in 48-well plates, subjected to EdU labeling, fixation, and staining according to the manufacturer’s instructions, and subsequently imaged with a fluorescence microscope (Olympus, Japan). The percentage of EdU-positive cells was quantified using ImageJ software.

Transwell assay

To evaluate the migratory capacity of HUVECs, a Transwell migration assay was conducted. Briefly, HUVECs were resuspended in serum-free medium and seeded into the upper chamber of a Transwell insert (Corning, United States) at a density of approximately 2 × 104 cells per well. The lower chamber was filled with complete medium supplemented with (Exos or CO2 laser-Exos) or other indicated treatments. Following 24 hours of incubation at 37 °C in 5% CO2, cells that migrated to the underside of the membrane were fixed with 4% paraformaldehyde and stained with crystal violet. Migrated cells were imaged and quantified under an optical microscope.

Wound healing assay

To assess the wound healing ability of HUVECs, a scratch assay was performed. Briefly, HUVECs were seeded in 6-well plates and cultured to approximately 90% confluence. A sterile 1 mL pipette tip was used to create a straight vertical scratch across the cell monolayer. The wells were gently washed with PBS to remove detached cells, after which serum-free medium containing the indicated treatments was added. Images of the wound area were acquired at 0 hours and 36 hours using an optical microscope, and wound closure was subsequently analyzed.

Tube formation assay

To assess the angiogenic potential of HUVECs, a Matrigel tube formation assay was conducted. Briefly, a pre-cooled 96-well plate was coated with 50 μL of Matrigel (Mogengel Bio, China) per well and incubated at 37 °C for 1 hour to allow solidification. HUVECs subjected to the indicated treatments were resuspended in serum-free medium and seeded onto the Matrigel at a density of 1 × 104 cells per well. After incubation at 37 °C for 6 hours, the formation of capillary-like networks was observed and imaged using an optical microscope. Tube formation was quantified by analyzing the number of capillary-like structures with ImageJ software.

Quantitative real-time polymerase chain reaction analysis

Total RNA was extracted from cells using TRIzol reagent (Invitrogen, United States), and cDNA was synthesized with the PrimeScript RT reagent kit (Takara, China) according to the manufacturer’s protocol. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed on a LightCycler 96 system (Roche, Germany) using SYBR Green PCR mix (TransGen Biotech, China). glyceraldehyde-3-phosphate dehydrogenase served as the internal control, and relative gene expression was determined using the 2-ΔΔCt method. The specific primer sequences are provided in Table 2.

Table 2 Primers used in the study.
Primer
Specie
Forward (5’-3’)
Reverse (5’-3’)
S1PR1HumanTCTGCGGGAAGGGAGTATGTTGCAGGAAGAGGCGGAAGTTATT
S1PR2HumanCGTCTTTATCGTCTGCTGGCTGTAGTGGGCTTTGTAGAGGATCG
S1PR3HumanCCTCTACGCACGCATCTACTTCAACACGCTCACCACAATCACC
GAPDHHumanGGAAGCTTGTCATCAATGGAAATCTGATGACCCTTTTGGCTCCC
Western blot analysis

After collection of Exos and treated cells, proteins were extracted using RIPA buffer (Beyotime, China) on ice for 30 minutes. The lysates were centrifuged at 12000 × g for 10 minutes at 4 °C, and the supernatants were collected for protein quantification using a bicinchoninic acid protein assay kit (Beyotime, China). Protein samples were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (8% or 12% separating gels depending on protein molecular weight) and transferred onto PVDF membranes (Biosharp, China). Membranes were blocked with 5% non-fat milk at room temperature for 1 hour, followed by overnight incubation at 4 °C with appropriately diluted primary antibodies (Table 3). After washing, membranes were incubated with horseradish peroxidase-conjugated secondary antibodies at room temperature for 1 hour. Protein bands were then visualized using an enhanced chemiluminescence detection kit (Beyotime, China).

Table 3 Primary antibodies used in the study.
Antibody
Company
Catalog number
Dilution ratio
Anti-CD63HuaBioCatET1607-21:2000
Anti-TSG101HuaBioCatET1701-591:2000
Anti-HSP90ProteintechCat13171-1-AP1:2000
Anti-phospho-AKTProteintechCat28731-1-AP1:2000
Anti-AKTProteintechCat10176-2-AP1:2000
Anti-HIF-1αCell signalingCat361691:1000
Anti-VEGFAProteintechCat19003-1-AP1:1000
Anti-S1PR1ProteintechCat55133-1-AP1:1000
Anti-S1PR2ProteintechCat21180-1-AP1:1000
Anti-S1PR3ProteintechCat84697-1-RR1:5000
Anti-β-actinProteintechCat66009-1-Ig1:10000
Animal model

All animal experiments were approved by the Animal Ethics Committee of Xuzhou Medical University, No. 202302T009. To establish the diabetic mouse model, 6-week-old male Swiss-Hauschka (ICR) mice were intraperitoneally injected with streptozotocin (65 mg/kg; Sigma, United States). Blood glucose levels were monitored, and diabetes was confirmed when glucose concentrations remained above 16.7 mmol/L. A total of 24 mice were used, including 18 diabetic mice and 6 normal mice, which were randomly assigned to four groups (n = 6 per group): (NC, normal wound healing), PBS-treated, Exos-treated, and CO2 laser-Exos-treated. Under anesthesia (intraperitoneal sodium pentobarbital), full-thickness skin wounds of 15 mm in diameter were created on the backs of each mouse under sterile conditions. The surgical field was disinfected with ethanol (700 mL/L), and the skin was carefully excised down to the subcutaneous tissue; wound edges were trimmed to remove residual tissue. PBS, Exos, or CO2 laser-Exos were injected at multiple points within the wound area (at least six injection sites per wound). After surgery, mice were housed in a biosafety facility with ad libitum access to food and water. Wound healing was monitored via digital photography on postoperative 0 day, 3 days, 7 days, 10 days, and 14 day, and wound areas were measured using ImageJ software (NIH, United States). The wound closure rate was calculated using the following formula: Wound closure (%) = [(original wound area - unhealed wound area)/original wound area] × 100%.

Histological and immunohistochemical analysis

On day 14 post-surgery, mice were euthanized by intraperitoneal injection of an overdose of 0.6% sodium pentobarbital, and wound tissues were collected and fixed in 4% paraformaldehyde. Samples were subsequently dehydrated, embedded in paraffin, and sectioned into 5 μm-thick slices. Tissue sections were stained with Hematoxylin and Eosin and Masson’s trichrome to evaluate the thickness of the newly formed epithelium and the maturation of collagen fibers. For immunohistochemical analysis, paraffin sections were rehydrated and incubated overnight at 4 °C with a primary antibody against CD31 (1:200; Proteintech, China). The following day, sections were treated with the appropriate secondary antibodies and the avidin–biotin complex, followed by color development using 3,3’-diaminobenzidinesubstrate. Stained sections were examined and imaged under an optical microscope.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 9 software. Data are presented as mean ± SD. Differences between two groups were evaluated using Student’s t-test, while comparisons among multiple groups were conducted using one-way analysis of variance followed by Tukey’s post-hoc test. A P value of < 0.05 was considered statistically significant.

RESULTS
Characterization of Ad-MSCs

The characterization of Ad-MSCs was verified through cell morphology, surface marker expression, and multilineage differentiation assays. As shown in Figure 1A, Ad-MSCs displayed a spindle-shaped morphology and adhered well to the culture surface. Osteogenic and adipogenic differentiation assays confirmed their multilineage potential, as evidenced by positive calcium deposition and lipid droplet formation (Figure 1B). Flow cytometry analysis demonstrated high expression of CD105, CD90, and CD44, with low expression of CD106, CD31, and CD34 (Figure 1C). Together, these findings confirm that the isolated Ad-MSCs possess typical MSCs characteristics and multilineage differentiation capacity.

Figure 1
Figure 1 Characterization of adipose-derived mesenchymal stem cells. A: Morphology of third-passage adipose-derived mesenchymal stem cells (Ad-MSCs). Scale bar = 200 μm; B: Osteogenic and adipogenic differentiation potential of Ad-MSCs. Scale bar = 100 μm; C: Flow cytometry analysis of surface markers on Ad-MSCs, including CD105, CD90, CD44, CD106, CD31, and CD34. Ad-MSCs: Adipose-derived mesenchymal stem cells.
Low-energy fractional CO2 laser-induced heat stress enhances HSP90 expression in Ad-MSCs

To investigate the photothermal effects of fractional CO2 laser on Ad-MSCs, temperature changes in the culture medium were monitored using infrared thermal imaging. As shown in Figure 2A, the medium temperature increased immediately after laser exposure in a dose-dependent manner, reaching peak values of 49.1 °C (50 mJ/cm2), 42.7 °C (40 mJ/cm2), and 39.5 °C (30 mJ/cm2), and gradually declined over the subsequent 10 minutes (Figure 2B). Western blot analysis revealed a significant upregulation of HSP90 expression in the 30 mJ/cm2 group compared with the NC group, with the highest expression observed in the 40 mJ/cm2 group, exceeding both the 30 mJ/cm2 and 50 mJ/cm2 groups (Figure 2C and D). Flow cytometry performed 24 hours post-treatment showed a slightly elevated apoptosis rate in the 30 mJ/cm2 group relative to NC, while the 40 mJ/cm2 group exhibited a lower apoptosis rate than the 50 mJ/cm2 group, with no statistically significant difference compared to the 30 mJ/cm2 group (Figure 2E and F). Collectively, these results indicate that low-energy fractional CO2 laser enhances HSP90 expression in Ad-MSCs via photothermal stimulation.

Figure 2
Figure 2 Low-energy fractional CO2 laser-induced heat stress enhances heat shock protein 90 expression in adipose-derived mesenchymal stem cells. aP < 0.05, bP < 0.01, cP < 0.001. Data are presented as mean ± SD (n = 3). A: Infrared thermal images of cell culture dishes following CO2 laser irradiation; B: Photothermal curve; C and D: Western blot analysis of heat shock protein 90 protein expression; E and F: Flow cytometric analysis of apoptosis. HSP90: Heat-shock protein 90; NC: Negative control; V-FITC: Vascular fluorescein isothiocyanate.
Characterization of Exos

Cell supernatants from untreated and CO2 laser-preconditioned Ad-MSCs were collected, and (Exos and CO2 laser-Exos) were isolated via ultracentrifugation. Exosome characterization was performed using TEM, NTA, and western blotting. TEM analysis showed that both Exos and CO2 laser-Exos exhibited typical exosomal morphology, appearing as homogeneous, spherical vesicles with a distinct membrane structure (Figure 3A). Western blotting confirmed the presence of classic exosome markers CD63 and tumor susceptibility gene 101 in both groups (Figure 3B). NTA analysis demonstrated similar size distributions for both exosome populations, with the majority of particles ranging from 80-180 nm (Figure 3C). These results indicate that Exos and CO2 laser-Exos share comparable morphology, particle size, and protein expression, confirming successful exosome isolation, and that low-energy CO2 laser stimulation did not significantly alter exosome secretion characteristics. Furthermore, uptake studies using PKH26-labeled Exos revealed red fluorescence around HUVEC nuclei (Figure 3D), demonstrating effective internalization of both Exos and CO2 laser-Exos by endothelial cells.

Figure 3
Figure 3 Characterization of exosomes. A: Transmission electron microscopy images showing the morphology of exosomes (Exos) and CO2 laser-Exos. Scale bar = 100 nm; B: Western blot analysis of exosomal markers CD63 and tumor susceptibility gene 101 in Exos and CO2 laser-Exos; C: Nanoparticle tracking analysis of size distribution of Exos and CO2 laser-Exos; D: Confocal laser scanning microscopy showing the uptake of PKH26-labeled Exos and CO2 laser-Exos by human umbilical vein endothelial cells. Exos and nuclei were stained red and blue, respectively. Scale bar = 10 μm. Exos: Exosomes; CO2 laser-Exos: Exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells; TSG101: Tumor susceptibility gene 101.
CO2 laser-Exos promote angiogenesis in HUVECs

To evaluate the effects of Exos on angiogenesis, HUVECs were treated under NG, HG, HG + Exos, and HG + CO2 laser-Exos conditions. Cell proliferation and viability, assessed by EdU and CCK-8 assays, demonstrated that both Exos and CO2 laser-Exos improved proliferation and viability under HG-induced stress, with CO2 laser-Exos showing the most pronounced enhancement (Figure 4A-C). Migration assays, including Transwell and wound healing, revealed that both exosome types promoted HUVEC migration, with CO2 laser-Exos producing the strongest effect (Figure 4D-G). In addition, tube formation assays showed that HUVECs exposed to CO2 laser-Exos formed more extensive capillary-like networks than those treated with Exos (Figure 4H and I). To explore the underlying mechanisms, Western blot analysis was performed to examine components of the AKT/HIF-1α/VEGF-A signaling pathway. Both Exos and CO2 laser-Exos partially reversed the HG-induced suppression of phosphorylated-AKT (p-AKT), HIF-1α, and VEGF-A expression, with CO2 laser-Exos inducing the most robust recovery (Figure 4J and K). Collectively, these findings indicate that CO2 laser-Exos effectively promote angiogenesis in HUVECs.

Figure 4
Figure 4 CO2 laser-exosomes promote angiogenesis in human umbilical vein endothelial cells. aP < 0.05, bP < 0.01, cP < 0.001. Data are presented as mean ± SD (n = 3). A and B: 5-ethynyl-2’-deoxyuridine incorporation assay to assess the proliferative capacity of human umbilical vein endothelial cells (HUVECs). Scale bar = 100 μm; C: Cell Counting Kit-8 assay to evaluate the viability of HUVECs after treatment with high glucose and exosomes; D and E: Transwell migration assay to evaluate the migratory ability of HUVECs. Scale bar = 200 μm; F and G: In vitro wound healing assay to assess cell migration. Scale bar = 200 μm; H and I: Tube formation assay to evaluate the ability of HUVECs to form capillary-like structures. Scale bar = 200 μm; J and K: Western blot analysis of the expression levels of phosphorylated protein kinase B, protein kinase B, hypoxia-inducible factor-1α, and vascular endothelial growth factor-A. NG: Normal glucose; HG: High glucose; Exos: Exosomes; CO2 laser-Exos: Exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells; EdU: 5-Ethynyl-2’-deoxyuridine; AKT: Protein kinase B; p-AKT: Phosphorylated protein kinase B; HIF-1α: Hypoxia-inducible factor-1α; VEGF-A: Vascular endothelial growth factor-A.
The S1P/S1PR1 signaling axis mediates CO2 laser-Exos-induced angiogenesis

To elucidate the upstream regulatory mechanisms through which CO2 laser-Exos promote angiogenesis, we investigated the expression changes of S1P and its receptors. First, S1P levels in Exos were quantified using ELISA, revealing that S1P concentrations were significantly higher in CO2 laser-Exos compared to control Exos (Figure 5A). Next, we examined the expression of S1P receptors in HUVECs under HG conditions. qPCR analysis demonstrated that HG treatment significantly upregulated S1PR1 mRNA expression relative to the NG group, whereas S1PR2 and S1PR3 expression showed no significant changes across groups (Figure 5B). Western blot analysis further confirmed elevated S1PR1 protein levels in the HG group, while S1PR2 and S1PR3 remained unchanged (Figure 5C and D). To assess the functional role of the S1P/S1PR1 axis in CO2 laser-Exos-induced angiogenesis, HUVECs were transfected with shS1PR1 plasmid to specifically knock down S1PR1 expression. Functional assays demonstrated that S1PR1 knockdown significantly impaired HUVEC biological activity. Compared to the vector group, the shS1PR1-treated cells exhibited a marked reduction in EdU-positive cells, decreased viability in the CCK-8 assay, reduced migration in the Transwell assay, and slower wound closure in the scratch assay (Figure 5E-K). Similarly, tube formation assays showed a substantial decrease in capillary-like structures in the shS1PR1 group relative to the vector group (Figure 5L and M). Comparable trends were observed when comparing the vector + CO2 laser-Exos group with the shS1PR1 + CO2 laser-Exos group. Moreover, western blot analysis revealed that shS1PR1 treatment significantly downregulated the protein expression of p-AKT, HIF-1α, VEGF-A, and S1PR1, a pattern also evident in the vector + CO2 laser-Exos vs shS1PR1 + CO2 laser-Exos comparison (Figure 5N and O). Collectively, these results indicate that the S1P/S1PR1 signaling axis is crucial for CO2 laser-Exos-mediated promotion of angiogenesis in HUVECs.

Figure 5
Figure 5 The sphingosine-1-phosphate/sphingosine-1-phosphate receptor signaling axis mediates exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells-induced angiogenesis. aP < 0.05, bP < 0.01, cP < 0.001. Data are presented as mean ± SD (n = 3). A: Enzyme-linked immunosorbent assay analysis of sphingosine-1-phosphate concentrations in activated supernatant from non-irradiated adipose-derived mesenchymal stem cells (Ad-MSCs), activated supernatant from laser-irradiated Ad-MSCs, exosomes, and exosomes derived from CO2 laser-preconditioned Ad-MSCs; B: Relative mRNA expression levels of sphingosine-1-phosphate receptor (S1PR1)-3 in human umbilical vein endothelial cells (HUVECs); C and D: Western blot and quantitative analysis of the relative protein expression of S1PR1-3 in HUVECs; E and F: 5-Ethynyl-2’-deoxyuridine incorporation assay to evaluate HUVEC proliferation. Scale bar = 100 μm; G: Cell Counting Kit-8 assay to assess HUVEC viability; H and I: Transwell migration assay to evaluate HUVEC motility. Scale bar = 200 μm; J and K: In vitro wound healing assay to assess migration. Scale bar = 200 μm; L and M: Tube formation assay to examine capillary-like network formation by HUVECs. Scale bar = 200 μm; N and O: Western blot analysis of the expression levels of phosphorylated protein kinase B, protein kinase B, hypoxia-inducible factor-1α, vascular endothelial growth factor-A, and S1PR1. NC: Activated supernatant from non-irradiated adipose-derived mesenchymal stem cells; NG: Normal glucose; HG: High glucose; HP: High permeability; CO2 laser-AS: Activated supernatant from laser-irradiated adipose-derived mesenchymal stem cells; Exos: Exosomes; CO2 laser-Exos: Exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells; EdU: 5-Ethynyl-2’-deoxyuridine; S1P: Sphingosine-1-phosphate; S1PR: Sphingosine-1-phosphate receptor; shS1PR: Short hairpin RNA targeting sphingosine-1-phosphate receptor; AKT: Protein kinase B; p-AKT: Phosphorylated protein kinase B; HIF-1α: Hypoxia-inducible factor-1α; VEGF-A: Vascular endothelial growth factor-A.
CO2 laser-Exos promote angiogenesis through activation of the S1PR1/AKT/HIF-1α pathway

To further validate that CO2 laser-Exos promote angiogenesis via the S1PR1/AKT/HIF-1α pathway, we conducted intervention experiments using the AKT phosphorylation inhibitor LY294002 and the activator SC79. Western blot analysis revealed that, compared to the NC group, LY294002 treatment markedly reduced the expression levels of p-AKT, HIF-1α, and VEGF-A (Figure 6A and B). Additionally, protein levels of p-AKT, HIF-1α, and VEGF-A were lower in the CO2 laser-Exos + LY294002 group than in the CO2 laser-Exos group, indicating that inhibition of AKT phosphorylation attenuated the pro-angiogenic effects of CO2 laser-Exos. Functional assays, including EdU, CCK-8, Transwell migration, scratch healing, and tube formation, demonstrated that LY294002 treatment significantly impaired HUVEC proliferation, migration, and capillary-like structure formation (Figure 6C-K). In contrast, treatment with SC79 significantly elevated p-AKT, HIF-1α, and VEGF-A levels compared to the NC group. Moreover, protein expression of p-AKT, HIF-1α, and VEGF-A in the shS1PR1 + SC79 group was higher than in the shS1PR1 group (Figure 7A and B). Correspondingly, cell function assays showed that SC79 treatment significantly enhanced HUVEC proliferation, migration, and tube formation capabilities (Figure 7C-K).

Figure 6
Figure 6 LY294002 suppresses exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells -induced angiogenesis. bP < 0.01; cP < 0.001. Data are presented as mean ± SD (n = 3). A and B: Western blot analysis of phosphorylated protein kinase B, protein kinase B, hypoxia-inducible factor-1α, and vascular endothelial growth factor-A protein expression levels in human umbilical vein endothelial cells (HUVECs) treated with LY294002 vs negative control and LY294002 + exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells vs exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells; C and D: 5-Ethynyl-2’-deoxyuridine incorporation assay to assess HUVEC proliferation. Scale bar = 100 μm; E: Cell Counting Kit-8 assay to evaluate HUVEC viability; F and G: Transwell migration assay to assess the migratory capacity of HUVECs. Scale bar = 200 μm; H and I: In vitro wound healing assay to evaluate cell migration. Scale bar = 200 μm; J and K: Tube formation assay to examine the formation of capillary-like structures by HUVECs. Scale bar = 200 μm. EdU: 5-Ethynyl-2’-deoxyuridine; NC: Negative control; CO2 laser-Exos: Exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells; AKT: Protein kinase B; p-AKT: Phosphorylated protein kinase B; HIF-1α: Hypoxia-inducible factor-1α; VEGF-A: Vascular endothelial growth factor-A.
Figure 7
Figure 7 SC79 enhances exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells-induced angiogenesis. bP < 0.01; cP < 0.001. Data are presented as mean ± SD (n = 3). A and B: Western blot analysis of phosphorylated protein kinase B, protein kinase B, hypoxia-inducible factor-1α, and vascular endothelial growth factor-A protein levels in human umbilical vein endothelial cells (HUVECs) treated with SC79 vs negative control and SC79 + short hairpin RNA targeting sphingosine-1-phosphate receptor vs short hairpin RNA targeting sphingosine-1-phosphate receptor; C and D: 5-Ethynyl-2’-deoxyuridine incorporation assay to assess cell proliferation. Scale bar = 100 μm; E: Cell Counting Kit-8 assay to evaluate the viability of HUVECs; F and G: Transwell assay to assess HUVEC migration. Scale bar = 200 μm; H and I: In vitro wound healing assay to assess the migratory capacity of HUVECs. Scale bar = 200 μm; J and K: Tube formation assay to visualize the capillary-like structure formation in HUVECs. Scale bar = 200 μm. EdU: 5-Ethynyl-2’-deoxyuridine; NC: Negative control; shS1PR1: Short hairpin RNA targeting sphingosine-1-phosphate receptor; AKT: Protein kinase B; p-AKT: Phosphorylated protein kinase B; HIF-1α: Hypoxia-inducible factor-1α; VEGF-A: Vascular endothelial growth factor-A.
CO2 laser-Exos accelerate angiogenesis in diabetic wounds

To investigate the pro-angiogenic effects of CO2 laser-Exos, we established a full-thickness skin wound model on the backs of diabetic mice and administered multiple subcutaneous injections of PBS, Exos, or CO2 laser-Exos at the wound edges. Digital imaging revealed that wound healing was markedly delayed in diabetic mice compared to NCs. Both Exos and CO2 laser-Exos promoted wound closure relative to the PBS group, with CO2 laser-Exos exhibiting a more pronounced effect on postoperative days 7, 10, and 14 (Figure 8A and B). To further assess reepithelialization and collagen deposition, hematoxylin and eosin and Masson staining were performed on wound tissues. The results demonstrated that both Exos and CO2 laser-Exos enhanced skin regeneration and collagen deposition in diabetic wounds, with CO2 laser-Exos showing superior effects (Figure 8C-F). Moreover, immunohistochemical analysis revealed a significant increase in the expression of the angiogenesis marker CD31 in wound tissues treated with Exos and CO2 laser-Exos compared to the PBS group, indicating enhanced neovascularization. Notably, neovascular density was significantly higher in the CO2 laser-Exos group than in the Exos group (Figure 8G and H). Collectively, these findings indicate that CO2 laser-Exos effectively accelerate angiogenesis in diabetic wounds.

Figure 8
Figure 8 Exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells accelerate angiogenesis in diabetic wounds. bP < 0.01; cP < 0.001. Data are presented as mean ± SD (n = 6). A and B: Representative images of full-thickness skin defects in non-diabetic mice and diabetic mice treated with phosphate-buffered saline, exosomes, or exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells on 0 day, 3 days, 7 days, 10 days, and 14 days post-surgery; C and D: Quantification of hematoxylin and eosin staining and skin thickness on day 14. Scale bar = 100 μm; E and F: Quantification of Masson’s trichrome staining and collagen deposition on day 14. Scale bar = 100 μm; G and H: Representative immunohistochemical staining images for CD31. Scale bar = 100 μm. NC: Negative control; PBS: Phosphate-buffered saline; Exos: Exosomes; CO2 laser-Exos: Exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells.
DISCUSSION

In this study, we investigated the pro-angiogenic effects of CO2 laser-Exos secreted by Ad-MSCs preconditioned with low-energy fractional CO2 laser light and explored the underlying molecular mechanisms promoting diabetic wound healing both in vitro and in vivo. Our results demonstrated that CO2 laser-Exos significantly enhanced the angiogenic capacity of HUVECs by activating the S1PR1/AKT/HIF-1α signaling pathway, thereby accelerating wound healing in diabetic mice (Figure 9). These findings suggest that low-energy fractional CO2 laser may serve as a novel physical preconditioning strategy to effectively augment the biological activity of MSC-derived Exos, providing new insights and potential clinical applications for cell-free therapy in diabetic wound healing.

Figure 9
Figure 9 Schematic illustration showing that low-energy fractional CO2 laser enhances heat-shock protein 90 expression in adipose-derived mesenchymal stem cells via photothermal effects, thereby improving the biological activity of their derived exosomes. These exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells promote angiogenesis and accelerate diabetic wound healing by activating the sphingosine-1-phosphate receptor/protein kinase B/hypoxia-inducible factor-1α signaling pathway. Ad-MSCs: Adipose-derived mesenchymal stem cells; CO2 laser-Exos: Exosomes derived from CO2 laser-preconditioned adipose-derived mesenchymal stem cells; HSP90: Heat-shock protein 90; AKT: Protein kinase B; HIF-1α: Hypoxia-inducible factor-1α; VEGF-A: Vascular endothelial growth factor-A; S1P: Sphingosine-1-phosphate; S1PR: Sphingosine-1-phosphate receptor; HUVECs: Human umbilical vein endothelial cells.

Diabetes is often associated with endothelial dysfunction, resulting in impaired angiogenesis and insufficient oxygen and nutrient supply, which severely delays wound healing[23,24]. In recent years, MSCs have attracted considerable attention in tissue repair and regenerative medicine due to their multipotent differentiation capabilities and secretion of diverse bioactive factors[25,26]. Among them, Ad-MSCs have emerged as a particularly promising MSC source because of their abundant availability, ease of acquisition, and strong proliferative capacity. They have been extensively utilized in research on tissue damage and chronic wound repair[27,28]. Notably, accumulating evidence indicates that MSCs exert their therapeutic effects primarily through paracrine mechanisms, with Exos serving as key effectors in this process[29,30]. Compared to MSCs, MSC-derived Exos exhibit superior membrane stability, biocompatibility, and enhanced biological activity[31], while also avoiding potential risks of immune rejection and tumorigenicity associated with MSC transplantation[32,33].

In recent years, studies have increasingly focused on enhancing the functional activity of Exos through various modification strategies. For instance, Exos derived from MSCs pretreated with atorvastatin have been shown to significantly promote angiogenesis, thereby accelerating diabetic wound healing[34]. Motivated by these findings, we investigated the role of CO2 laser-Exos in diabetic wound healing and observed that CO2 laser-Exos markedly enhanced the angiogenic capacity of HUVECs. Clinically, fractional CO2 lasers are widely used for scar repair and improvement of photo-aged skin, demonstrating promising therapeutic effects[35,36]. Furthermore, clinical studies suggest that CO2 lasers may facilitate wound healing in diabetic foot ulcers[37,38]. Compared to conventional debridement, CO2 laser debridement for infected and chronic wounds allows for more precise and selective tissue removal, provides antimicrobial effects, improves periwound perfusion, and consequently achieves superior healing outcomes with a favorable safety profile[39-41]. However, the effects of CO2 laser-pretreated Exos remain largely unexplored. In this study, Ad-MSCs were pretreated with low-energy fractional CO2 lasers. This wavelength is strongly absorbed by water, generating thermal effects within cells[13]. Previous research has demonstrated that excessive temperatures, particularly those exceeding 43 °C, can cause thermal damage, leading to apoptosis or cell death[42,43]. Therefore, precise temperature control during laser treatment is essential to prevent irreversible cellular injury. To achieve this, we employed the Micro DeepFX mode, which evenly distributes laser energy across the irradiation area in micro-pixels. This approach enables localized heating at each energy point, activating cellular thermal stress responses while avoiding widespread damage caused by excessively high overall temperatures[44]. To determine the optimal laser energy density, three gradient groups (30 mJ/cm2, 40 mJ/cm2, and 50 mJ/cm2) were tested. The 40 mJ/cm2 group exhibited the highest expression of HSP90 in Ad-MSCs compared to the 30 mJ/cm2 and 50 mJ/cm2 groups. HSP90, a molecular chaperone, facilitates protein repair and provides cellular protection under stress conditions[45,46]. Consistently, studies using human full-thickness 3D skin equivalent models have shown that, by day 5 after fractional ultrapulsed CO2 laser irradiation, re-epithelialization is nearly complete, accompanied by transcriptional upregulation of multiple repair-related genes, including heat-shock protein family members [e.g., heat shock protein family B (small) member 3] and genes involved in tissue remodeling and immune responses[47]. Infrared thermal imaging indicated that the peak temperature of the culture medium in the 50 mJ/cm2 group reached 49.1 °C, and the apoptosis rate was significantly higher than in the 40 mJ/cm2 group, suggesting that excessively high temperatures induced cellular damage, resulting in downregulation of HSP90 expression. Recent studies have also shown that HSP90 can be secreted extracellularly via Exos, mediating intercellular communication and playing a vital role in skin wound repair[48,49]. In vitro, CO2 laser-Exos pretreated at 40 mJ/cm2 significantly enhanced HUVEC proliferation, migration, and tube formation under high glucose conditions. in vivo, CO2 laser-Exos markedly accelerated wound healing in diabetic mice, and immunohistochemical analysis revealed an increased number of new blood vessels following treatment.

Additionally, we investigated the potential molecular mechanisms by which CO2 laser-Exos promote angiogenesis in vitro. In the hyperglycemic microenvironment characteristic of diabetic chronic wounds, endothelial cells often exhibit dysfunction accompanied by impaired angiogenesis[50]. Substantial evidence indicates that hyperglycemia destabilizes HIF-1α at the wound site, thereby reducing the expression of its target genes (e.g., VEGF) and suppressing neovascularization[51]. Moreover, hyperglycemia disrupts key pro-angiogenic pathways, such as PI3K/AKT/endothelial nitric oxide synthase, typically manifesting as decreased AKT phosphorylation and compromised endothelial proliferation, migration, and tube formation[52]. In this study, CO2 laser-Exos significantly upregulated p-AKT, HIF-1α, and VEGF-A in HUVECs, restoring endothelial proliferation, migration, and tube formation under HG conditions. To elucidate upstream regulatory mechanisms, we focused on S1P, which was markedly elevated in CO2 laser-Exos compared to Exos. We concluded that the enhanced angiogenic capacity of CO2 laser-Exos is closely associated with their increased S1P content. Previous studies have demonstrated that the S1P/S1PR1 axis plays a pivotal role in maintaining the endothelial barrier and promoting angiogenesis[53]. Correspondingly, we observed a significant upregulation of S1PR1 expression in HUVECs under HG conditions. Using an shS1PR1 knockdown model in vitro, we found that silencing S1PR1 substantially attenuated the angiogenic effects of CO2 laser-Exos on HUVECs, accompanied by reduced expression of p-AKT, HIF-1α, and VEGF-A. These findings confirm that CO2 laser-Exos mediate angiogenesis by delivering S1P to endothelial cells, which binds to S1PR1 and activates the PI3K/AKT signaling pathway. Furthermore, through intervention with the AKT phosphorylation inhibitor LY294002 and the activator SC79, we demonstrated that HIF-1α functions as a downstream regulatory factor of the PI3K/AKT pathway. Collectively, these results indicate that S1P-enriched CO2 laser-Exos enhance the angiogenic capacity of HUVECs via the S1PR1/AKT/HIF-1α axis, a mechanism that is expected to synergistically improve endothelial protection and neovascularization in diabetic chronic wounds, thereby promoting wound repair.

Compared with other exosome-enhancement strategies, fractional CO2 laser preconditioning offers several notable advantages. While approaches such as hypoxia, pharmacological pretreatment, and genetic modification can enhance exosome activity and improve diabetic wound repair[54-56], they raise concerns regarding drug residues and vector safety. In contrast, fractional CO2 laser provides an adjustable, non-contact physical stimulus that activates MSC-derived Exos through controllable photothermal effects, without introducing exogenous substances, thereby offering a superior safety profile. Moreover, compared with other photothermal modalities, such as near-infrared lasers or photothermal nanoparticles, the fractional CO2 laser exploits the strong absorption of water at 10.6 μm to generate uniform and controllable local photothermal effects, enhancing the pro-angiogenic capacity of MSC-Exos without the need for exogenous carriers. This approach mitigates uncertainties related to material residues and improves translational feasibility. Although other physical stimuli - such as ultrasound, electromagnetic fields, and mechanical stress - have been reported to increase exosome yield and directional delivery[57-59], they generally lack the precision, parameter controllability, and translational potential offered by fractional CO2 lasers. Collectively, these features highlight the unique advantages of fractional CO2 laser preconditioning in enhancing exosome-mediated angiogenesis and promoting wound healing.

Finally, we acknowledge several limitations of this study. Ad-MSCs were obtained from only three non-obese adult donors, and the small sample size, combined with the absence of sex-stratified analyses, may introduce donor heterogeneity and sex-related bias. Although standardized cell isolation and culture procedures were employed, and multiple biological replicates were performed to minimize variability, inter-donor differences cannot be entirely eliminated. Future studies will include a larger number of donors and ensure balanced sex distribution to enhance the robustness and generalizability of the findings.

CONCLUSION

In summary, our study demonstrates that low-energy fractional CO2 laser enhances the biological activity of MSC-derived Exos through photothermal effects. CO2 laser-Exos promote endothelial cell angiogenesis by activating the S1PR1/AKT/HIF-1α pathway, thereby accelerating diabetic wound healing. These findings offer a novel therapeutic strategy for acellular treatment of diabetic wounds. Given the widespread clinical use of fractional CO2 lasers in skin repair, this approach is both feasible and possesses strong translational potential. Future studies should focus on establishing standardized laser operating protocols and quality-control metrics, as well as employing multi-omics and mass-spectrometry platforms to further elucidate the underlying mechanisms.

ACKNOWLEDGEMENTS

The authors thank the Central Laboratory of the Affiliated Hospital of Xuzhou Medical University for its support with the platform and instruments.

References
1.  Burgess JL, Wyant WA, Abdo Abujamra B, Kirsner RS, Jozic I. Diabetic Wound-Healing Science. Medicina (Kaunas). 2021;57:1072.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 660]  [Cited by in RCA: 555]  [Article Influence: 111.0]  [Reference Citation Analysis (5)]
2.  Dawi J, Tumanyan K, Tomas K, Misakyan Y, Gargaloyan A, Gonzalez E, Hammi M, Tomas S, Venketaraman V. Diabetic Foot Ulcers: Pathophysiology, Immune Dysregulation, and Emerging Therapeutic Strategies. Biomedicines. 2025;13:1076.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 101]  [Article Influence: 101.0]  [Reference Citation Analysis (0)]
3.  Chang M, Nguyen TT. Strategy for Treatment of Infected Diabetic Foot Ulcers. Acc Chem Res. 2021;54:1080-1093.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 629]  [Cited by in RCA: 486]  [Article Influence: 97.2]  [Reference Citation Analysis (4)]
4.  Zhao J, Yang S, Shu B, Chen L, Yang R, Xu Y, Xie J, Liu X, Qi S. Transient High Glucose Causes Persistent Vascular Dysfunction and Delayed Wound Healing by the DNMT1-Mediated Ang-1/NF-κB Pathway. J Invest Dermatol. 2021;141:1573-1584.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 55]  [Article Influence: 9.2]  [Reference Citation Analysis (3)]
5.  Elahi FM, Farwell DG, Nolta JA, Anderson JD. Preclinical translation of exosomes derived from mesenchymal stem/stromal cells. Stem Cells. 2020;38:15-21.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 139]  [Cited by in RCA: 180]  [Article Influence: 30.0]  [Reference Citation Analysis (5)]
6.  Riazifar M, Mohammadi MR, Pone EJ, Yeri A, Lässer C, Segaliny AI, McIntyre LL, Shelke GV, Hutchins E, Hamamoto A, Calle EN, Crescitelli R, Liao W, Pham V, Yin Y, Jayaraman J, Lakey JRT, Walsh CM, Van Keuren-Jensen K, Lotvall J, Zhao W. Stem Cell-Derived Exosomes as Nanotherapeutics for Autoimmune and Neurodegenerative Disorders. ACS Nano. 2019;13:6670-6688.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 485]  [Cited by in RCA: 463]  [Article Influence: 66.1]  [Reference Citation Analysis (1)]
7.  Lee YJ, Shin KJ, Chae YC. Regulation of cargo selection in exosome biogenesis and its biomedical applications in cancer. Exp Mol Med. 2024;56:877-889.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 298]  [Cited by in RCA: 286]  [Article Influence: 143.0]  [Reference Citation Analysis (1)]
8.  Chen YF, Luh F, Ho YS, Yen Y. Exosomes: a review of biologic function, diagnostic and targeted therapy applications, and clinical trials. J Biomed Sci. 2024;31:67.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 160]  [Reference Citation Analysis (0)]
9.  Zhou C, Zhang B, Yang Y, Jiang Q, Li T, Gong J, Tang H, Zhang Q. Stem cell-derived exosomes: emerging therapeutic opportunities for wound healing. Stem Cell Res Ther. 2023;14:107.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 277]  [Cited by in RCA: 254]  [Article Influence: 84.7]  [Reference Citation Analysis (4)]
10.  Tang T, Chen L, Zhang M, Wang C, Du X, Ye S, Li X, Chen H, Hu N. Exosomes derived from BMSCs enhance diabetic wound healing through circ-Snhg11 delivery. Diabetol Metab Syndr. 2024;16:37.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 25]  [Cited by in RCA: 24]  [Article Influence: 12.0]  [Reference Citation Analysis (0)]
11.  Hu Y, Tao R, Chen L, Xiong Y, Xue H, Hu L, Yan C, Xie X, Lin Z, Panayi AC, Mi B, Liu G. Exosomes derived from pioglitazone-pretreated MSCs accelerate diabetic wound healing through enhancing angiogenesis. J Nanobiotechnology. 2021;19:150.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 272]  [Cited by in RCA: 255]  [Article Influence: 51.0]  [Reference Citation Analysis (0)]
12.  Shorakaie A, Nahvifard E, Shirkavand A, Ataie Fashtami L, Mohajerani E. CO2 Fractional Laser Induced Skin Micro-Tunnel Thermal Damage Patterns: A Simulation Study. J Lasers Med Sci. 2024;15:e63.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 3]  [Reference Citation Analysis (0)]
13.  Guo H, Zhang X, Li H, Fu C, Jiang L, Hu Y, Huang J, Chen J, Zeng Q. Dynamic panoramic presentation of skin function after fractional CO(2) laser treatment. iScience. 2023;26:107559.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 14]  [Reference Citation Analysis (0)]
14.  Constantin A, Dumitrescu M, Mihai Corotchi MC, Jianu D, Simionescu M. CO(2) laser increases the regenerative capacity of human adipose-derived stem cells by a mechanism involving the redox state and enhanced secretion of pro-angiogenic molecules. Lasers Med Sci. 2017;32:117-127.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 18]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
15.  Chen T, Song P, He M, Rui S, Duan X, Ma Y, Armstrong DG, Deng W. Sphingosine-1-phosphate derived from PRP-Exos promotes angiogenesis in diabetic wound healing via the S1PR1/AKT/FN1 signalling pathway. Burns Trauma. 2023;11:tkad003.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 73]  [Cited by in RCA: 73]  [Article Influence: 24.3]  [Reference Citation Analysis (1)]
16.  Aoki M, Aoki H, Mukhopadhyay P, Tsuge T, Yamamoto H, Matsumoto NM, Toyohara E, Okubo Y, Ogawa R, Takabe K. Sphingosine-1-Phosphate Facilitates Skin Wound Healing by Increasing Angiogenesis and Inflammatory Cell Recruitment with Less Scar Formation. Int J Mol Sci. 2019;20:3381.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 23]  [Cited by in RCA: 45]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
17.  Cartier A, Leigh T, Liu CH, Hla T. Endothelial sphingosine 1-phosphate receptors promote vascular normalization and antitumor therapy. Proc Natl Acad Sci U S A. 2020;117:3157-3166.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 37]  [Cited by in RCA: 83]  [Article Influence: 13.8]  [Reference Citation Analysis (0)]
18.  Meacci E, Garcia-Gil M. S1P/S1P Receptor Signaling in Neuromuscolar Disorders. Int J Mol Sci. 2019;20:6364.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 12]  [Cited by in RCA: 19]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
19.  Wang X, Qiu Z, Dong W, Yang Z, Wang J, Xu H, Sun T, Huang Z, Jin J. S1PR1 induces metabolic reprogramming of ceramide in vascular endothelial cells, affecting hepatocellular carcinoma angiogenesis and progression. Cell Death Dis. 2022;13:768.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 23]  [Cited by in RCA: 36]  [Article Influence: 9.0]  [Reference Citation Analysis (1)]
20.  Liu X, Wu J, Zhu C, Liu J, Chen X, Zhuang T, Kuang Y, Wang Y, Hu H, Yu P, Fan H, Zhang Y, Liu Z, Zhang L. Endothelial S1pr1 regulates pressure overload-induced cardiac remodelling through AKT-eNOS pathway. J Cell Mol Med. 2020;24:2013-2026.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11]  [Cited by in RCA: 43]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
21.  Lin JX, Weng XF, Xie XS, Lian NZ, Qiu SL, Wang JB, Lu J, Chen QY, Cao LL, Lin M, Tu RH, Yang YH, Liu SJ, Hu M, Lin YK, Huang CM, Zheng CH, Li P, Xie JW. CDK5RAP3 inhibits angiogenesis in gastric neuroendocrine carcinoma by modulating AKT/HIF-1α/VEGFA signaling. Cancer Cell Int. 2019;19:282.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 14]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
22.  Athanasiadis A, Ambele MA, Pepper MS. Isolation of Adipose-Derived Mesenchymal Stromal/Stem Cells. Methods Mol Biol. 2025;2938:125-131.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
23.  Luo EF, Li HX, Qin YH, Qiao Y, Yan GL, Yao YY, Li LQ, Hou JT, Tang CC, Wang D. Role of ferroptosis in the process of diabetes-induced endothelial dysfunction. World J Diabetes. 2021;12:124-137.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 129]  [Cited by in RCA: 123]  [Article Influence: 24.6]  [Reference Citation Analysis (0)]
24.  Casado-Díaz A, Quesada-Gómez JM, Dorado G. Extracellular Vesicles Derived From Mesenchymal Stem Cells (MSC) in Regenerative Medicine: Applications in Skin Wound Healing. Front Bioeng Biotechnol. 2020;8:146.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 273]  [Cited by in RCA: 249]  [Article Influence: 41.5]  [Reference Citation Analysis (4)]
25.  Han X, Liao R, Li X, Zhang C, Huo S, Qin L, Xiong Y, He T, Xiao G, Zhang T. Mesenchymal stem cells in treating human diseases: molecular mechanisms and clinical studies. Signal Transduct Target Ther. 2025;10:262.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 107]  [Cited by in RCA: 153]  [Article Influence: 153.0]  [Reference Citation Analysis (4)]
26.  Liu W, Yu M, Xie D, Wang L, Ye C, Zhu Q, Liu F, Yang L. Melatonin-stimulated MSC-derived exosomes improve diabetic wound healing through regulating macrophage M1 and M2 polarization by targeting the PTEN/AKT pathway. Stem Cell Res Ther. 2020;11:259.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 432]  [Cited by in RCA: 403]  [Article Influence: 67.2]  [Reference Citation Analysis (6)]
27.  Mazini L, Rochette L, Admou B, Amal S, Malka G. Hopes and Limits of Adipose-Derived Stem Cells (ADSCs) and Mesenchymal Stem Cells (MSCs) in Wound Healing. Int J Mol Sci. 2020;21:1306.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 413]  [Cited by in RCA: 375]  [Article Influence: 62.5]  [Reference Citation Analysis (6)]
28.  Song Y, You Y, Xu X, Lu J, Huang X, Zhang J, Zhu L, Hu J, Wu X, Xu X, Tan W, Du Y. Adipose-Derived Mesenchymal Stem Cell-Derived Exosomes Biopotentiated Extracellular Matrix Hydrogels Accelerate Diabetic Wound Healing and Skin Regeneration. Adv Sci (Weinh). 2023;10:e2304023.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 187]  [Article Influence: 62.3]  [Reference Citation Analysis (0)]
29.  Bhat A, Malik A, Yadav P, Ware WJ, Kakalij P, Chand S. Mesenchymal stem cell‐derived extracellular vesicles: Recent therapeutics and targeted drug delivery advances. J Extracell Biol. 2024;3:e156.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 18]  [Reference Citation Analysis (0)]
30.  Kou M, Huang L, Yang J, Chiang Z, Chen S, Liu J, Guo L, Zhang X, Zhou X, Xu X, Yan X, Wang Y, Zhang J, Xu A, Tse HF, Lian Q. Mesenchymal stem cell-derived extracellular vesicles for immunomodulation and regeneration: a next generation therapeutic tool? Cell Death Dis. 2022;13:580.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 507]  [Cited by in RCA: 478]  [Article Influence: 119.5]  [Reference Citation Analysis (7)]
31.  Qiu X, Liu J, Zheng C, Su Y, Bao L, Zhu B, Liu S, Wang L, Wang X, Wang Y, Zhao W, Zhou J, Deng Z, Liu S, Jin Y. Exosomes released from educated mesenchymal stem cells accelerate cutaneous wound healing via promoting angiogenesis. Cell Prolif. 2020;53:e12830.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 35]  [Cited by in RCA: 131]  [Article Influence: 21.8]  [Reference Citation Analysis (0)]
32.  Hu P, Yang Q, Wang Q, Shi C, Wang D, Armato U, Prà ID, Chiarini A. Mesenchymal stromal cells-exosomes: a promising cell-free therapeutic tool for wound healing and cutaneous regeneration. Burns Trauma. 2019;7:38.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 131]  [Cited by in RCA: 121]  [Article Influence: 17.3]  [Reference Citation Analysis (5)]
33.  Baranovskii DS, Klabukov ID, Arguchinskaya NV, Yakimova AO, Kisel AA, Yatsenko EM, Ivanov SA, Shegay PV, Kaprin AD. Adverse events, side effects and complications in mesenchymal stromal cell-based therapies. Stem Cell Investig. 2022;9:7.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 126]  [Cited by in RCA: 111]  [Article Influence: 27.8]  [Reference Citation Analysis (0)]
34.  Yu M, Liu W, Li J, Lu J, Lu H, Jia W, Liu F. Exosomes derived from atorvastatin-pretreated MSC accelerate diabetic wound repair by enhancing angiogenesis via AKT/eNOS pathway. Stem Cell Res Ther. 2020;11:350.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 331]  [Cited by in RCA: 327]  [Article Influence: 54.5]  [Reference Citation Analysis (9)]
35.  Zhang DD, Zhao WY, Fang QQ, Wang ZC, Wang XF, Zhang MX, Hu YY, Zheng B, Tan WQ. The efficacy of fractional CO(2) laser in acne scar treatment: A meta-analysis. Dermatol Ther. 2021;34:e14539.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 35]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
36.  Du YM, Zeng J, Li M, Wang YB, Wu Y, Qi RQ, Gao XH, Chen HD. Efficacy and safety of Resveratrol combined with Ablative Fractional CO(2) laser system in the treatment of skin photoaging. J Cosmet Dermatol. 2021;20:3880-3888.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
37.  Xing DL, Zhu YQ, Sun W, Fang X, Zhuang ZW, Qiu L, Chen XL. Use of carbon dioxide fractional laser in the management of lower limb ischemia in patients with diabetes: a case report : CO(2) fractional laser in the treatment of diabetic foot. J Int Med Res. 2024;52:3000605241253759.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
38.  Monami M, Mirabella C, Scatena A, Nreu B, Zannoni S, Aleffi S, Giannoni L, Mannucci E. CO(2) laser for the treatment of diabetic foot ulcers with exposed bone. A consecutive series of type 2 diabetic patients. J Endocrinol Invest. 2017;40:819-822.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 8]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
39.  Guan H, Zhang D, Ma X, Lu Y, Dong J, Niu Y, Liu Y, Lu S, Xu J, Tang J. Efficacy and safety of CO(2) laser in the treatment of chronic wounds: A Retrospective Matched Cohort Trial. Lasers Surg Med. 2022;54:490-501.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 5]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
40.  Jiang B, Tang R, Zheng D, Yang Y, Li Y, Yang R, Liu L, Yan H. Evaluation of the Efficacy of Ultrapulsed CO(2) Laser in Chronic Wounds. Lasers Surg Med. 2021;53:443-449.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 5]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
41.  Monami M, Ragghianti B, Silverii A, Scatena A, Landi L, Cosentino C, Vitale V, Mannucci E. Retrospective Matched Case-Control Study on the Use of CO(2) Laser for the Treatment of Nonhealing Diabetic Foot Ulcers: The DULCIS-2 (Diabetic ULcer, CO(2) Laser, and Infections) Study. Int J Low Extrem Wounds. 2022;21:471-476.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 3]  [Reference Citation Analysis (0)]
42.  Qin S, Xu C, Li S, Wang X, Sun X, Wang P, Zhang B, Ren H. Hyperthermia induces apoptosis by targeting Survivin in esophageal cancer. Oncol Rep. 2015;34:2656-2664.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 19]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
43.  Li L, Tan H, Gu Z, Liu Z, Geng Y, Liu Y, Tong H, Tang Y, Qiu J, Su L. Heat stress induces apoptosis through a Ca²⁺-mediated mitochondrial apoptotic pathway in human umbilical vein endothelial cells. PLoS One. 2014;9:e111083.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 49]  [Cited by in RCA: 85]  [Article Influence: 7.1]  [Reference Citation Analysis (0)]
44.  Zou B, Zheng W, Pan H, Yang B, Liu Z. Research trends and hotspot analysis of fractional carbon dioxide laser: A bibliometric and visualized analysis via Citespace. J Cosmet Dermatol. 2022;21:5484-5499.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
45.  Chiosis G, Digwal CS, Trepel JB, Neckers L. Structural and functional complexity of HSP90 in cellular homeostasis and disease. Nat Rev Mol Cell Biol. 2023;24:797-815.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 122]  [Cited by in RCA: 152]  [Article Influence: 50.7]  [Reference Citation Analysis (0)]
46.  Morán Luengo T, Mayer MP, Rüdiger SGD. The Hsp70-Hsp90 Chaperone Cascade in Protein Folding. Trends Cell Biol. 2019;29:164-177.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 108]  [Cited by in RCA: 209]  [Article Influence: 26.1]  [Reference Citation Analysis (0)]
47.  Schmitt L, Huth S, Amann PM, Marquardt Y, Heise R, Fietkau K, Huth L, Steiner T, Hölzle F, Baron JM. Direct biological effects of fractional ultrapulsed CO(2) laser irradiation on keratinocytes and fibroblasts in human organotypic full-thickness 3D skin models. Lasers Med Sci. 2018;33:765-772.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 35]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
48.  Bhatia A, O'Brien K, Guo J, Lincoln V, Kajiwara C, Chen M, Woodley DT, Udono H, Li W. Extracellular and Non-Chaperone Function of Heat Shock Protein-90α Is Required for Skin Wound Healing. J Invest Dermatol. 2018;138:423-433.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 31]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
49.  Tang X, Chang C, Guo J, Lincoln V, Liang C, Chen M, Woodley DT, Li W. Tumour-Secreted Hsp90α on External Surface of Exosomes Mediates Tumour - Stromal Cell Communication via Autocrine and Paracrine Mechanisms. Sci Rep. 2019;9:15108.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 67]  [Cited by in RCA: 61]  [Article Influence: 8.7]  [Reference Citation Analysis (2)]
50.  Yang DR, Wang MY, Zhang CL, Wang Y. Endothelial dysfunction in vascular complications of diabetes: a comprehensive review of mechanisms and implications. Front Endocrinol (Lausanne). 2024;15:1359255.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 215]  [Cited by in RCA: 191]  [Article Influence: 95.5]  [Reference Citation Analysis (1)]
51.  Li G, Ko CN, Li D, Yang C, Wang W, Yang GJ, Di Primo C, Wong VKW, Xiang Y, Lin L, Ma DL, Leung CH. A small molecule HIF-1α stabilizer that accelerates diabetic wound healing. Nat Commun. 2021;12:3363.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 79]  [Cited by in RCA: 181]  [Article Influence: 36.2]  [Reference Citation Analysis (0)]
52.  An Y, Xu BT, Wan SR, Ma XM, Long Y, Xu Y, Jiang ZZ. The role of oxidative stress in diabetes mellitus-induced vascular endothelial dysfunction. Cardiovasc Diabetol. 2023;22:237.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 299]  [Cited by in RCA: 276]  [Article Influence: 92.0]  [Reference Citation Analysis (0)]
53.  Wang B, Dong N, Wu D, Fang Y, Chen J, Lin Y, Bellusci S, Zhang JS, Dai K, Chen C. Sphingosine 1-phosphate receptor 1 governs endothelial barrier function and angiogenesis by upregulating endoglin signaling. Ann Transl Med. 2022;10:136.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 15]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
54.  Wang J, Wu H, Peng Y, Zhao Y, Qin Y, Zhang Y, Xiao Z. Hypoxia adipose stem cell-derived exosomes promote high-quality healing of diabetic wound involves activation of PI3K/Akt pathways. J Nanobiotechnology. 2021;19:202.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 234]  [Cited by in RCA: 239]  [Article Influence: 47.8]  [Reference Citation Analysis (6)]
55.  Wang H, Bai Z, Qiu Y, Kou J, Zhu Y, Tan Q, Chen C, Mo R. Empagliflozin-Pretreated MSC-Derived Exosomes Enhance Angiogenesis and Wound Healing via PTEN/AKT/VEGF Pathway. Int J Nanomedicine. 2025;20:5119-5136.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 16]  [Reference Citation Analysis (0)]
56.  Ge L, Wang K, Lin H, Tao E, Xia W, Wang F, Mao C, Feng Y. Engineered exosomes derived from miR-132-overexpresssing adipose stem cells promoted diabetic wound healing and skin reconstruction. Front Bioeng Biotechnol. 2023;11:1129538.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 64]  [Reference Citation Analysis (1)]
57.  Jiang R, Wang H, Zhong F, Hu Y, Liu J, Chen Y, Su W, Cao S, Deng Q, Zhou Q. Low-intensity pulsed ultrasound as a strategy to boost exosome secretion by adipose-derived stem cells and uptake for myocardial infarction therapy. Biomed Mater. 2025;20.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 2]  [Reference Citation Analysis (0)]
58.  Villa C, Secchi V, Macchi M, Tripodi L, Trombetta E, Zambroni D, Padelli F, Mauri M, Molinaro M, Oddone R, Farini A, De Palma A, Varela Pinzon L, Santarelli F, Simonutti R, Mauri P, Porretti L, Campione M, Aquino D, Monguzzi A, Torrente Y. Magnetic-field-driven targeting of exosomes modulates immune and metabolic changes in dystrophic muscle. Nat Nanotechnol. 2024;19:1532-1543.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 40]  [Reference Citation Analysis (0)]
59.  Thompson W, Papoutsakis ET. The role of biomechanical stress in extracellular vesicle formation, composition and activity. Biotechnol Adv. 2023;66:108158.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 62]  [Reference Citation Analysis (1)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Endocrinology and metabolism

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade A, Grade B, Grade B, Grade B, Grade B

Novelty: Grade B, Grade B, Grade B, Grade B, Grade B

Creativity or Innovation: Grade A, Grade B, Grade B, Grade B, Grade B

Scientific Significance: Grade A, Grade B, Grade B, Grade B, Grade B

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Wu CW, MD, PhD, Assistant Professor, Taiwan; Zhang WY, MD, PhD, Assistant Professor, China; Zhou H, Professor, China S-Editor: Bai Y L-Editor: A P-Editor: Yu HG

Write to the Help Desk