BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Gastroenterol. Oct 14, 2026; 32(38): 118814
Published online Oct 14, 2026. doi: 10.3748/wjg.118814
Specificity protein 1/ZIP8/zinc axis reduced macrophage extracellular traps to alleviate severe acute pancreatitis in mice
Yi-Miao Cheng, Zu-Xing Wei, Xiao-Yan Qi, Jun He, Xu-Yang Hou, Department of General Surgery, The Second Xiangya Hospital, Central South University, Changsha 410011, Hunan Province, China
Qiong Liu, Department of Stomatology, The Second Xiangya Hospital, Central South University, Changsha 410011, Hunan Province, China
Xu-Yang Hou, Department of Cardiovascular Surgery, The Second Xiangya Hospital, Central South University, Changsha 410011, Hunan Province, China
ORCID number: Jun He (0000-0001-5309-0765); Xu-Yang Hou (0009-0001-1085-681X).
Author contributions: Hou XY designed the study, developed the methodology, and provided critical revisions; Cheng YM conducted the experiments, collected the data, performed statistical analyses, and drafted the initial manuscript; Liu Q, Wei ZX, Qi XY, and He J contributed to assisting with the experiments and interpreting the results.
Supported by the Natural Science Foundation of Hunan Province, No. 2023JJ40821; Natural Science Foundation of Changsha City, No. kq2208308; and Hunan Provincial Health Commission Health Research Project, No. W20243029.
Institutional review board statement: This study did not involve human participants, human tissues, or identifiable human data.
Institutional animal care and use committee statement: This study followed standard ethical guidelines for animal research and received approval from the Institutional Animal Care and Use Committee at the Second Xiangya Hospital of Central South University (approval No. 20223872).
Conflict-of-interest statement: The authors declare that they have no conflict of interest.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: The data are available from the corresponding author for legitimate inquiries.
Corresponding author: Xu-Yang Hou, MD, Doctor, Department of Cardiovascular Surgery, The Second Xiangya Hospital, Central South University, No. 139 Renmin Road, Changsha 410011, Hunan Province, China. houxuyang@csu.edu.cn
Received: January 12, 2026
Revised: March 9, 2026
Accepted: April 3, 2026
Published online: October 14, 2026
Processing time: 238 Days and 16.2 Hours

Abstract
BACKGROUND

Severe acute pancreatitis (SAP) is characterized by inflammatory injury and organ dysfunction, yet the contribution of macrophage extracellular traps (METs) to SAP pathogenesis is not fully understood.

AIM

To clarify METs involvement in the pathogenesis of SAP, as well as to investigate and evaluate the potential therapeutic effects of factors regulating MET formation in mitigating disease severity.

METHODS

In this study, SAP was induced in mice via duct ligation and caerulein injection, and MET formation was evaluated by measuring double-stranded DNA and citrullinated histone H3 expression. Interventions involving with deoxyribonuclease I (DNase I), a peptidylarginine deiminase 4 (PAD4) inhibitor, N-acetylcysteine, zinc supplementation, and ZIP8 overexpression were used to assess the effects of these treatments on METs and disease severity.

RESULTS

MET formation, which is dependent on the PAD4 and reactive oxygen species pathways, was significantly increased in SAP mice, mainly in M1 macrophages. Zinc supplementation and ZIP8 overexpression suppressed MET formation, restored zinc homeostasis, and reduced pancreatic and pulmonary injury, whereas DNase I exacerbated intestinal barrier dysfunction.

CONCLUSION

These findings indicate that targeting METs through zinc supplementation or ZIP8 could be a promising strategy for SAP treatment, underscoring the importance of zinc homeostasis in inflammatory disorders.

Key Words: Macrophage extracellular traps; Severe acute pancreatitis; Specificity protein 1; ZIP8; Zinc

Core Tip: This study reveals that severe acute pancreatitis triggers macrophage extracellular trap (MET) formation in M1 macrophages through peptidylarginine deiminase 4 and reactive oxygen species pathways, linked to zinc deficiency and ZIP expression downregulation. Zinc supplementation and ZIP8 overexpression mitigate MET formation and organ injury. Additionally, specificity protein 1’s role in regulating ZIP8 expression is highlighted, with its downregulation exacerbating zinc deficiency and MET formation, offering novel insights into therapeutic strategies.



INTRODUCTION

Severe acute pancreatitis (SAP) is a critical subtype of acute pancreatitis (AP), characterized by extensive pancreatic tissue damage and a systemic inflammatory response that frequently leads to multiple organ dysfunction and high mortality[1,2]. Although clinical management has improved[3], the underlying immunopathological mechanisms remain incompletely understood, thereby constraining the development of effective therapeutic strategies.

As integral cells of the human immune system, macrophages play a vital role in the progression of AP[4]. In concert with neutrophils and other immune cells, macrophages orchestrate and intensify the inflammatory cascade during SAP progression, influencing the degree of pancreatitis[5]. Extracellular traps (ETs), which were first identified in neutrophils, contribute to host defense by trapping and killing bacteria, but their formation can also trigger immune activation and inflammation, potentially causing organ damage under certain conditions[6]. Macrophage ETs (METs), which are similar to neutrophil ETs (NETs), are DNA-based structures supplemented with cytotoxic enzymes and inflammatory mediators[7]. These traps can exacerbate both local and systemic tissue damage, and have emerged as a novel mechanism through which macrophages promote tissue injury and inflammation[8]. Recent studies have demonstrated that METs play an active role in the development of several diseases, including ulcerative colitis[9], acute kidney injury[10], and type 1 diabetes[11]. NETs can promote trypsin activation, trigger inflammatory responses, and cause tissue damage in mice with SAP[12]. However, the involvement of METs in SAP and their underlying mechanisms have yet to be confirmed. In particular, the upstream molecular mechanisms regulating MET formation and their functional contribution to SAP pathogenesis remain poorly understood. Identifying the key regulatory pathways controlling MET release may therefore provide important insights into the immunopathology of SAP.

Zinc is an essential trace element with strong anti-inflammatory and antioxidant properties[13]. Zinc homeostasis is crucial for the proper function of the immune system, particularly in maintaining macrophage function[14]. Specifically, zinc deficiency impairs macrophage differentiation and phagocytic function, leading to a significant increase in the oxidative burst of these cells[15]. Additionally, zinc plays a vital role in macrophage signaling and inflammatory responses, including pathways such as mitogen-activated protein kinase, protein kinase C, and nuclear factor kappa-B[15-17]. As an active metal ion, zinc plays an important role in the pathogenesis of AP. In experimental AP models, serum zinc levels are significantly reduced, whereas zinc supplementation can alleviate intestinal microbiota alterations and barrier damage in SAP[18], and regulate oxidative stress levels[19]. In light of these findings, the specific mechanisms underlying the interaction between zinc and macrophages during the course of SAP remain largely unknown and warrant further investigation. Moreover, zinc levels are closely associated with the formation of NETs[20], and zinc signaling is an essential component of the reactive oxygen species (ROS)-dependent signal transduction pathways that lead to NETosis[21]. Supplementation with extracellular zinc reduces the release of NETs, whereas low zinc levels lead to increased NETs release and enhanced neutrophil degranulation[22]. Currently, no studies have investigated the effect of zinc on METs in SAP, and the molecular mechanisms linking zinc homeostasis to MET formation remain unclear. In particular, whether zinc transporters and their transcriptional regulators participate in the control of MET release during SAP has not been explored.

In this study, we utilized duct ligation and caerulein-induced SAP mouse models to systematically investigate the presence and regulation of METs in SAP. Our findings suggest the existence of a putative transcriptional regulatory axis involving the transcription factor specificity protein 1 (Sp1) and the zinc transporter ZIP8 (SLC39A8), which may modulate intracellular zinc homeostasis, thereby influencing MET formation during SAP. These results expand the current understanding of ET biology beyond neutrophils and provide new insights into zinc-associated immunoregulation in SAP.

MATERIALS AND METHODS
Animal models

C57BL/6J mice were obtained from Vital River Laboratory Animal Technology (Beijing, China). Animal experiments were performed under specific pathogen-free conditions. This study followed standard ethical guidelines for animal research and received approval from the Institutional Animal Care and Use Committee at the Second Xiangya Hospital of Central South University (approval No. 20223872). Every effort was made to minimize animal suffering. Mice in the peptidylarginine deiminase 4 (PAD4) inhibition group received intraperitoneal injections of BB-Cl-amidine (BB-Cl) at a dose of 20 mg/kg daily for three consecutive days, followed by every other day until day 11, after which SAP was induced (as detailed below) and samples were collected. Control mice received an equal volume of saline. In the caerulein-induced SAP mouse model, the mice were fasted for 12 hours prior to experimentation. On the day of induction, caerulein (50 μg/kg) was administered intraperitoneally at hourly intervals for a total of 12 doses. Samples were collected 24 hours after the initial injection. In the ligation-induced SAP mouse model, mice were fasted for 12 hours prior to surgery. Anesthesia was induced via intraperitoneal injection of 1% pentobarbital sodium solution (Sinopharm Chemical Reagent, China) at a dose of 50 μL per 10 g body weight, after which the mice were immobilized on a surgical platform. The abdominal surgical area was shaved and disinfected. A midline incision was created from the xiphoid process to the umbilicus using a sterile scalpel. The underlying linea alba and peritoneum were dissected to expose the upper abdominal cavity. Sterile 0.9% sodium chloride solution was periodically applied throughout the procedure to prevent visceral desiccation. Using sterile forceps or cotton swabs, the stomach was gently retracted into the abdomen to expose the caudal region of the splenic lobe and pancreas. The main pancreatic duct was subsequently located at the pancreatic neck. A fine flat-tip needle was used to puncture the antimesenteric side of the main duct, followed by injection of methylene blue to visualize the ductal system. The duodenal branch of the pancreatic duct was ligated with 6-0 sutures. Organs were repositioned within the abdominal cavity, and the incision was closed with sutures. A heating pad was used to facilitate postoperative recovery. On the third day following ligation, caerulein (50 μg/kg) was administered twice at 1-hour intervals. Samples were collected 24 hours after the final injection.

Hematoxylin and eosin

Lung and pancreatic tissues harvested from mice were immediately fixed in 4% paraformaldehyde solution. After fixation, the tissues were dehydrated, embedded in paraffin, and sectioned at a thickness of 4 μm. The sections were subsequently stained with hematoxylin and eosin following standard protocols.

Plasma amylase and lipase assay

Blood samples were collected from murine hearts to the maximum feasible volume and temporarily stored in preprepared centrifuge tubes containing 20 μL of 0.5 M ethylene diamine tetraacetic acid (EDTA). The samples were then centrifuged at 1000 × g for 15 minutes to obtain plasma. After centrifugation, the plasma samples were systematically labeled and analyzed using an automated biochemistry Cobas c501 analyzer (Roche, Switzerland) with appropriate reagent kits. Plasma amylase and lipase concentrations were measured using enzymatic kinetic methods. All procedures were performed in strict accordance with the manufacturer’s instructions.

Flow cytometric analysis of neutrophils in plasma

Mice were anesthetized with isoflurane (R510-22-10, RWD, China) delivered via a vaporizer. Anesthesia was induced at 3% isoflurane and maintained at 2% throughout the procedure. Once deep anesthesia was confirmed, the mice were placed in the supine position. After thoracic disinfection with 75% ethanol, a sterile syringe was inserted at a 15-30° angle at the left costal arch, inferior to the xiphoid process, following palpation of maximal cardiac pulsation. The needle was withdrawn following blood collection, and the mice were euthanized by cervical dislocation under sustained deep anesthesia. Blood samples were filtered through a 70 μm strainer into a 50 mL tube, rinsed with phosphate-buffered saline (PBS), and centrifuged at 1600 rpm for 1 minute. The resulting pellet was resuspended in red blood cell lysis buffer for 1 minute at room temperature, washed with PBS, and finally resuspended in 1 mL of PBS. A discontinuous Percoll gradient was prepared according to the manufacturer’s instructions. The cell suspension was layered onto the gradient and centrifuged at 1600 rpm for 30 minutes at 25 °C. The neutrophil-enriched intermediate fraction was collected, washed twice with PBS, and resuspended in RPMI-1640 medium. The cells were stained with anti-Ly6G (560601, BD, United States) and anti-cluster of differentiation (CD) 11b (550993, BD, United States) antibodies, and subsequently analyzed by flow cytometry.

Immunohistochemical staining

Pancreatic paraffin sections were incubated at 60 °C for 45 minutes and subsequently deparaffinized in xylene using a sequential protocol: Xylene (10 minutes, twice), absolute ethanol (3 minutes, twice), 95% ethanol (3 minutes), and 75% ethanol (3 minutes). Following deparaffinization, the sections were rinsed under running water and subjected to antigen retrieval in preheated tris-EDTA buffer (potential of hydrogen = 9.0) for 20 minutes at a temperature maintained above 95 °C. The sections were then allowed to cool naturally in the retrieval solution and rinsed again under running water. Immunohistochemical staining was performed with a mouse and rabbit specific horseradish peroxidase (HRP)/diaminobenzidine (DAB) detection immunohistochemical kit (ab36466, Abcam, United Kingdom) according to the manufacturer’s instructions. Briefly, endogenous peroxidase activity was blocked using hydrogen peroxide for 10 minutes. After two thorough washes with PBS, the sections were incubated with primary antibody against cleaved caspase 3 (abs132005, Absin, China) overnight at 4 °C. The following day, biotinylated goat anti-polyvalent antibody and streptavidin peroxidase were applied sequentially for 10 minutes each at room temperature, with thorough PBS washes between steps. DAB chromogen was applied for 1-5 minutes to develop the signal, followed by a 10-minute wash under running water. Counterstaining was performed with hematoxylin for 10 minutes, followed by a 10-minute wash under running water. The sections were subsequently dehydrated through a reverse gradient of ethanol concentrations (75%, 95%, absolute ethanol, and xylene) by immersion for 1-2 minutes in each solution, and finally mounted with neutral resin. Images were captured using a Zeiss microscope.

Peritoneal macrophage collection and western blot

To elicit a substantial number of macrophages, mice were intraperitoneally injected with 3% Brewer’s thioglycollate broth three days prior to the experiment. Subsequently, the mice were anesthetized with isoflurane and euthanized by cervical dislocation. After securing the mouse on a dissection board, pre-chilled sterile PBS was injected into the peritoneal cavity. The abdomen was gently massaged to dislodge cells into the lavage fluid. The lavage fluid was then aspirated, and peritoneal macrophages were pelleted by centrifugation. For total protein extraction, the collected cells were lysed on ice using radio immunoprecipitation assay lysis buffer (89901, Thermo Fisher, United States) for 30 minutes. The lysate was centrifuged at 12000 g for 15 minutes at 4 °C, and the supernatant was collected. Protein concentration was determined using the bicinchoninic acid method and normalized with lysis buffer and 4 × sample loading buffer (R095296, RHAWN, China). Prior to loading, samples were denatured in boiling water for 10 minutes. Electrophoresis was performed initially at a constant voltage of 60 V in the stacking gel, and then increased to 120 V in the separating gel until the target protein migrated to the desired position. Proteins were transferred onto a polyvinylidene difluoride (1620177, bio-rad, United States) in a transfer tank at a constant voltage of 66 V for 180 minutes. Following transfer, the membrane was blocked with 5% non-fat dry milk for 1 hour at room temperature. The membrane was then incubated overnight with primary antibodies against ZIP8 (A10395, Abclonal, China) and β-actin (AC038, Abclonal, China) on a shaker at 4 °C. After washing with tris buffered saline with Tween (TBST), the membrane was incubated with HRP-conjugated secondary antibody (AS014, Abclonal, China) for 90 minutes at room temperature, followed by extensive washing with TBST. Finally, the immunocomplexes were detected using chemiluminescent substrate (34580, Thermo Fisher, United States) and visualized.

Quantitative real-time polymerase chain reaction

Total RNA was extracted from PBS-washed cells using TRIzol reagent (15596018, Thermo Fisher, United States), followed by chloroform extraction and isopropanol precipitation. The resulting RNA pellet was subsequently washed with 75% ethanol, air-dried, and dissolved in diethylpyrocarbonate-treated water (R0022, Beyotime, China). RNA concentration and purity were assessed using a NanoDrop2000 spectrophotometer (Thermo Fisher). Complementary DNA (cDNA) was synthesized from the extracted RNA using a High-Capacity cDNA Reverse Transcription Kit (K1622, Thermo, United States) in a 20 μL reaction volume, following the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (q-PCR) was conducted using a commercial qPCR mix (RK21203, ABclonal, China) on a LightCycler 96 system (Roche) with gene-specific primers to quantify gene expression levels on the basis of cycle threshold (Ct) values. The primers used were listed in Table 1.

Table 1 Lists of primers.
Gene symbol
Primer direction
Primer sequence (5’-3’)
Amplicon size (bp)
Source/reference
Pad4ForwardACGCTGCCTGTGGTCTTTGACT110Origene
ReverseACCTCCAGGTTCCCAAAGGCAT
Nox2ForwardTGGCGATCTCAGCAAAAGGTGG140Origene
ReverseGTACTGTCCCACCTCCATCTTG
Tlr2ForwardACAGCAAGGTCTTCCTGGTTCC124Origene
ReverseGCTCCCTTACAGGCTGAGTTCT
Mtf1ForwardGGCTGTGAGAAGGCGTTCAACA130Origene
ReverseATGTGCTTCCGCAGGTCACTGA
Nrf2ForwardCAGCATAGAGCAGGACATGGAG109Origene
ReverseGAACAGCGGTAGTATCAGCCAG
Hif1αForwardCCTGCACTGAATCAAGAGGTTGC130Origene
ReverseCCATCAGAAGGACTTGCTGGCT
Sp1ForwardCTCCAGACCATTAACCTCAGTGC120Origene
ReverseCACCACCAGATCCATGAAGACC
ZIP8ForwardCACTGAGCCTAACGGACACATC135Origene
ReverseCACAAAGCGTGATCATCCAGGC
β-actinForwardGAGGTATCCTGACCCTGAAGTA150Origene
ReverseCACACGCAGCTCATTGTAGA
Measurement of intestinal permeability using fluorescein isothiocyanate-dextran

The body weights of the mice in both the control and experimental groups were precisely measured using an analytical balance. Following an 8-hour fast with ad libitum access to water, the mice were administered 4 kDa fluorescein isothiocyanate (FITC)-dextran (0.6 mg/kg) by oral gavage and subsequently fasted for an additional 4 hours. The mice were subsequently anesthetized with isoflurane, and blood was collected via cardiac puncture into EDTA-coated tubes. Blood samples were centrifuged at 2000 × g for 10 minutes at room temperature. The resulting plasma was carefully aspirated and diluted with PBS. Diluted plasma samples and FITC-dextran standards were aliquoted into a black 96-well plate. The fluorescence was measured using a microplate reader with excitation and emission wavelengths set at 490 nm and 520 nm, respectively. The concentration of FITC-dextran in the plasma samples was calculated by interpolation from the standard curve.

Quantification of double-stranded DNA using PicoGreen assay

Plasma and cell culture supernatant samples were collected from experimental and control group mice, respectively, clarified by centrifugation, and stored at -80 °C until analysis. According to the manufacturer’s protocol, both the PicoGreen double-stranded DNA (dsDNA) reagent and the Lambda DNA standard were diluted. The diluted Lambda DNA standard was subsequently used to prepare a standard curve with a concentration gradient ranging from 0 ng/mL to 100 ng/mL. An aliquot of each sample supernatant was mixed with an equal volume of PicoGreen working solution in a black 96-well plate. After a 10-minute incubation at room temperature protected from light, the fluorescence was measured using a microplate reader (excitation: 480 nm, emission: 520 nm). The dsDNA concentration in each sample was quantified by interpolation from the standard curve.

Immunofluorescence staining of pancreatics and cultured cells

For pancreatic immunofluorescence staining, the initial deparaffinization steps were performed in accordance with the immunohistochemical protocol up to the postantigen retrieval stage. After the sections were allowed to cool naturally in the retrieval solution and rinsed under running water, they were incubated with a blocking solution prepared from bovine and donkey serum at room temperature for at least 30 minutes. The sections were subsequently incubated overnight at 4 °C with the following primary antibodies: Anti-F4/80 (123140, BioLegend, United States) and anti-citrullinated histone H3 (CitH3) (ab281584, Abcam, United Kingdom). On the following day, species-specific secondary antibodies were applied, and the samples were incubated at room temperature for at least 60 minutes. Finally, the sections were mounted with anti-fade mounting medium containing 4’,6-diamidino-2-phenylindole (DAPI). Fluorescence images were acquired using a Zeiss microscope. For immunofluorescence staining of cultured cells, the cells were cultured in Dulbecco’s modified eagle medium (DMEM). When the cells reached the logarithmic growth phase, they were trypsinized, counted, and seeded onto coverslips in 12-well plates. After cell adhesion occurred, the cells were fixed with 4% paraformaldehyde for 10 minutes and then were washed twice with PBS. When needed, permeabilization was performed using 0.5% TritonX-100. The cells were subsequently blocked with an animal serum-based blocking solution at room temperature for at least 30 minutes, followed by overnight incubation at 4 °C with the following primary antibodies: Anti-F4/80 (123140, BioLegend, United States), anti-citrullinated histone H3 (ab281584, Abcam, United Kingdom), and anti-ZIP8 (A10395, ABclonal, China). The subsequent steps on the following day were identical to those described for tissue immunofluorescence staining. Fluorescence images were captured using a Zeiss microscope.

Intracellular zinc levels were measured

After differentiation and maturation, bone marrow-derived macrophages (BMDMs) were subjected to 24 hours of treatment. Zinc sulfate (Z2876, Sigma, Germany) was added at a concentration of 5 μM 2 hours prior to phorbol 12-myristate 13-acetate (PMA) stimulation as a pretreatment. The cells were treated with PMA (S7791, Selleck, United States) and acinar cell supernatant. The cells were then incubated with a 1X Zinquin ethyl ester (MX4516, Maokang, China) staining solution, which was prepared by diluting the stock solution 1:1000 in culture medium, for 30 minutes at 37 °C. After three washes with PBS, the cells were fixed with 4% paraformaldehyde for 10 minutes. The fixed samples were air-dried, mounted with anti-fade medium containing DAPI, and imaged using either an Olympus fluorescence microscope or a Leica confocal microscope for subsequent data analysis.

RNA-sequencing

Total RNA was extracted from cells following previously established protocols. RNA concentration and purity were assessed using an Agilent 2100 Bioanalyzer. cDNA fragments were purified using the AMPure XP system (Beckman Coulter, Beverly, United States), and first- and second-strand cDNA synthesis was performed using M-MuLV Reverse Transcriptase and Phusion High-Fidelity DNA Polymerase I, respectively. The sequencing libraries were generated and sequenced using the Illumina NovaSeq 6000 platform. After the reads containing impurities were filtered out, the clean reads were mapped to the reference genome. FeatureCounts was used to quantify the reads mapped to each gene, and fragments per kilobase of transcript per million mapped reads values were calculated to measure the gene expression levels. Differentially expressed genes were identified using DESeq2. Genes with an adjusted P value less than 0.05 were considered significantly different.

Macrophage transfection with lentivirus

The murine macrophage line RAW264.7 was utilized for lentiviral transduction. Cells in the logarithmic growth phase were seeded into 24-well plates at a density designed to reach approximately 70% confluence at the time of transduction. Cells were cultured in complete growth medium consisting of DMEM (C3110-0500, Gibco, United States) supplemented with 10% fetal bovine serum (FBS) (C04001-500, Vivacell, China) and 1% penicillin/streptomycin (15140-122, Gibco, United States). On the day of transduction, the medium was replaced with fresh complete medium. Lentiviral particles were thawed on ice, and the appropriate volume of viral supernatant, determined on the basis of a predetermined optimal multiplicity of infection of 50 and the cell number, was added directly to the cultures. The plates were gently swirled to ensure an even distribution and incubated at 37 °C with 5% carbon dioxide. After 24 hours, the viral supernatant was aspirated and replaced with fresh complete medium. To select for transduced cells, puromycin (ant-pr-1, InvivoGen, United States) was added to the culture medium at a final concentration of 2 μg/mL at 48 hours post-transduction. The selection medium was changed every 2-3 days. The transduction efficiency was assessed 5-7 days after selection by either observing green fluorescent protein expression under a fluorescence microscope or by quantifying the messenger RNA (mRNA) and protein levels of the target gene using q-PCR and western blot analysis, respectively.

2’,7’-dichlorodihydrofluorescein diacetate assay to detect intracellular ROS

Intracellular ROS levels were quantified using the fluorescent probe 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA) (D6883, MedChemExpress, United States). Cells in the logarithmic growth phase were seeded into 96-well plates at a density of 1 × 104 cells per well. After the designated treatments, the culture medium was aspirated and the cells were gently washed twice with PBS. The cells were subsequently incubated with 100 μL of 10 μM DCFH-DA working solution, prepared in serum-free medium, for 30 minutes at 37 °C in the dark. Following incubation, the cells were washed three times with PBS to thoroughly remove any residual extracellular probe. Afterward, 100 μL of fresh serum-free medium was added to each well, and the fluorescence intensity was immediately measured using a SpectraMax i3x microplate reader (Molecular Devices, United States), with excitation and emission wavelengths set at 488 nm and 525 nm, respectively. Relative fluorescence units were normalized to the total protein content in each well, as determined by a bicinchoninic acid protein assay, and are expressed as a percentage of the control group.

METs-induced by BMDMs

C57BL/6J mice were euthanized via carbon dioxide asphyxiation. Following hair removal and skin disinfection, the abdominal cavity was accessed through layered dissection. The pancreas was isolated, excised, and transferred into prechilled sterile centrifuge tubes. The femur and tibia were separated, and the surrounding muscle tissue was carefully removed using sterile surgical scissors. The bones were immediately placed in ice-cold PBS. To extract BMDMs, the knee joint was dissected to expose the marrow cavity. Bone marrow cells were flushed out using a sterile syringe prefilled with PBS, and the cell aggregates were gently dispersed by pipetting. The cell suspension was filtered through a 40-μm cell strainer into a 50-mL centrifuge tube and then centrifuged at 800 rpm for 5 minutes at 4 °C. After being washed with PBS, the cells were resuspended in complete DMEM supplemented with 10% FBS (C04001-500, Vivacell, China), 1% penicillin streptomycin (Gibco, 15140-122, United States), and 20 ng/mL macrophage-colony stimulating factor (250-03-100UG, Proteintech, United States) and then seeded into culture plates. The cells were cultured in a humidified incubator at 37 °C with 5% carbon dioxide for approximately 7 days to facilitate differentiation into macrophages. After differentiation, the cells were incubated for an additional 3 days with either 5 μM BB-Cl (25378, Cayman Chemical, United States) or 5 mmol/L N-acetylcysteine (HY-B0215, MedChemExpress, United States). Control cultures received an equivalent volume of dimethyl sulfoxide. For primary acinar cell isolation, the harvested pancreatic tissue was minced into 2-mm3 fragments using sterile scissors. The tissue fragments were digested in 1 mL of mouse pancreas dissociation solution (abs50096-10T, Absin, China) at 37 °C with shaking at 180 rpm for 15 minutes. Digestion was terminated, and the homogenate was filtered through a 70-μm cell strainer. The filtrate was collected in a 50-mL tube and centrifuged at 400 × g for 3 minutes. After three washes with PBS, the acinar cell pellet was resuspended in Waymouth’s medium (11220035, Gibco, United States) supplemented with 2.5% FBS, 1% penicillin streptomycin (15140-122, Gibco, United States), 0.25 mg/mL trypsin inhibitor (T8031, Solarbio, China), and 25 ng/mL recombinant human epidermal growth factor (HY-P7067, MedChemExpress, United States) for subsequent culture. Following macrophage differentiation, acinar cells were pretreated with 100 nM caerulein (S9690, Selleck, Japan) for 1 hour and then cocultured with macrophages in a Transwell system separated by a sterile nylon membrane for 6 hours. The cells were subsequently stimulated with 100 nM PMA (S7791, Selleck, United States) for 12 hours to induce MET formation.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 8. The data are expressed as the means ± SEs. Group differences were assessed using unpaired Student’s t test for normally distributed data, or nonparametric alternatives otherwise. Multiple group comparisons were conducted by one-way analysis of variance, followed by Tukey’s honestly significant difference post hoc test if assumptions of normality and homoscedasticity were met or by Dunnett’s T3 test if violated. Statistical significance was defined as P < 0.05.

RESULTS
METs are present in both ligation- and caerulein-induced SAP models

Multiple types of immune cells are capable of generating ETs, mainly NETs and METs, which are mesh-like structures consisting of DNA, histones, antimicrobial peptides, and proteases, and exhibit many similarities, including major components such as CitH3, myeloperoxidase, and elastase[9,23]. To determine the distribution of ETs in the pancreas during SAP, we first established two commonly used SAP models: Duct ligation-induced and caerulein-induced models. The successful establishment of both models was confirmed by pancreatic histopathology, elevated plasma lipase and amylase levels, and lung tissue injury (Figure 1A and B). Immunofluorescence was subsequently employed to detect CitH3, a key protein involved in chromatin decondensation and DNA release, in the pancreatic tissues of SAP model mice. Pronounced CitH3 expression was observed in mice with SAP, indicating the presence of ETs in these mice (Figure 1C). Further analysis of plasma dsDNA levels also revealed a marked increase in dsDNA in both SAP mouse models (Figure 1D). To assess MET presence in SAP, mice were depleted of neutrophils using anti-Ly6G antibody prior to SAP induction. Flow cytometry confirmed near-complete elimination of peripheral blood neutrophils (Figure 1E) and markedly reduced neutrophil infiltration in pancreatic tissues (Figure 1F). However, plasma analysis revealed a significant increase in dsDNA levels, suggesting that, in addition to NETs, other cell-derived ETs may also be involved in the SAP process (Figure 1G). During the progression of SAP, the number of macrophages increases in a manner dependent on the disease severity[5], leading us to initially hypothesize that METs may also be present in SAP. Immunofluorescence analysis of CitH3 expression in pancreatic tissues from SAP model mice revealed that, even after pretreatment with the anti-Ly6G antibody, high levels of CitH3 persisted in both the duct ligation-induced and caerulein-induced models (Figure 1H). These findings further demonstrate that, during the course of SAP, other types of ETs are present in addition to NETs. Since macrophages, in addition to neutrophils, are the principal proinflammatory cells infiltrating the pancreas, immunofluorescence staining was used to analyze both CitH3 expression and the distribution of the macrophage marker F4/80. The results revealed that ETs were present around F4/80-positive cells (Figure 1H). These results indicate that METs are present in experimental mouse models of SAP. Given the well-established pathogenic role of NETs in SAP, the presence of METs suggests that macrophage-derived ETs may represent an additional source of inflammatory mediators that contribute to pancreatic injury and systemic inflammation during SAP progression.

Figure 1
Figure 1 Macrophage extracellular traps are present in severe acute pancreatitis. A: Hematoxylin-eosin staining revealed pathological changes in the pancreatic and lung tissues in acute pancreatitis models induced by caerulein, and in severe acute pancreatitis (SAP) models induced by either caerulein or duct ligation; B: Levels of plasma amylase and lipase (n = 4); C: Immunofluorescence staining revealed the protein expression levels of citrullinated histone H3 (CitH3) (red fluorescence) and F4/80 (green fluorescence) in SAP; D: Levels of double-stranded DNA (dsDNA) in plasma (n = 4); E and F: Neutrophils were depleted from mice using an anti-Ly6G antibody, followed by induction of the SAP model. Cluster of differentiation (CD) 11b and Ly6G antibodies were subsequently used for staining, and flow cytometry was performed to determine the purity of CD11b and Ly6G in blood and pancreatic tissues; G: Levels of dsDNA in plasma (n = 5); H: After pretreatment with an anti-Ly6G antibody, the expression of F4/80 and CitH3 in pancreatic tissue was assessed by immunofluorescence. aP < 0.05. bP < 0.01. cP < 0.001. NS: Not significant; Nc: Negative control; AP: Acute pancreatitis; SAP: Severe acute pancreatitis; CitH3: Citrullinated histone H3; DAPI: 4’,6-diamidino-2-phenylindole; dsDNA: Double-stranded DNA.
Elimination of METs by deoxyribonuclease I significantly reduces the severity of SAP

To clarify the potential role of METs in the progression of SAP, C57BL/6J mice were pretreated with anti-Ly6G antibody prior to SAP induction and deoxyribonuclease I (DNase I) administration (Figure 2A). DNase I was found to attenuate SAP in caerulein-induced models, as evidenced by significantly reduced pancreatic injury, alleviated lung injury, and decreased plasma amylase and lipase activities (Figure 2B-D), suggesting that inhibiting METs decreases SAP severity. Further analysis revealed that DNase I reduced the degree of acinar cell death and decreased the expression of the apoptosis marker cleaved caspase 3 (Figure 2E and F), indicating that MET inhibition can alleviate acinar cell damage.

Figure 2
Figure 2 Degradation of macrophage extracellular traps alleviates the severity of severe acute pancreatitis. A: Experimental flowchart: C57 mice were pretreated with anti-Ly6G antibody, followed by induction of severe acute pancreatitis and treatment with DNase I; B: Representative hematoxylin-eosin-stained images of pancreatic and lung tissues; C and D: Expression levels of amylase and lipase in plasma (n = 7); E and F: Representative immunohistochemical images of cleaved caspase 3 (brown granules) in pancreatic tissue, accompanied by statistical analysis (n = 7); G: Expression level of 16S rDNA in plasma (n = 4); H: Plasma fluorescein isothiocyanate (FITC) signal in each group of mice following oral gavage with FITC-dextran (n = 4). aP < 0.05. bP < 0.01. cP < 0.001. NS: Not significant; Ctrl: Control; DNase I: Deoxyribonuclease I; Casp: Caspase; IHC: Immunohistochemical; 16S rDNA: 16S ribosomal DNA; FITC: Fluorescein isothiocyanate.

On the other hand, DNase I treatment led to more pronounced small intestinal distension, which is consistent with previous findings[24]. This effect is likely due to the disruption of ETs, which may impair the capacity of neutrophils and macrophages to prevent the dissemination of symbiotic bacteria or to eliminate invading pathogens during episodes of intestinal barrier dysfunction or gastrointestinal infection[24]. Given that bacteremia arising from intestinal barrier dysfunction is pivotal in SAP progression[25], we monitored changes in intestinal barrier integrity in SAP model mice with or without DNase I treatment. DNase I alone significantly increased plasma 16S rDNA expression (Figure 2G). After gavage of FITC-dextran, treatment with DNase I alone led to an increase in the plasma FITC signal (Figure 2H). These findings suggest that although DNase I can alleviate SAP by inhibiting METs, its potential side effects limit its therapeutic utility.

MET formation induced by acinar cells and PMA relies on the PAD4 pathway and ROS activation; M1 macrophages show a heightened capacity for MET production

To elucidate the mechanism underlying MET formation in SAP, we first cocultured primary macrophages with damaged acinar cells and PMA and subsequently assessed dsDNA levels (Figure 3A and B). Our results showed that stimulation with both damaged acinar cells and PMA markedly induced MET formation (Figure 3B). PAD4, an enzyme that converts arginine into citrulline and mediates histone citrullination, plays a pivotal role in NET formation[26]. Previous studies have suggested that PAD4 may also be necessary for MET formation[27]. To investigate whether PAD4 is required for MET induction by acinar cells and PMA, we inhibited PAD4 activity in vitro using BB-Cl, which resulted in suppressed MET formation (Figure 3C and D). In vivo experiments further confirmed that BB-Cl could inhibit METs, as reflected by decreased dsDNA concentrations (Figure 3E). BB-Cl alleviated the severity of SAP, as demonstrated by reduced pathological damage to pancreatic and lung tissues and decreased plasma amylase and lipase activities (Figure 3F-H).

Figure 3
Figure 3 Macrophage extracellular trap formation depends on the peptidylarginine deiminase 4 pathway and reactive oxygen species, and M1 macrophages exhibit a strong ability to form macrophage extracellular traps. A and B: Primary macrophages were cocultured with phorbol 12-myristate 13-acetate and pancreatic acinar cells (following injury induced by caerulein), and the expression levels of double-stranded DNA (dsDNA) were subsequently measured in each group (n = 3); C and D: Representative immunofluorescence images of citrullinated histone H3 (CitH3) and F4/80 in macrophages from each group (C), as well as statistical analysis of the positivity rate of CitH3 (D), a macrophage extracellular trap marker (n = 5); E-H: After the administration of the peptidylarginine deiminase 4 inhibitor and anti-Ly6G, either alone or in combination, in the severe acute pancreatitis model, the levels of dsDNA in mouse plasma were measured (E), hematoxylin-eosin staining of pancreatic and lung tissues was performed (F), and the activities of amylase and lipase in plasma were determined (G and H) (n = 7); I and J: Representative immunofluorescence images of CitH3 and F4/80 in macrophages from each group, along with statistical analysis of CitH3 (n = 4). aP < 0.05. bP < 0.01. cP < 0.001. NS: Not significant; MET: Macrophage extracellular trap; PMA: Phorbol 12-myristate 13-acetate; BMDMs: Bone marrow-derived macrophages; Nc: Negative control; dsDNA: Double-stranded DNA; CitH3: Citrullinated histone H3; Cl-amidine: BB-Cl-amidine; Ctrl: Control; DAPI: 4’,6-diamidino-2-phenylindole; NAC: N-Acetylcysteine; MFI: Mean fluorescence intensity.

Additionally, the formation of METs may depend on ROS. To clarify whether ROS are essential for the induction of MET formation by acinar cells and PMA, we used N-acetylcysteine to scavenge intracellular ROS and found that N-acetylcysteine reduced both the dsDNA concentration and extracellular CitH3 staining in macrophages (Figure 3I). These findings indicate that both PAD4 and ROS are necessary for the induction of MET formation by acinar cells and PMA. Furthermore, we evaluated the differences in MET formation among M0, M1, and M2 macrophages and observed that compared with M2 and M0 macrophages, M1 macrophages exhibited a significantly greater capacity to form METs (Figure 3J). Collectively, these results demonstrate that M1 macrophages are the predominant subtype responsible for MET formation. This observation is consistent with the pro-inflammatory phenotype of M1 macrophages, which are characterized by elevated ROS production and enhanced antimicrobial activity, both of which are known to facilitate ET formation.

Extracellular zinc effectively inhibits the formation of METs

As previously mentioned, zinc is vital for macrophage functions such as phagocytosis, bactericidal activity, antigen presentation, and the regulation of inflammation, all of which require precise regulation of zinc ions. Furthermore, zinc supplementation has been shown to inhibit the formation of NETs. To investigate whether zinc is a key trace element in the regulation of MET formation, we supplemented primary macrophages with zinc and found that zinc supplementation significantly inhibited the formation of METs induced by acinar cells and PMA, as evidenced by decreased extracellular CitH3 expression and reduced dsDNA levels in the cell supernatant (Figure 4A-C). Using a zinc ion probe, we found that the intracellular zinc content decreased after macrophages were cocultured with damaged pancreatic acinar cells in the presence of PMA (Figure 4D). Further analysis revealed that serum zinc levels were significantly lower in the SAP mice than in the negative control and AP mice (Figure 4E), suggesting that zinc deficiency may contribute to increased MET formation in SAP mice. To verify the inhibitory potential of zinc on METs and its therapeutic effect on SAP in vivo, we administered two concentrations of zinc to mice after Ly6G antibody treatment, followed by caerulein-induced SAP modeling. The doses (60 μg/kg and 30 μg/kg) were based on studies demonstrating the regulatory effects of zinc on neutrophil functions[28,29]. The control group received an equal volume of saline. Both the high-zinc group and the low-zinc group (injected daily for three consecutive days) showed reduced pathological damage to the pancreas and lungs, along with decreased plasma lipase and amylase levels, indicating that zinc is a promising trace element for inhibiting SAP progression and is potentially linked to macrophage function (Figure 4F-H). We subsequently assessed CitH3 levels in the pancreas and found that zinc reduced both pancreatic CitH3 levels and plasma dsDNA concentrations in SAP mice (Figure 4I and J). Collectively, these results suggest that zinc supplementation may suppress MET formation in SAP. Considering that ROS plays a critical role in MET induction, the inhibitory effect of zinc on MET formation may be mediated through its antioxidant properties and its ability to modulate intracellular ROS levels.

Figure 4
Figure 4 Zinc supplementation can inhibit the formation of macrophage extracellular traps. A and B: Representative immunofluorescence images of citrullinated histone H3 (CitH3) (red) and F4/80 (green) in macrophages, along with statistical analysis of the relative expression levels of CitH3 (n = 4); C: Double-stranded DNA (dsDNA) levels in the cell supernatant (n = 4); D: Macrophages were cocultured with pancreatic acinar cells treated with caerulein in the presence of phorbol 12-myristate 13-acetate. The intracellular zinc levels in the macrophages were measured using a zinc ion probe and statistically analyzed (n = 4); E: Zinc concentration in serum (n = 4); F-J: After supplementing severe acute pancreatitis model mice were supplemented with different concentrations of zinc, pathological changes in pancreatic and lung tissues were assessed by hematoxylin-eosin staining (F), plasma levels of amylase and lipase were measured (G and H), immunofluorescence staining for CitH3 and F4/80 in pancreatic tissue was performed (I), and the concentration of dsDNA in plasma was determined (J) (n = 8). aP < 0.05. bP < 0.01. cP < 0.001. NS: Not significant; PMA: Phorbol 12-myristate 13-acetate; Nc: Negative control; CitH3: Citrullinated histone H3; DAPI: 4’,6-diamidino-2-phenylindole; dsDNA: Double-stranded DNA; AP: Acute pancreatitis; SAP: Severe acute pancreatitis; MFI: Mean fluorescence intensity.
Low Sp1 expression disrupts the zinc-ZIP8 negative feedback mechanism, resulting in persistently low zinc levels and inducing MET formation

Zinc ion concentration, distribution, and homeostasis are governed mainly by two major transporter families: SLC30 (zinc transporter) for zinc export and SLC39 (Zrt- and Irt-like protein) for zinc import, while the storage of this essential element is mediated primarily by metallothionein[30]. We performed transcriptome sequencing on macrophages treated with acinar cells and PMA, as well as control macrophages, and identified zinc-regulating genes. Among these genes, ZIP8 was the most significantly downregulated (Figure 5A). Furthermore, q-PCR and immunofluorescence assays confirmed that both ZIP8 mRNA and protein levels were markedly reduced in the experimental group (Figure 5B and C). We then investigated whether overexpressing ZIP8 could increase intracellular zinc levels in macrophages. Following adenoviral overexpression of ZIP8, we assessed intracellular zinc levels using a fluorescent zinc probe (Figure 5D and E). ZIP8 overexpression increased zinc levels in the intervention group to levels comparable to those in the control group, suggesting that reduced ZIP8 protein levels are a major cause of decreased zinc content in macrophages (Figure 5D and E). Importantly, ZIP8 overexpression also reduced MET formation (Figure 5F).

Figure 5
Figure 5 Reduced ZIP8 expression in macrophages reduces zinc levels and is linked to enhanced macrophage extracellular trap formation; zinc supplementation can lower reactive oxygen species levels and suppress macrophage extracellular trap formation. A: A transcriptomic analysis was conducted to identify differentially expressed genes in the macrophages of the macrophage extracellular trap (MET)-induced group and negative control groups; B: The expression level of ZIP8 messenger RNA (mRNA) in bone marrow-derived macrophages (BMDMs) was measured using quantitative real-time polymerase chain reaction (q-PCR) (n = 3); C: Representative immunofluorescence images showing ZIP8 expression in BMDMs; D: After ZIP8 was overexpressed, ZIP8 mRNA expression in BMDMs was measured using q-PCR (n = 3); E: Zinc levels in BMDMs were assessed using a fluorescent zinc probe (n = 4); F: Representative fluorescence images of citrullinated histone H3 (CitH3) and F4/80 in macrophages, together with quantitative analysis of CitH3 fluorescence intensity (n = 4); G: Changes in the mRNA expression levels of peptidylarginine deiminase 4, nicotinamide adenine dinucleotide phosphate hydrogen oxidase 2, and toll-like receptor 2 in macrophages within the MET induction system, with or without ZIP8 overexpression, were measured by q-PCR (n = 4); H: Intracellular reactive oxygen species levels were measured using a 2’,7’-dichlorodihydrofluorescein diacetate fluorescent probe assay (n = 4). aP < 0.05. bP < 0.01. cP < 0.001. NS: Not significant; PMA: Phorbol 12-myristate 13-acetate; Nc: Negative control; CitH3: Citrullinated histone H3; BMDMs: Bone marrow-derived macrophages; DAPI: 4’,6-diamidino-2-phenylindole; mRNA: Messenger RNA; Oe: Overexpression; MFI: Mean fluorescence intensity; PAD4: Peptidylarginine deiminase 4; TLR2: Toll-like receptor 2; NOX2: Nicotinamide adenine dinucleotide phosphate hydrogen oxidase 2; ROS: Reactive oxygen species; DCFH-DA: 2’,7’-dichlorodihydrofluorescein diacetate.

What is the primary mechanism underlying the inhibition of MET formation by zinc? Previous studies have shown that PAD4[26], nicotinamide adenine dinucleotide phosphate hydrogen oxidase (NOX) 2[31], and toll-like receptor (TLR) 2[32] play different roles in mediating NET formation. To determine whether these genes are involved in the inhibition of MET formation by zinc, we analyzed their expression levels in macrophage METs after zinc supplementation and found that zinc supplementation did not reduce the expression of PAD4, NOX2, or TLR2 (Figure 5G). However, ROS probe assays revealed that zinc supplementation reduced the increase in intracellular ROS induced by pancreatic acinar cells plus PMA, suggesting that zinc inhibition of METs may be related to ROS levels (Figure 5H).

The zinc-ZIP8 negative feedback axis helps maintain intracellular zinc homeostasis. Given that ZIP8 expression was markedly reduced after treatment with pancreatic acinar cells plus PMA, important mechanisms remain to be clarified. Previous studies have indicated that metal-regulatory transcription factor-1[33], nuclear factor erythroid 2-related factor 2[34], and ETs[35] are key upstream molecules positively regulate ZIP8, but in macrophages treated with acinar cells and PMA, all three genes were significantly upregulated (Supplementary Figure 1A), which does not explain the decrease in ZIP8 expression. Sp1 is an important member of the Sp/Krüppel-like factor transcription factor family and plays a crucial role in macrophage polarization and inflammatory phenotypes[36,37]. In addition to zinc, ZIP8 is known to transport cadmium and manganese, and studies have confirmed that Sp1 regulates the role of ZIP8 in cadmium homeostasis[38]. Therefore, we examined the effect of pancreatic acinar cells plus PMA treatment on Sp1 expression and found that, similar to that of ZIP8, Sp1 expression was also significantly suppressed (Supplementary Figure 1A). JASPAR analysis revealed multiple high-affinity binding sites for Sp1 within the ZIP8 promoter region (Supplementary Figure 1B). Inhibiting Sp1 function with mithramycin A led to a significant reduction in ZIP8 expression in macrophages, suggesting that Sp1 may act as a potential transcriptional regulator of ZIP8 expression (Supplementary Figure 1C). Furthermore, Sp1 overexpression inhibited MET formation (Supplementary Figure 1D-F). Since Sp1 is a transcription factor with broad regulatory functions in various cell types, therapeutic research targeting Sp1 in SAP has not progressed, but ZIP8-targeted therapy may represent a promising approach for SAP treatment.

Overexpression of ZIP8 via adeno-associated virus serotype 6 alleviates the severity of SAP by reducing METs

The application of the adeno-associated virus (AAV) system for the treatment of various inflammatory diseases has garnered increasing attention. Our data demonstrate that the Sp1/ZIP8/zinc axis is a key regulatory pathway for METs, and that targeting ZIP8 or supplementation with zinc may represent potential therapeutic strategies for SAP. To this end, we used the AAV serotype 6 (AAV6) system to overexpress ZIP8. The AAV6 serotype has strong potential for macrophage targeting, and when combined with the CD68 promoter, it is theoretically capable of specifically regulating target gene expression in macrophages. Accordingly, we administered AAV6 via intravenous injection and, after two weeks, induced SAP following anti-Ly6G antibody treatment (Figure 6A). It was demonstrated by Western blot and q-PCR that AAV6 significantly increased the expression of ZIP8 at both the protein and mRNA levels in peritoneal macrophages (Figure 6B and C). Initial ZIP8 staining revealed that AAV6 promoted ZIP8 expression in pancreatic macrophages (Figure 6D). Hematoxylin-eosin staining indicated that pancreatic tissue injury was reduced in the AAV6-ZIP8 group, characterized by decreased necrosis and reduced inflammatory cell infiltration (Figure 6E). Pulmonary inflammatory cell infiltration and pathological damage were similarly reduced (Figure 6F). The plasma amylase and lipase levels also decreased (Figure 6G and H). There was a reduction in plasma dsDNA (Figure 6I) and CitH3 levels in the pancreas (Figure 6J). Collectively, these results suggest that AAV6-mediated ZIP8 overexpression alleviates the severity of SAP by reducing METs.

Figure 6
Figure 6 The overexpression of ZIP8 mitigates the severity of severe acute pancreatitis by decreasing macrophage extracellular trap formation. A: Schematic diagram of the experimental procedure; B: Western blot analysis of ZIP8 protein expression levels in peritoneal macrophages (n = 4); C: Quantitative real-time polymerase chain reaction analysis of ZIP8 messenger RNA expression levels in peritoneal macrophages (n = 7); D: Representative immunofluorescence images showing ZIP8 (green) and cluster of differentiation 68 (red) expression; E and F: Hematoxylin-eosin staining demonstrating the pathological effects of ZIP8 overexpression on pancreatic and lung tissues; G and H: Plasma levels of amylase and lipase (n = 7); I: Plasma levels of double-stranded DNA (n = 7); J: Representative fluorescence images of citrullinated histone H3 (CitH3) and F4/80 in the pancreas, together with quantitative analysis of CitH3 fluorescence intensity (n = 7). aP < 0.05. bP < 0.01. cP < 0.001. AAV: Adeno-associated virus; Ctrl: Control; DAPI: 4’,6-diamidino-2-phenylindole; mRNA: Messenger RNA; CD: Cluster of differentiation; CitH3: Citrullinated histone H3; dsDNA: Double-stranded DNA; MFI: Mean fluorescence intensity.
DISCUSSION

In this study, we systematically investigated the role of METs in the pathogenesis of SAP. Our results reveal several key findings. First, METs are abundantly formed in experimental SAP models even after neutrophil depletion, indicating that macrophages represent an additional cellular source of ETs in SAP. Second, MET formation is dependent on PAD4 activity and ROS generation and occurs predominantly in pro-inflammatory M1 macrophages. Third, zinc supplementation significantly suppresses MET formation both in vitro and in vivo, likely through the modulation of intracellular ROS levels. Finally, our data suggest the existence of a putative Sp1-ZIP8-zinc regulatory axis that influences zinc homeostasis and MET formation during SAP. Together, these findings provide new insights into the role of macrophage-derived ETs in SAP pathogenesis.

Our data indicate that appropriate inhibition of METs can confer therapeutic benefits in mice with SAP; however, indiscriminate elimination of ETs does not represent the most effective therapeutic approach. Structurally, METs closely resemble NETs, comprising histones, double-stranded DNA, elastase, and myeloperoxidase[8]. Histones or granular proteins in ETs act as toxic cargos that can induce apoptosis and lysis, thereby promoting cell death, tissue damage, and inflammation; moreover, proteases within ETs regulate inflammatory responses by proteolytically degrading or activating captured cytokines and chemokines[39]. In essence, ETs are capable of causing tissue damage. In our study, we observed that METs formed in SAP model mice and that removal of METs via DNase I alleviated pancreatic and lung tissue injury as well as acinar cell death. These observations align with previous reports indicating that METs exacerbate tissue injury in inflammatory diseases, such as atherosclerosis, acute kidney injury, and hepatic ischemia/reperfusion injury[40]. Similarly, during the early phase of AP, activated neutrophils release granular proteins, which can trigger pancreatic inflammation and damage, and even provoke systemic inflammatory responses[41]. However, further investigation revealed that DNase I treatment aggravated intestinal barrier dysfunction, leading to increased bacteremia and elevated plasma FITC-dextran levels, suggesting that nonselective ET clearance may impair host defense. The release of cellular contents from immune cells such as neutrophils, macrophages, and mast cells results in the formation of ET networks in the extracellular milieu, which can capture and eliminate pathogens and play an indispensable role in innate immunity[8,42]. Studies have shown that inhibiting NET formation during severe murine sepsis reduces bacterial capture and increases bacterial dissemination to remote organs[43]; in a cecal ligation and puncture model, NET depletion by recombinant human DNase administration increased susceptibility to polymicrobial sepsis, neutrophil infiltration, and tissue injury in the lungs and liver[44]. In mouse models of experimental necrotizing enterocolitis, NET formation limited bacterial translocation, while reduced NETs were associated with increased systemic bacterial proliferation, increased mortality, and increased bacteremia[45]. Thus, ETs are crucial for protecting against intestinal lesions associated with bacterial infections[24]. Patients with SAP complications demonstrate increased intestinal permeability, which is correlated with sepsis and organ failure[46]. On the basis of our data, we propose that METs in the gut during SAP may act in a similar manner: METs induced during AP may be beneficial for preventing bacteremia as the disease progresses to gastrointestinal infection. For instance, in sepsis, NETs exert key bactericidal and anti-infective effects in the early stages but become detrimental later[47]. SAP is initiated by sterile inflammation of pancreatic tissue, and as the inflammatory cascade becomes activated, it can result in systemic inflammatory response syndrome as well as multiple organ dysfunctions, including diffuse alveolar damage, bacteremia, and intestinal barrier failure[1,48]. Therefore, we believe that investigating the specific effects of METs on different organs and systems at various stages of SAP progression is important for future research. Furthermore, DNase I is capable of degrading all the ETs supported by DNA scaffolds. In addition to macrophages and neutrophils, direct application of DNase I also impaired the ability of other innate immune cells capable of forming ETs such as eosinophils and monocytes to capture and eliminate pathogens. Therefore, DNase I is not an ideal or specific reagent for evaluating the functions of METs or NETs, particularly in diseases characterized by intestinal barrier dysfunction and increased susceptibility to bacteremia, highlighting the necessity for the development of targeted inhibitory agents.

In our experimental model, zinc emerged as a key regulatory factor in the formation of METs. We found that zinc supplementation significantly inhibited MET formation both in vitro and in vivo, reduced levels of dsDNA and CitH3, and alleviated pancreatic and pulmonary injury. Zinc deficiency is associated with cellular changes in AP and may contribute to pancreatic injury[49]. In SAP rat models, serum zinc levels were significantly reduced, and zinc supplementation alleviated intestinal permeability and endotoxemia, improving disease outcomes[18]. Moreover, zinc supplementation restored free radical-scavenging enzyme activity, reduced free radical levels, and inhibited oxidative stress damage in SAP rats[19]. These results support the hypothesis that zinc acts as a negative regulator of METs by modulating ROS levels. We subsequently investigated the mechanisms through which ZIP8, a zinc transporter protein, is regulated in SAP and identified Sp1 as a putative transcription factor. Sp1 is involved in various biological processes, including inflammation in the innate immune system, macrophage polarization, and apoptosis[50,51]. Using the JASPAR database, we analyzed the potential binding sites between Sp1 and ZIP8 and confirmed with mithramycin A inhibition that Sp1 is a positive regulator of ZIP8 expression; moreover, Sp1 overexpression suppressed MET formation. Similar to our findings, in their study on the role of glutathione in cadmium toxicity, Aiba et al[38] revealed that low-dose cadmium exposure downregulates ZIP8 and Sp1 expression, with Sp1 being a transcriptional regulator of ZIP8. These observations collectively suggest that disruption of zinc transporter regulation may represent an important mechanism linking zinc homeostasis to macrophage inflammatory responses and ET formation.

Dysregulation of the Sp1-ZIP8 axis may serve as a critical observational indicator for the progression of SAP. Although our study has confirmed that low Sp1 expression leads to impaired ZIP8-mediated zinc influx, the pathophysiological significance underlying this phenomenon warrants further analysis. Previous literature indicates that mitochondrial ROS impairs Sp1 activity by oxidizing the cysteine residues within its zinc finger motifs, thereby abolishing its DNA-binding capacity and suppressing downstream gene expression[52]. Mitochondrial dysfunction is widely recognized as an early triggering event in the pathogenesis of AP. Persistent ROS accumulation and elevated membrane permeability resulting from mitochondrial dysfunction trigger a vicious inflammatory cascade, thereby exacerbating the course of SAP[53-55]. In conjunction with our findings, this implies that the ROS accumulation resulting from mitochondrial dysfunction at the very initiation of SAP might inhibit Sp1, thereby disrupting the ZIP8 pathway essential for zinc uptake in macrophages. Such a localized state of “intracellular zinc depletion” not only compromises antioxidant defense mechanisms but also amplifies ROS generation by disinhibiting NOX. Consequently, the breakdown of the Sp1-ZIP8 axis might signify a pivotal signaling pathway marking the progression of SAP from localized inflammation to systemic inflammatory response syndrome.

Targeting the upstream pathways regulating METs generation offers advantages over simply eliminating downstream METs. While DNase I is capable of degrading pre-formed METs and mitigating SAP partially, its overall effects are not comprehensive. Therefore, from the perspective of translational medicine, intervening in the “upstream” mechanisms of METs formation may yield greater therapeutic benefits. Our data indicate that the formation of METs in SAP relies on the activation of the PAD4/ROS signaling axis, and intracellular zinc levels directly modulate PAD4 activity. Crucially, PAD4-mediated CitH3 serves not only as a prerequisite for chromatin decondensation but also as an initiating factor triggering autoantigen exposure and immunothrombosis[56]. Therefore, relying solely on enzymatic degradation therapy may have limitations. Conversely, inhibiting ROS-dependent PAD4 activation by restoring ZIP8 expression or supplementing with zinc effectively blocks the initiation of the “nuclear breakdown” program at its source. This is highly consistent with the findings of Cheng et al[22], who concluded that zinc supplementation suppresses NETs by inhibiting PAD4 expression, further confirming that zinc acts not only as a metabolic cofactor but also as a “sentinel” of nuclear integrity. Thus, in our study, the gene therapy based on AAV6-ZIP8 significantly alleviated the severity of SAP, with its core advantage being its ability to simultaneously inhibit the formation of METs and the release of associated cytotoxic proteins, providing a more comprehensive protection than simple nucleases.

CONCLUSION

Our study confirmed that in duct ligation-induced and caerulein-induced SAP models, METs are active contributors to tissue injury and disease progression, providing new insights into the regulatory mechanisms of ETs in SAP and suggesting that zinc supplementation and ZIP8 enhancement are feasible strategies for limiting disease progression. Further research is needed to explore the clinical applicability of these interventions and to further elucidate the molecular networks that regulate METs in pancreatitis and other inflammatory diseases.

ACKNOWLEDGMENTS

The authors thank Engineer Sun Y for his helpful methodological guidance in this project.

References
1.  Mederos MA, Reber HA, Girgis MD. Acute Pancreatitis: A Review. JAMA. 2021;325:382-390.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 822]  [Cited by in RCA: 735]  [Article Influence: 147.0]  [Reference Citation Analysis (1)]
2.  Lee PJ, Papachristou GI, Speake C, Lacy-Hulbert A. Immune markers of severe acute pancreatitis. Curr Opin Gastroenterol. 2024;40:389-395.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 19]  [Cited by in RCA: 23]  [Article Influence: 11.5]  [Reference Citation Analysis (0)]
3.  Hamesch K, Hollenbach M, Guilabert L, Lahmer T, Koch A. Practical management of severe acute pancreatitis. Eur J Intern Med. 2025;133:1-13.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 28]  [Article Influence: 28.0]  [Reference Citation Analysis (0)]
4.  Chen H, Wang Y, Zippi M, Fiorino S, Hong W. Oxidative stress, DAMPs, and immune cells in acute pancreatitis: molecular mechanisms and therapeutic prospects. Front Immunol. 2025;16:1608618.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 19]  [Reference Citation Analysis (4)]
5.  Hu F, Lou N, Jiao J, Guo F, Xiang H, Shang D. Macrophages in pancreatitis: Mechanisms and therapeutic potential. Biomed Pharmacother. 2020;131:110693.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 131]  [Cited by in RCA: 134]  [Article Influence: 22.3]  [Reference Citation Analysis (0)]
6.  Herre M, Cedervall J, Mackman N, Olsson AK. Neutrophil extracellular traps in the pathology of cancer and other inflammatory diseases. Physiol Rev. 2023;103:277-312.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 172]  [Cited by in RCA: 188]  [Article Influence: 62.7]  [Reference Citation Analysis (0)]
7.  Shin Y, Bae H, Lee C, Rhee I. The dynamic roles of macrophages extracellular traps (METs) in immune regulation. Arch Pharm Res. 2025;48:293-304.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 14]  [Reference Citation Analysis (0)]
8.  Weng W, Hu Z, Pan Y. Macrophage Extracellular Traps: Current Opinions and the State of Research regarding Various Diseases. J Immunol Res. 2022;2022:7050807.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 42]  [Article Influence: 10.5]  [Reference Citation Analysis (0)]
9.  Zhou Z, Miao X, Shen Y, Wang P, Shi R, Fan H, Yang Y, Guo M, Wu J. Macrophage extracellular traps impair intestinal barrier function in DSS-induced colitis in mice by inducing intestinal epithelial cell apoptosis. Biochem Pharmacol. 2025;242:117406.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 5]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
10.  Ye X, Dong Y, Han J, Huang Y, Wen M, Zheng R, Wang P, Chen R, Zhao L. Repurposing zafirlukast confers renal protection in ischemia-reperfusion injury via suppressing macrophage METosis. Int Immunopharmacol. 2025;165:115459.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 5]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
11.  Shen Y, Shi R, Lu S, Wang Y, Zhou Z, Wu C, You Q, Fan H, Wu J. Role of Peptidyl Arginine Deiminase 4-Dependent Macrophage Extracellular Trap Formation in Type 1 Diabetes Pathogenesis. Diabetes. 2024;73:1862-1874.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 16]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
12.  Yaykasli KO, Schauer C, Muñoz LE, Mahajan A, Knopf J, Schett G, Herrmann M. Neutrophil Extracellular Trap-Driven Occlusive Diseases. Cells. 2021;10:2208.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 32]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
13.  Sun X, Xu S, Liu T, Wu J, Yang J, Gao XJ. Zinc supplementation alleviates oxidative stress to inhibit chronic gastritis via the ROS/NF-κB pathway in a mouse model. Food Funct. 2024;15:7136-7147.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 18]  [Reference Citation Analysis (0)]
14.  Kim B, Lee WW. Regulatory Role of Zinc in Immune Cell Signaling. Mol Cells. 2021;44:335-341.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 37]  [Cited by in RCA: 88]  [Article Influence: 17.6]  [Reference Citation Analysis (0)]
15.  Gao H, Dai W, Zhao L, Min J, Wang F. The Role of Zinc and Zinc Homeostasis in Macrophage Function. J Immunol Res. 2018;2018:6872621.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 63]  [Cited by in RCA: 115]  [Article Influence: 14.4]  [Reference Citation Analysis (0)]
16.  Hübner C, Haase H. Interactions of zinc- and redox-signaling pathways. Redox Biol. 2021;41:101916.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 13]  [Cited by in RCA: 138]  [Article Influence: 27.6]  [Reference Citation Analysis (0)]
17.  Jomova K, Alomar SY, Valko R, Nepovimova E, Kuca K, Valko M. The role of redox-active iron, copper, manganese, and redox-inactive zinc in toxicity, oxidative stress, and human diseases. EXCLI J. 2025;24:880-954.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 22]  [Reference Citation Analysis (0)]
18.  Su SY, Tang QQ. Altered intestinal microflora and barrier injury in severe acute pancreatitis can be changed by zinc. Int J Med Sci. 2021;18:3050-3058.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 15]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
19.  Tang QQ, Su SY, Fang MY. Zinc supplement modulates oxidative stress and antioxidant values in rats with severe acute pancreatitis. Biol Trace Elem Res. 2014;159:320-324.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 20]  [Cited by in RCA: 23]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
20.  Zhou X, Wang H, Lian S, Wang J, Wu R. Effect of Copper, Zinc, and Selenium on the Formation of Bovine Neutrophil Extracellular Traps. Biol Trace Elem Res. 2021;199:3312-3318.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 13]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
21.  Hasan R, Rink L, Haase H. Zinc signals in neutrophil granulocytes are required for the formation of neutrophil extracellular traps. Innate Immun. 2013;19:253-264.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 88]  [Cited by in RCA: 66]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
22.  Cheng J, Rink L, Wessels I. Zinc Supplementation Reduces the Formation of Neutrophil Extracellular Traps by Decreasing the Expression of Peptidyl Arginine Deiminase 4. Mol Nutr Food Res. 2024;68:e2400013.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 9]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
23.  Daniel C, Leppkes M, Muñoz LE, Schley G, Schett G, Herrmann M. Extracellular DNA traps in inflammation, injury and healing. Nat Rev Nephrol. 2019;15:559-575.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 83]  [Cited by in RCA: 152]  [Article Influence: 21.7]  [Reference Citation Analysis (0)]
24.  Saha P, Yeoh BS, Xiao X, Golonka RM, Singh V, Wang Y, Vijay-Kumar M. PAD4-dependent NETs generation are indispensable for intestinal clearance of Citrobacter rodentium. Mucosal Immunol. 2019;12:761-771.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 39]  [Cited by in RCA: 66]  [Article Influence: 9.4]  [Reference Citation Analysis (0)]
25.  Li F, Wang Z, Cao Y, Pei B, Luo X, Liu J, Ge P, Luo Y, Ma S, Chen H. Intestinal Mucosal Immune Barrier: A Powerful Firewall Against Severe Acute Pancreatitis-Associated Acute Lung Injury via the Gut-Lung Axis. J Inflamm Res. 2024;17:2173-2193.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 21]  [Cited by in RCA: 17]  [Article Influence: 8.5]  [Reference Citation Analysis (1)]
26.  Liu X, Arfman T, Wichapong K, Reutelingsperger CPM, Voorberg J, Nicolaes GAF. PAD4 takes charge during neutrophil activation: Impact of PAD4 mediated NET formation on immune-mediated disease. J Thromb Haemost. 2021;19:1607-1617.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 39]  [Cited by in RCA: 197]  [Article Influence: 39.4]  [Reference Citation Analysis (0)]
27.  Wang Z, Shi R, Shi Y, Sun T, Shen Y, Wu C, Yang Y, Fan H, Wu J. Profibrotic impact of PAD4-driven macrophage extracellular traps in ulcerative colitis. Pharmacol Res. 2025;220:107933.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 10]  [Article Influence: 10.0]  [Reference Citation Analysis (0)]
28.  Guttek K, Reinhold A, Grüngreiff K, Schraven B, Reinhold D. Zinc aspartate induces proliferation of resting and antigen-stimulated human PBMC under high-density cell culture condition. J Trace Elem Med Biol. 2023;77:127152.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 3]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
29.  Wessels I, Pupke JT, von Trotha KT, Gombert A, Himmelsbach A, Fischer HJ, Jacobs MJ, Rink L, Grommes J. Zinc supplementation ameliorates lung injury by reducing neutrophil recruitment and activity. Thorax. 2020;75:253-261.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 65]  [Article Influence: 10.8]  [Reference Citation Analysis (0)]
30.  Chen B, Yu P, Chan WN, Xie F, Zhang Y, Liang L, Leung KT, Lo KW, Yu J, Tse GMK, Kang W, To KF. Cellular zinc metabolism and zinc signaling: from biological functions to diseases and therapeutic targets. Signal Transduct Target Ther. 2024;9:6.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 260]  [Reference Citation Analysis (0)]
31.  Dömer D, Walther T, Möller S, Behnen M, Laskay T. Neutrophil Extracellular Traps Activate Proinflammatory Functions of Human Neutrophils. Front Immunol. 2021;12:636954.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 19]  [Cited by in RCA: 176]  [Article Influence: 35.2]  [Reference Citation Analysis (0)]
32.  Wu S, Chen Y, Jin X, Yu J, Chen X, Wan T. Toll Like Receptors Promote High Glucose-Induced Vascular Endothelial Cell Dysfunction by Regulating Neutrophil Extracellular Traps Formation. Inflammation. 2025;48:3542-3559.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 10]  [Article Influence: 10.0]  [Reference Citation Analysis (0)]
33.  Kim JH, Jeon J, Shin M, Won Y, Lee M, Kwak JS, Lee G, Rhee J, Ryu JH, Chun CH, Chun JS. Regulation of the catabolic cascade in osteoarthritis by the zinc-ZIP8-MTF1 axis. Cell. 2014;156:730-743.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 242]  [Cited by in RCA: 313]  [Article Influence: 26.1]  [Reference Citation Analysis (0)]
34.  Saroj M, Prakash S, Vikram NK, Saraya A, Priyatma, Ganie MA, Arulselvi S, Pandey S. Hyperactive behaviour of growth differentiation factor- 15 (GDF-15) in conjunction with iron trafficking transporters and suppression of Nrf-2 gene in diabetes and metabolic syndrome. Mol Cell Biochem. 2024;479:1109-1120.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
35.  Hatano N, Matsubara M, Suzuki H, Muraki Y, Muraki K. HIF-1α Dependent Upregulation of ZIP8, ZIP14, and TRPA1 Modify Intracellular Zn(2+) Accumulation in Inflammatory Synoviocytes. Int J Mol Sci. 2021;22:6349.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5]  [Cited by in RCA: 18]  [Article Influence: 3.6]  [Reference Citation Analysis (1)]
36.  Gu J, Sun R, Tang D, Liu F, Chang X, Wang Q. Astragalus mongholicus Bunge-Curcuma aromatica Salisb. suppresses growth and metastasis of colorectal cancer cells by inhibiting M2 macrophage polarization via a Sp1/ZFAS1/miR-153-3p/CCR5 regulatory axis. Cell Biol Toxicol. 2022;38:679-697.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 38]  [Article Influence: 9.5]  [Reference Citation Analysis (0)]
37.  Lin Z, Lv D, Liao X, Peng R, Liu H, Wu T, Wu K, Sun Y, Zhang Z. CircUBXN7 promotes macrophage infiltration and renal fibrosis associated with the IGF2BP2-dependent SP1 mRNA stability in diabetic kidney disease. Front Immunol. 2023;14:1226962.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 31]  [Reference Citation Analysis (0)]
38.  Aiba I, Hossain A, Kuo MT. Elevated GSH level increases cadmium resistance through down-regulation of Sp1-dependent expression of the cadmium transporter ZIP8. Mol Pharmacol. 2008;74:823-833.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 38]  [Cited by in RCA: 36]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
39.  Hidalgo A, Libby P, Soehnlein O, Aramburu IV, Papayannopoulos V, Silvestre-Roig C. Neutrophil extracellular traps: from physiology to pathology. Cardiovasc Res. 2022;118:2737-2753.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 130]  [Cited by in RCA: 329]  [Article Influence: 82.3]  [Reference Citation Analysis (0)]
40.  Rasmussen KH, Hawkins CL. Role of macrophage extracellular traps in innate immunity and inflammatory disease. Biochem Soc Trans. 2022;50:21-32.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 53]  [Article Influence: 13.3]  [Reference Citation Analysis (0)]
41.  Ishqi HM, Ali M, Dawra R. Recent advances in the role of neutrophils and neutrophil extracellular traps in acute pancreatitis. Clin Exp Med. 2023;23:4107-4122.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 20]  [Cited by in RCA: 19]  [Article Influence: 6.3]  [Reference Citation Analysis (1)]
42.  Conceição-Silva F, Reis CSM, De Luca PM, Leite-Silva J, Santiago MA, Morrot A, Morgado FN. The Immune System Throws Its Traps: Cells and Their Extracellular Traps in Disease and Protection. Cells. 2021;10:1891.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 49]  [Article Influence: 9.8]  [Reference Citation Analysis (0)]
43.  Li Z, Hu W, Lv K, Sui L, Yuan M, Ao L, Chen Q, Li J, Tian L, Liu Z, Wang S, Liang H, Xu X. HDAC2 enhances the antimicrobial activity of neutrophils by promoting the formation of neutrophil extracellular traps (NETs) in sepsis. J Adv Res. 2025;S2090-1232(25)00655.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 5]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
44.  Meng W, Paunel-Görgülü A, Flohé S, Hoffmann A, Witte I, MacKenzie C, Baldus SE, Windolf J, Lögters TT. Depletion of neutrophil extracellular traps in vivo results in hypersusceptibility to polymicrobial sepsis in mice. Crit Care. 2012;16:R137.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 134]  [Cited by in RCA: 158]  [Article Influence: 11.3]  [Reference Citation Analysis (0)]
45.  Chaaban H, Burge K, Eckert J, Keshari RS, Silasi R, Lupu C, Warner B, Escobedo M, Caplan M, Lupu F. Neutrophil extracellular trap inhibition increases inflammation, bacteraemia and mortality in murine necrotizing enterocolitis. J Cell Mol Med. 2021;25:10814-10824.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 26]  [Cited by in RCA: 25]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
46.  Sharma M, Sachdev V, Singh N, Bhardwaj P, Pal A, Kapur S, Saraya A. Alterations in intestinal permeability and endotoxemia in severe acute pancreatitis. Trop Gastroenterol. 2012;33:45-50.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 19]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
47.  Duan Z, Xie T, Chu C, Chen F, Wang X, Li J, Ding W. De-escalation antibiotic therapy alleviates organ injury through modulation of NETs formation during sepsis. Cell Death Discov. 2021;7:345.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 10]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
48.  Banks PA, Bollen TL, Dervenis C, Gooszen HG, Johnson CD, Sarr MG, Tsiotos GG, Vege SS; Acute Pancreatitis Classification Working Group. Classification of acute pancreatitis--2012: revision of the Atlanta classification and definitions by international consensus. Gut. 2013;62:102-111.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5667]  [Cited by in RCA: 4969]  [Article Influence: 382.2]  [Reference Citation Analysis (18)]
49.  Wang M, Phadke M, Packard D, Yadav D, Gorelick F. Zinc: Roles in pancreatic physiology and disease. Pancreatology. 2020;20:1413-1420.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 24]  [Article Influence: 4.0]  [Reference Citation Analysis (1)]
50.  Zhang J, Li QR, Cui J, Fu XK, Tian G. Specificity protein 1 suppresses prohibitin 1 to induce macrophage M1 polarization and impair phagocytosis, exacerbating sepsis-associated acute lung injury. Free Radic Biol Med. 2025;237:473-490.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 6]  [Reference Citation Analysis (0)]
51.  Ding J, Fayyaz AI, Ding Y, Liang D, Luo M. Role of Specificity Protein 1 (SP1) in Cardiovascular Diseases: Pathological Mechanisms and Therapeutic Potentials. Biomolecules. 2024;14:807.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 15]  [Cited by in RCA: 25]  [Article Influence: 12.5]  [Reference Citation Analysis (0)]
52.  Soledad RB, Charles S, Samarjit D. The secret messages between mitochondria and nucleus in muscle cell biology. Arch Biochem Biophys. 2019;666:52-62.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 28]  [Cited by in RCA: 38]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
53.  Criddle DN. Reactive oxygen species, Ca(2+) stores and acute pancreatitis; a step closer to therapy? Cell Calcium. 2016;60:180-189.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 40]  [Cited by in RCA: 59]  [Article Influence: 5.9]  [Reference Citation Analysis (0)]
54.  Yan J, Liu H, Xu Y, Sun X, Meng X, Wei S, Li Z, Jin X, Liu J, Wang X, Cui P, He Z. Tailored "Three-stage booster" nano-extinguisher for synergistic treatment of severe acute pancreatitis by rectifying mitochondrial dysfunction and inhibiting pancreatic autodigestion. Acta Biomater. 2025;200:569-590.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 7]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
55.  Wen E, Cao Y, He S, Zhang Y, You L, Wang T, Wang Z, He J, Feng Y. The mitochondria-targeted Kaempferol nanoparticle ameliorates severe acute pancreatitis. J Nanobiotechnology. 2024;22:148.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 45]  [Reference Citation Analysis (1)]
56.  Ouyang W, Chen Y, Tan T, Song Y, Dong T, Yu X, Lee KE, Zhou X, Tetz Z, Go S, Zeng X, Shao L, Quan C, Zhao T, Tian Y, Kurabayashi K, Jin H, Ma J, Qin J, Williams B, Li Q, Zhu GD, Alam HB, Stringer KA, Li Y, Ma J. A citrullinated histone H3 monoclonal antibody for immune modulation in sepsis. Nat Commun. 2025;16:7435.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 19]  [Cited by in RCA: 21]  [Article Influence: 21.0]  [Reference Citation Analysis (0)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade B, Grade B, Grade C

Novelty: Grade B, Grade B, Grade D

Creativity or innovation: Grade B, Grade B, Grade C

Scientific significance: Grade B, Grade B, Grade D

P-Reviewer: Du QC, MD, China; Fu Y, PhD, China; Liu YQ, Associate Chief Physician, Associate Professor, MD, PhD, China S-Editor: Fan M L-Editor: A P-Editor: Zhang L

Write to the Help Desk