BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Gastroenterol. Oct 7, 2026; 32(37): 121244
Published online Oct 7, 2026. doi: 10.3748/wjg.121244
Wenyang Jiedu Huayu Formula targets succinate metabolism to alleviate acute-on-chronic liver failure
Jie Zhou, Nian-Hua Tan, Bin Chen, Department of Hepatology, The First Hospital of Hunan University of Chinese Medicine, Changsha 410007, Hunan Province, China
Xiao-Ling Tian, Department of Traditional Chinese Medicine, School of Health and Medicine, China Three Gorges University, Yichang 443002, Hubei Province, China
Yi-Fang Zhou, Department of Gastroenterology, Hunan Provincial Hospital of Integrated Traditional Chinese and Western Medicine, Changsha 410006, Hunan Province, China
Zhuo-Yu Zhou, Department of Otorhinolaryngology, Hunan Women and Children’s Hospital, Changsha 410208, Hunan Province, China
ORCID number: Jie Zhou (0009-0005-0881-1494); Nian-Hua Tan (0000-0003-0240-2903); Bin Chen (0000-0002-5485-2263).
Co-corresponding authors: Nian-Hua Tan and Bin Chen.
Author contributions: Zhou J performed the experiments, analyzed the data, and wrote the manuscript; Tian XL, Zhou YF, and Zhou ZY performed the experiments and analyzed the data; Tan NH and Chen B designed and coordinated the study as co-corresponding authors. All authors approved the final version of the manuscript.
Supported by National Natural Science Foundation of China, No. 82575008; Chinese Medicine Advantageous Disease (Clinical Evidence-Based Capacity Enhancement) Project of the National Administration of Traditional Chinese Medicine, No. czxm-kyb-2025001; Hunan Provincial Natural Science Foundation of China, No. 2026JJ30167 and No. 2026JJ50326; University-Hospital Joint Fund Project of Hunan University of Chinese Medicine, No. 2024XYLH343; and Hunan Provincial Postgraduate Research Innovation Project, No. 2024CX018.
Institutional animal care and use committee statement: This study was approved by the Ethics Committee of the First Affiliated Hospital of Hunan University of Chinese Medicine, No. ZYFY202503313.
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: No additional data are available.
Corresponding author: Bin Chen, MD, Department of Hepatology, The First Hospital of Hunan University of Chinese Medicine, No. 95 Shaoshan Middle Road, Yuhua District, Changsha 410007, Hunan Province, China. chenbin0410@126.com
Received: March 20, 2026
Revised: April 25, 2026
Accepted: June 30, 2026
Published online: October 7, 2026
Processing time: 165 Days and 17.1 Hours

Abstract
BACKGROUND

Acute-on-chronic liver failure (ACLF) is a life-threatening condition characterized by acute hepatic decompensation and high short-term mortality. Although Wenyang Jiedu Huayu Formula (WYJD) has demonstrated therapeutic efficacy for alleviating liver injury and modulating immune inflammation, whether its hepatoprotective effects involve targeting succinate metabolism remains unclear.

AIM

To investigate whether WYJD exerts therapeutic effects in ACLF by targeting succinate metabolism and to elucidate the underlying molecular mechanisms.

METHODS

ACLF rat model was prepared by sensitization using bovine serum albumin, followed by D-galactosamine/lipopolysaccharide challenge. Animals were assigned to normal control, Model, WYJD, and WYJD plus succinate dehydrogenase (SDH) inhibitor groups. Therapeutic efficacy was evaluated using hepatic histopathology and inflammatory cytokine profiling. Succinate metabolism-related molecular changes were systematically analyzed using targeted energy metabolomics, biochemical enzyme activity assays, western blotting, and reverse transcription quantitative polymerase chain reaction. Mitochondrial ultrastructure was examined using transmission electron microscopy. Intrahepatic macrophage infiltration was assessed using immunofluorescence staining.

RESULTS

WYJD treatment markedly attenuated hepatic necrosis and inflammatory cell infiltration in ACLF rat models. Metabolomic analysis revealed succinate accumulation and tricarboxylic acid cycle dysfunction in the ACLF liver tissues, which were effectively reversed by WYJD. Mechanistically, WYJD upregulated SDH activity and expression of its catalytic subunits SDHA/B, facilitating succinate-to-fumarate conversion and reducing succinate levels, thereby suppressing downstream hypoxia-inducible factor-1α expression. In addition, WYJD improved mitochondrial ultrastructure, restored ATP content, and reduced CD68+ macrophage infiltration in liver. These beneficial effects were partially abolished by SDH inhibition.

CONCLUSION

WYJD ameliorated ACLF by acting partly through SDH to clear accumulated succinate and suppress hypoxia-inducible factor-1α-mediated inflammation, suggesting succinate metabolism as a potential therapeutic target.

Key Words: Acute-on-chronic liver failure; Wenyang Jiedu Huayu Formula; Succinate metabolism; Succinate dehydrogenase; Hypoxia-inducible factor-1α; Macrophages; Metabolic reprogramming

Core Tip: This study demonstrated that Wenyang Jiedu Huayu Formula (WYJD) ameliorated acute-on-chronic liver failure by targeting succinate metabolism. WYJD acts partly through succinate dehydrogenase to clear accumulated succinate and suppress hypoxia-inducible factor-1α signaling, thereby correcting energy metabolic disturbances and attenuating macrophage-mediated inflammation. These findings suggested that succinate metabolism can be a potential therapeutic target in acute-on-chronic liver failure, and the study provided mechanistic insights supporting the clinical application of WYJD from a metabolic-immune perspective.



INTRODUCTION

Acute-on-chronic liver failure (ACLF) is a severe clinical syndrome characterized by acute hepatic decompensation superimposed on chronic liver disease, and presents with high short-term mortality and poor prognosis[1,2]. Liver transplantation is the definitive treatment, but its clinical application is limited by donor shortage and high costs[1]. Therefore, elucidating the pathogenesis of ACLF and exploring safe and effective medical treatment strategies is of significant clinical importance.

The pathological mechanisms underlying ACLF involve intense systemic inflammation and immune-metabolic dysregulation[3,4]. To meet the immense energy demands of uncontrolled inflammation and immune cell activation, the body undergoes metabolic reprogramming, manifested as mitochondrial dysfunction, disruption of the tricarboxylic acid (TCA) cycle, and inhibition of oxidative phosphorylation (OXPHOS)[5-7]. This metabolic imbalance not only directly causes hepatocyte death and organ failure, but also reciprocally regulates immune cell activation and inflammatory responses by altering key metabolite levels, forming a detrimental metabolic-immunity cycle that accelerates disease progression[7,8]. Recent studies have identified succinate, an intermediate metabolite of TCA cycle, to be an important metabolic hub linking cellular metabolic status to inflammatory signaling[9,10]. Under stressful conditions such as hypoxia or inflammation, succinate dehydrogenase (SDH) activity is suppressed leading to aberrant succinate accumulation[9]. Accumulated succinate stabilizes hypoxia-inducible factor-1α (HIF-1α) by inhibiting prolyl hydroxylase activity, thereby driving glycolysis and promoting the expression of pro-inflammatory genes[11]. Therefore, targeting succinate metabolism to restore homeostasis may represent a novel strategy for ameliorating the metabolic disturbances and excessive inflammatory responses in ACLF.

Extensive clinical experience has been accumulated in traditional Chinese medicine for the prevention and treatment of liver failure. Based on the intertwined pathogenesis of ACLF characterized by “blood stasis”, “toxicity”, and “deficiency” in Chinese medicine theory, our research group established “resolving stasis, reinforcing deficiency, and promoting regeneration” as the core therapeutic principle, and accordingly developed the Wenyang Jiedu Huayu Formula (WYJD). Among the six herbal components, Chishao and Fuzi constituted the core herb pair and served as sovereign drugs for WYJD (Table 1). The long-term clinical application of WYJD in patients with ACLF has demonstrated favorable therapeutic efficacy, effectively reducing mortality rates, and the formula has been incorporated into relevant clinical guidelines[12,13].

Table 1 Wenyang Jiedu Huayu Formula composition.
Chinese name
Scientific name
Common name
Weight (g)
Part used
Fu PianAconitum carmichaelii DebeauxProcessed aconite lateral root10Processed lateral root
Bai ZhuAtractylodes macrocephala KoidzLargehead atractylodes rhizome30Rhizome
Yin ChenArtemisia capillaris ThunbCapillary wormwood herb30Aerial part
Dan ShenSalvia miltiorrhiza BungeSalvia root30Root and rhizome
Chi ShaoPaeonia lactiflora PallRed peony root60Root
Yi Yi RenCoix lacryma-jobi L. var. ma-yuen (Roman.) StapfCoix seed30Seed

Our previous studies on this core herb pair demonstrated that Chishao-Fuzi downregulates HIF-1α, inhibits glycolysis, and promotes macrophage polarization toward the anti-inflammatory M2 phenotype, thereby mitigating immune-inflammatory injury in ACLF[14,15]. These findings suggested that the active components within WYJD may similarly act upstream of HIF-1α regulation, with succinate as a key metabolic signaling molecule critical for HIF-1α stabilization serving as an important node connecting energy metabolism and immune inflammation. Based on this premise, the present study investigated whether WYJD ameliorated energy metabolic disorders and immune-inflammatory injury in ACLF by SDH activation, clearance of aberrantly accumulated succinate, and subsequent inhibition of HIF-1α signaling pathway from the perspective of succinate metabolic regulation.

MATERIALS AND METHODS
Animals

Male Sprague-Dawley rats (specific pathogen-free, 110-150 g) were supplied by Hunan SJA Laboratory Animal Co., Ltd. Animals were kept under standardized conditions (22-26 °C, 50%-70% humidity, 12-hour light/dark cycle) with unrestricted access to food and water. All procedures were approved by the Ethics Committee of the First Affiliated Hospital of Hunan University of Chinese Medicine, No. ZYFY202503313.

Reagents

Bovine serum albumin (BSA, AWB0157a) was obtained from Abiowell. Freund’s incomplete adjuvant (F5506), D-galactosamine (G0750), lipopolysaccharide (L2630), and dimethyl malonate (DMM, 136441) were purchased from Sigma-Aldrich.

Preparation of WYJD

WYJD consisted of six Chinese herbal medicines (Table 1) sourced from the First Affiliated Hospital of Hunan University of Chinese Medicine. The herbs were weighed according to the clinical prescription, soaked in distilled water for 30 minutes, and made into a decoction. Fu Pian was first decocted for 1 hour, after which the remaining five herbs were added, and the mixture was boiled for an additional 40 minutes. The decoction was filtered and the residue was re-boiled with distilled water for 30 minutes. The two filtrates were combined and concentrated to a final concentration of 1.71 g crude drug/mL for subsequent animal experiments. Chemical profiling was done using ultra-performance liquid chromatography-tandem mass spectrometry, as described previously[16].

Animal model establishment and grouping

The ACLF rat model was established as described previously (Figure 1)[14]. The rats were sensitized by subcutaneous multisite injections of BSA emulsion (0.5 mL containing 4 mg BSA) on days 1, 14, 24, and 34. From day 35, immunological challenge was performed via tail vein injections of BSA solution twice weekly for six consecutive weeks, with doses progressively increasing from 2 mg to 4 mg in 0.5 mg increments. On the day following the final tail vein injection, acute liver injury was induced by intraperitoneal administration of D-galactosamine (400 mg/kg) and lipopolysaccharide (100 μg/kg). Twelve hours later, the rats were anesthetized with 3% sodium pentobarbital (2 mL/kg, i.p.) and blood samples were collected from the abdominal aorta and liver tissues for subsequent analyses.

Figure 1
Figure 1 Schematic diagram of the acute-on-chronic liver failure rat model protocol. BSA: Bovine serum albumin; D-GaIN: D-galactosamine; LPS: Lipopolysaccharide; WYJD: Wenyang Jiedu Huayu Formula; DMM: Dimethyl malonate.

The rats were initially allocated to either a normal control group (NC, n = 6) or a model induction group (n = 34). During the induction period, 10 rats died. The remaining rats were assigned to the Model, WYJD, or WYIN (WYJD plus DMM) groups. Rats in the WYJD group received daily intragastric administration of WYJD decoction (17.1 g/kg), whereas those in the WYIN group received additional intraperitoneal injections of DMM (160 mg/kg)[17]. Equal volumes of saline were administered to the NC and Model groups. All interventions were continued until the acute challenge, and the final number of surviving rats in each group was used for analysis.

Liver histology

Fixed in 40 g/L formaldehyde, paraffin-embedded liver sections (5 μm) were stained with hematoxylin and eosin. The sections were examined and photographed under a light microscope.

Immunofluorescence

Liver tissue sections were blocked with 5% BSA and incubated overnight at 4 °C with primary antibodies against CD68 (1:200, Servicebio, GB113109, China) and Ki67 (1:200, Abiowell, AWA10320, China). After washing, the sections were incubated with fluorophore-conjugated secondary antibodies (1:500) at 37 °C for 1 hour, counterstained with DAPI, and imaged using a fluorescence microscope (BA410T, Motic, China).

Transmission electron microscopy

Liver specimens (1 mm³) were fixed in 2.5 g/L glutaraldehyde, post-fixed in 10 g/L osmium tetroxide, dehydrated, and embedded in epoxy resin. Ultrathin sections were stained with uranyl acetate and lead citrate and examined under a transmission electron microscope (JEM-1400FLASH, JEOL, Japan). Mitochondrial damage was semi-quantitatively assessed using the Flameng scoring system[18]. For each group, 20-30 randomly selected mitochondria from five randomly chosen fields per section were scored by two independent observers who were blinded to group allocation. The scoring criteria are listed in Table 2. The average score for each group was calculated and presented as mean ± SD.

Table 2 Flameng scoring criteria for mitochondrial damage.
Score
Description
0Normal mitochondrial morphology
1Mild swelling, decreased matrix density, and separated cristae
2Moderate swelling, translucent matrix, and intact cristae
3Severe swelling, condensed matrix, and ruptured cristae
4Severe swelling with ruptured cristae, complete loss of inner and outer membranes, and vacuolation
ELISA

Serum and liver homogenate levels of interleukin-1β (IL-1β, YJ037361), tumor necrosis factor-α (YJ002859), and IL-10 (YJ002813) were quantified using ELISA kits (Shanghai Enzyme-Linked Biotechnology, China) according to the manufacturer’s instructions.

Reverse transcription quantitative polymerase chain reaction

Total RNA was isolated from the liver tissues using a TRIzol reagent, and complementary DNA was synthesized using a reverse transcription kit (CW2569, CWBIO, China). Quantitative polymerase chain reaction was performed on a PIKOREAL96 system (Thermo, United States) with SYBR Green Master Mix. The primer sequences are listed in Table 3. Relative expression was calculated by the 2-ΔΔCt method with β-actin as reference.

Table 3 Primer sequences for reverse transcription quantitative polymerase chain reaction.
Gene
Forward sequence (5′-3′)
Reverse sequence (5′-3′)
Size (bp)
SDHACTGTTGCCAAGGACCTAGCATAGCCTCTTCCTTCACGGAT70
SDHBCAAAACCTTCGCCATTTACCGATTAGAGCATCCAGCACCATCG32
HIF-1αACGATTGTGAAGTTAATGCTCCCAACCAACAGAAACGAAACCCC120
β-actinACATCCGTAAAGACCTCTATGCCTACTCCTGCTTGCTGATCCAC42
Western blot analysis

Liver lysates were prepared in RIPA buffer containing protease inhibitors, and protein concentrations were measured using bicinchoninic acid assay. Equal amounts of proteins were separated by sodium-dodecyl sulfate gel electrophoresis and transferred to polyvinylidene fluoride membranes. Membranes were blocked with 5% skim milk and incubated overnight at 4 °C with primary antibodies against SDHA (1:1000, Proteintech, 14865-1-AP, China), SDHB (1:1000, Proteintech, 10620-1-AP, China), HIF-1α (1:1000, Abiowell, AWA13590, China), and β-actin (1:5000, Proteintech, 66009-1-Ig, China), then with HRP-conjugated secondary antibodies (1:5000). The bands were visualized using enhanced chemiluminescence and quantified using ImageJ.

Targeted metabolomics analysis of TCA cycle intermediates

Liver samples (50 mg) were homogenized in cold methanol, extracted with 80% methanol, incubated at -20 °C, and centrifuged. The supernatants were dried, reconstituted in methanol-water (1:1), and analyzed by liquid chromatography-tandem mass spectrometry (Shimadzu Nexera X2 LC-30AD, Japan; AB SCIEX QTRAP 6500+, United States) using a Kinetex F5 column (2.6 μm, 3.0 mm × 100 mm). Mobile phases were 10 mmol/L ammonium acetate (A) and acetonitrile (B) with gradient elution: 0-3 minutes 0% B, 3-10 minutes 0%-95% B, 10-12 minutes 95% B, 12-13 minutes 95%-0% B, 13-14 minutes 0% B. Electrospray ionization source parameters: Ion spray voltage ±5500/-4500 V, temperature 500 °C, gas1 55 psi, gas2 60 psi, curtain gas 35 psi. Multiple reaction monitoring mode was used to quantify TCA cycle intermediates.

SDH activity and energy metabolism indicators

Hepatic SDH activity (A022-1-1, Nanjing Jiancheng, China), ATP content (A095-1-1, Nanjing Jiancheng, China), NAD+/NADH ratio (S0176S, Beyotime, China), and succinate levels (E-BC-K902-M, Elabscience, China) were measured using commercial kits following standard protocols.

Statistical analysis

Data are presented as mean ± SD. GraphPad Prism 10 was used for statistical analysis and graphing. Normality was tested using Shapiro-Wilk and Q-Q plots. For multiple comparisons, one-way ANOVA with Tukey’s post-hoc test (normal distribution, equal variance) or Kruskal-Wallis with Dunn’s test (non-normal/unequal variance) was applied. P < 0.05 was considered significant.

RESULTS
WYJD ameliorated liver injury and inflammatory response in ACLF rats

To assess the therapeutic effect of WYJD on ACLF, we evaluated histopathological changes in liver tissues and systemic inflammatory markers. Hematoxylin and eosin staining revealed that compared with the NC group, the Model group exhibited disrupted hepatic architecture characterized by extensive hepatocyte necrosis, ballooning degeneration, and massive inflammatory cell infiltration. WYJD treatment significantly reduced necrosis and inflammatory infiltration, thereby improving liver tissue structure. The improvement in liver pathology was less pronounced in the WYIN group (WYJD combined with the SDH inhibitor DMM) than in the WYJD group (Figure 2A).

Figure 2
Figure 2 Wenyang Jiedu Huayu Formula ameliorates liver injury and inflammatory response in acute-on-chronic liver failure rats. A: Representative images of hematoxylin and eosin-stained liver sections from each group. Black arrows indicate hepatocellular necrosis, green arrows indicate ballooning degeneration, and yellow arrows indicate inflammatory cell infiltration. Scale bars: 200 μm (× 40), 100 μm (× 100), 50 μm (× 200), 20 μm (× 400); B: Levels of inflammatory cytokines, including tumor necrosis factor-α, interleukin-1β, and interleukin-10, in liver tissue homogenates measured by ELISA; C: Serum levels of tumor necrosis factor-α, interleukin-1β, and interleukin-10 measured by ELISA. Data are presented as mean ± SD (n = 6 per group). aP < 0.05, dP < 0.0001. NC: Normal control group; WYJD: Wenyang Jiedu Huayu Formula; WYIN: Wenyang Jiedu Huayu Formula plus dimethyl malonate; IL: Interleukin; TNF-α: Tumor necrosis factor-α.

ELISA analysis showed that serum and hepatic levels of tumor necrosis factor-α and IL-1β were markedly elevated in the Model group, whereas IL-10 decreased. WYJD treatment significantly reversed these changes and restored the balance between pro- and anti-inflammatory mediators (Figure 2B and C). Co-administration with DMM partially abrogated the effects of WYJD on cytokine levels. These results indicated that WYJD alleviated liver injury and systemic inflammation in ACLF, potentially by modulating SDH activity.

WYJD reshaped hepatic energy metabolism by modulating succinate metabolism and correcting TCA cycle dysfunction

Targeted metabolomics showed succinate accumulation and TCA cycle disturbances: To elucidate the metabolic basis of the action of WYJD in ACLF, we performed targeted energy metabolomics of liver tissues. Orthogonal partial least squares discriminant analysis score plot and permutation test results revealed a clear separation in the metabolic profiles among the four groups indicating no overfitting and confirming that ACLF modeling and subsequent drug intervention profoundly reshaped the hepatic metabolic landscape (Figure 3A and B). Heatmap analysis revealed a distinct clustering of key energy metabolites among the four groups (Figure 3C). Succinate levels were markedly elevated in the model group, indicating an aberrant accumulation under ACLF conditions. WYJD treatment significantly reduced succinate levels, an effect that was attenuated by SDH inhibition in the WYIN group. Other TCA cycle intermediates including fumarate, malate, and acetyl-CoA, decreased in the Model group and were restored by WYJD, and decreased in the WYIN group (Figure 3D). Quantitative analysis confirmed that succinate content was significantly increased and fumarate content was decreased in the Model group compared with the NC group (Figure 3E) suggesting metabolic blockade at the SDH-catalyzed step. WYJD treatment normalized these changes and this effect was abrogated by SDH inhibition. An independent biochemical assay for succinate content in liver homogenates corroborated these findings (Figure 3F). Notably, although the absolute succinate values differed between the two methods owing to their distinct analytical principles, both methods consistently demonstrated significant succinate accumulation in the Model group which was reversed by WYJD treatment, supporting the robustness of this finding.

Figure 3
Figure 3 Wenyang Jiedu Huayu Formula reshapes hepatic energy metabolism by modulating succinate metabolism and correcting tricarboxylic acid cycle dysfunction. A: Orthogonal partial least squares discriminant analysis score plot showing the overall separation pattern of energy metabolic profiles in liver tissues among the four groups; B: Permutation test (200 permutations) validating the robustness of the orthogonal partial least squares discriminant analysis model; C: Heatmap visualization of targeted energy metabolomics analysis in liver tissues from the four groups; D: Schematic diagram of tricarboxylic acid cycle; E: Quantitative analysis of succinate and fumarate levels in liver tissues measured by targeted metabolomics; F: Succinate content in liver tissue homogenates measured by a biochemical colorimetric assay; G: Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of differentially expressed metabolites; H: Quantitative analysis of lactate levels, lactate/pyruvate ratio, and ATP content in liver tissues measured by targeted metabolomics; I: ATP levels and NAD+/NADH ratio in liver tissues measured by biochemical assays. Data are presented as mean ± SD (n = 5 per group). aP < 0.05, cP < 0.001, and dP < 0.0001. TCA: Tricarboxylic acid; NC: Normal control group; WYJD: Wenyang Jiedu Huayu Formula; WYIN: Wenyang Jiedu Huayu Formula plus dimethyl malonate.

Pathway enrichment analysis reveals restoration of TCA cycle and suppression of HIF-1α signaling: Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of the differentially expressed metabolites demonstrated systematic metabolic reconfiguration following WYJD intervention (Figure 3G). The most significantly enriched pathways included the TCA cycle, carbon metabolism, and HIF-1 signaling. Restoration of the TCA cycle and carbon metabolism pathways suggests that WYJD re-establishes core energy metabolic homeostasis, whereas enrichment changes in the HIF-1 pathway link succinate metabolism to inflammatory regulation. These data indicated that WYJD corrected aberrant succinate metabolism and restored TCA cycle function in ACLF.

WYJD improves cellular energy status and redox homeostasis: To assess the functional consequences of TCA cycle restoration, we measured hepatic energy parameters. Compared with the NC group, the Model group exhibited significantly reduced ATP content and NAD+/NADH ratio along with elevated lactate levels and lactate/pyruvate ratio, indicating enhanced glycolytic compensation. WYJD treatment restored ATP levels and the NAD+/NADH ratio while decreasing lactate levels and lactate/pyruvate ratio (Figure 3H and I). These results demonstrated that WYJD enhanced mitochondrial energy metabolism efficiency by restoring TCA cycle flux, thereby alleviating excessive glycolysis.

WYJD upregulates SDH activity to clear succinate and inhibit HIF-1α expression

Based on metabolomics findings of aberrant succinate accumulation, we further validated SDH/succinate/HIF-1α signaling axis at the molecular level. SDH is a key enzyme involved in the TCA cycle and electron transport chain (ETC), and its functional status directly affects succinate metabolism and cellular energy homeostasis[19]. Given that the SDHA and SDHB subunits constitute the catalytic core of SDH, which is responsible for succinate oxidation and electron transfer[19,20], we focused on detecting their expression and SDH activity. Compared with the NC group, the Model group showed significantly reduced SDH activity in the liver tissue accompanied by downregulated mRNA and protein expression of SDHA and SDHB (Figure 4A-C). WYJD treatment reversed these changes by markedly enhancing SDH activity and upregulating SDHA/B expression. The effects of WYJD on SDH activity and expression were partially abrogated in the WYIN group.

Figure 4
Figure 4 Wenyang Jiedu Huayu Formula upregulates succinate dehydrogenase activity to clear succinate and inhibit hypoxia-inducible factor-1α expression. A: Succinate dehydrogenase enzyme activity in liver tissues measured by biochemical assay; B: Relative mRNA expression levels of Sdha and Sdhb in liver tissues determined by reverse transcription quantitative polymerase chain reaction; C: Western blot analysis of succinate dehydrogenase A and succinate dehydrogenase B protein expression in liver tissues; D: Relative mRNA expression level of Hif1a in liver tissues determined by reverse transcription quantitative polymerase chain reaction; E: Western blot analysis of hypoxia-inducible factor-1α protein expression in liver tissues. Data are presented as mean ± SD (n = 6 per group). aP < 0.05, bP < 0.01, and dP < 0.0001. NC: Normal control group; WYJD: Wenyang Jiedu Huayu Formula; WYIN: Wenyang Jiedu Huayu Formula plus dimethyl malonate; SDH: Succinate dehydrogenase; HIF-α: Hypoxia-inducible factor-α.

Examination of downstream HIF-1α expression revealed that both protein and mRNA levels were significantly upregulated in the Model group, suppressed by WYJD treatment, and this suppression was reversed in the WYIN group (Figure 4D). These results demonstrated that WYJD promoted succinate clearance by upregulating SDH activity and expression, thereby inhibiting HIF-1α stabilization and expression.

WYJD improves mitochondrial ultrastructure to promote energy metabolism recovery

Mitochondria are the primary sites of cellular aerobic respiration and energy conversion, and their structural integrity directly determines the functional efficiency of the TCA cycle and OXPHOS[21]. To validate the effect of WYJD on energy metabolism at the ultrastructural level, we examined mitochondrial morphology in hepatocytes using transmission electron microscopy. Hepatocytes in the NC group displayed normal mitochondrial morphology with distinct, dense cristae, and a uniform matrix. In contrast, mitochondria in the model group exhibited marked swelling, disrupted or absent cristae, and a vacuolated matrix, which are characteristic of severe mitochondrial dysfunction in ACLF. WYJD treatment attenuated mitochondrial swelling, partially restored the cristae structure, and increased matrix density. An improvement in mitochondrial function in the WYIN group was weaker than that in the WYJD group (Figure 5). These ultrastructural findings confirmed that WYJD improved mitochondrial morphology and function, an effect that is closely associated with SDH activity.

Figure 5
Figure 5 Wenyang Jiedu Huayu Formula improves mitochondrial ultrastructure in acute-on-chronic liver failure rats. A: Representative transmission electron microscopy images of mitochondria in hepatocytes from each group. Scale bars: 1 μm (× 12000) and 500 nm (× 30000). Green arrows: Normal mitochondria; orange arrows: Damaged mitochondria; yellow arrows: Mitophagic structures; B: Semi-quantitative assessment of mitochondrial damage using the Flameng scoring system. Data are presented as mean ± SD. dP < 0.0001. NC: Normal control group; WYJD: Wenyang Jiedu Huayu Formula; WYIN: Wenyang Jiedu Huayu Formula plus dimethyl malonate.
WYJD inhibits macrophage infiltration via regulation of succinate metabolism

Macrophages are key effector cells in the hepatic inflammatory response during ACLF[22]. To clarify the dynamic changes in macrophages in liver tissue, we employed dual immunofluorescence staining with CD68 and Ki67. The results showed that, compared with the NC group, the Model group exhibited a significant increase in CD68+ macrophages with diffuse infiltration in the liver, whereas Ki67-positive signals showed no significant differences between the two groups (Figure 6). These findings indicated that the increased number of hepatic macrophages under ACLF conditions primarily originated from the recruitment of circulating monocytes rather than the local proliferation of Kupffer cells. WYJD intervention markedly reduced CD68+ macrophage infiltration, an effect that was partially reversed in the WYIN group treated with the SDH inhibitor (Figure 5). These results demonstrated that WYJD effectively suppressed macrophage recruitment to the liver in the ACLF model, an action partly dependent on SDH activity.

Figure 6
Figure 6 Wenyang Jiedu Huayu Formula inhibits macrophage infiltration in the liver of acute-on-chronic liver failure rats. A: Representative immunofluorescence images of liver sections from the normal control, Model, Wenyang Jiedu Huayu Formula, and WYIN (Wenyang Jiedu Huayu Formula plus dimethyl malonate) groups stained for CD68 (green) and Ki67 (red). Nuclei were counterstained with DAPI (blue). Scale bar: 20 μm; B: Quantitative analysis of CD68+ area percentage and Ki67 labeling index. CD68+ area was calculated as the percentage of CD68-positive area relative to the total tissue area. The Ki67 labeling index was calculated as (Ki67 nuclei/DAPI total nuclei) × 100%. Data are presented as mean ± SD. bP < 0.01, dP < 0.0001. NC: Normal control group; WYJD: Wenyang Jiedu Huayu Formula; WYIN: Wenyang Jiedu Huayu Formula plus dimethyl malonate.
DISCUSSION

ACLF is associated with high short-term mortality due to immune-metabolic dysregulation[23]. Omics studies have revealed significant metabolic pathways remodeling and accumulation of key metabolites in patients with ACLF. These metabolic abnormalities directly modulate immune cell activation and inflammatory responses, creating a vicious cycle in which metabolic disorders and immune dysregulation reinforce each other[4,24]. Our previous clinical metabolomic analysis demonstrated that ACLF liver tissues exhibited characteristic metabolic reprogramming associated with aberrant hepatic macrophage activation[8]. The present study extends these findings by indicating that WYJD effectively eliminated abnormally accumulated succinate in the liver by upregulating SDH activity and expression. This is associated with suppression of HIF-1α stabilization and transcriptional activity, along with improvement in mitochondrial function, reversal of metabolic reprogramming, and attenuation of macrophage-mediated immune-inflammatory injury. These findings suggested a therapeutic mechanism for WYJD from a metabolic-immune perspective and provided experimental evidence supporting traditional Chinese medicine principles of resolving stasis, reinforcing deficiency, and promoting regeneration.

Recent studies have identified succinate, an intermediate metabolite of the TCA cycle, as an endogenous signaling molecule that accumulates under inflammatory conditions and directly participates in immune regulation[25,26]. In the ACLF model used in the present study, liver tissues exhibited significantly elevated succinate levels and reduced fumarate content, indicating SDH inhibition and the consequent blockade of succinate metabolism. Accumulated succinate promotes glycolysis and inflammation-related gene expression through HIF-1α stabilization and activates extracellular inflammatory signaling via the cell surface receptor SUCNR1[27-29]. This study systematically delineated a pathological cascade involving aberrant succinate metabolism, HIF-1α activation, pro-inflammatory cytokine release, and energy metabolic disturbances in an ACLF animal model. These findings advance our understanding of ACLF pathogenesis from inflammation to metabolic-immune dysregulation.

Given the pivotal role of succinate metabolism in ACLF progression, targeting this pathway can be a promising therapeutic strategy. SDH, the core catalytic enzyme involved in succinate metabolism, may serve as a key molecular target through which WYJD exerts its metabolic and immunomodulatory effects. SDH comprises four subunits, with the catalytic SDHA and SDHB forming a hydrophilic domain on the mitochondrial matrix responsible for succinate oxidation and electron transfer. The transmembrane subunits SDHC and SDHD anchor the complex to the inner mitochondrial membrane and connect it to the ETC[19]. This unique architecture positions SDH as the only enzyme complex that simultaneously participates in both the TCA cycle and the ETC. Its activity directly influences succinate flux, mitochondrial respiratory efficiency, and cellular energy homeostasis[19]. Moreover, the SDH function is closely linked to immune regulation. The deletion of SDHA or SDHB in macrophages suppresses mitochondrial respiration and reduces the production of the anti-inflammatory cytokine IL-10[30] highlighting the central role of SDH in metabolic-immune crosstalk.

The present study demonstrated that WYJD specifically upregulated the expression of the catalytic subunits SDHA and SDHB and enhanced SDH enzymatic activity. This promoted conversion of succinate to fumarate, reduced succinate accumulation at its source, restored TCA cycle flux, enhanced OXPHOS efficiency, and attenuated glycolytic compensation. Transmission electron microscopy showed improved mitochondrial ultrastructure following WYJD treatment, providing morphological evidence supporting these metabolic improvements. Pharmacological inhibition of SDH partially reversed these beneficial effects suggesting that SDH was a key mediator of WYJD activity.

This study demonstrated that the regulatory effects of WYJD on energy metabolism extended to remodeling of the hepatic immune microenvironment. HIF-1α, a key transcription factor downstream of succinate, regulates diverse cellular responses including glycolysis and inflammation[31]. WYJD significantly downregulated HIF-1α expression while reducing hepatic succinate levels, providing an upstream transcriptional mechanism for its anti-inflammatory effects. Our previous work demonstrated that WYJD inhibits glycolysis via HIF-1α downregulation, thereby promoting macrophage polarization from the pro-inflammatory M1 to the anti-inflammatory M2 phenotype. We further demonstrated that WYJD modulated not only macrophage polarization, but also macrophage recruitment to the liver. WYJD treatment significantly reduced CD68+ macrophage infiltration to the liver in ACLF, which was partially abrogated by SDH inhibition, linking macrophage dynamics to succinate metabolism.

Our previous clinicopathological analysis similarly showed a marked increase in CD68+ cells in liver tissues from patients with ACLF, without a corresponding increase in Ki67 staining, suggesting that accumulated hepatic macrophages are derived primarily from recruited circulating monocytes rather than from local Kupffer cell proliferation[8]. HIF-1α is known to directly upregulate chemokines such as vascular endothelial growth factor and chemokine ligand 12, and adhesion molecules, thereby promoting monocyte and macrophage recruitment[32,33]. Based on our findings WYJD modulated the SDH-succinate-HIF-1α signaling pathway, we proposed that WYJD inhibition of macrophage infiltration occurred via SDH activation, reduction of succinate accumulation, and suppression of HIF-1α transcriptional activity, leading to downregulation of local hepatic chemotactic signals and ultimately preventing pathological recruitment of circulating monocytes. Preliminary data on chemokine expression from our previous studies supports this hypothesis[8]. Thus, this study not only demonstrated the inhibitory effect of WYJD on macrophage infiltration in an ACLF animal model but also provided experimental evidence on its regulation of macrophages recruitment through metabolic-immune crosstalk.

This study had several limitations. A DMM-only control group was not included in this study. However, a recent study demonstrated that DMM at the same dose (160 mg/kg, intraperitoneally) showed no direct hepatotoxicity in vitro or in vivo[17]. Therefore, the partial reversal of the protective effects of WYJD in the WYIN group might not be attributable to the nonspecific toxicity of DMM, although off-target effects cannot be formally excluded. SDH and HIF-1α expression were assessed in whole liver homogenates, which do not discriminate between hepatocyte-specific and macrophage-specific contributions. Whether WYJD primarily targets the SDH in hepatocytes or infiltrating macrophages remains to be determined.

We did not directly assess HIF-1α nuclear translocation or measure its downstream target genes. However, a previous study demonstrated that reduction in HIF-α protein levels correlates with decreased HIF transcriptional activity, as measured by luciferase reporter assays and downstream target gene expression[34]. Therefore, a significant reduction in HIF-1α protein levels observed after WYJD treatment strongly suggests decreased HIF-1α transcriptional activity.

Furthermore, as a multicomponent herbal formula, the identification of the specific active constituents of WYJD responsible for SDH modulation requires further investigation. The chemokine repertoire downstream of HIF-1α and its functional role in monocyte recruitment during ACLF also remains to be fully characterized. Finally, the present findings were obtained in a rat model of ACLF. Although this model recapitulates key features of human ACLF, the translational relevance of targeting succinate metabolism in patients requires further validation using human liver samples, patient-derived organoids, or clinical cohort studies.

CONCLUSION

This study systematically elucidated the metabolic-immune regulatory mechanism by which WYJD ameliorated ACLF. By acting partly through SDH, clearing aberrantly accumulated succinate, and suppressing HIF-1α signaling, WYJD effectively corrected energy disturbances, thereby attenuating mitochondrial damage and macrophage-mediated inflammatory responses. These findings provided a mechanistic basis for the clinical application of WYJD and suggested a framework for developing metabolic node-targeted therapeutic strategies involving metabolic-immune crosstalk for liver failure.

References
1.  Sarin SK, Choudhury A, Kumar A, Mahmud N, Lee GH, Ning Q, Tan SS, Thanapirom K, Arora V, Nakayama N, Li J, Karvellas CJ. Acute-on-chronic liver failure: pathophysiological mechanisms and clinical management. Nat Rev Gastroenterol Hepatol. 2026;23:411-431.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 11]  [Article Influence: 11.0]  [Reference Citation Analysis (4)]
2.  Kulkarni AV, Sarin SK. Acute-on-chronic liver failure - steps towards harmonization of the definition! J Hepatol. 2024;81:360-366.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 33]  [Article Influence: 16.5]  [Reference Citation Analysis (0)]
3.  Luo J, Li J, Li P, Liang X, Hassan HM, Moreau R, Li J. Acute-on-chronic liver failure: far to go-a review. Crit Care. 2023;27:259.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 41]  [Article Influence: 13.7]  [Reference Citation Analysis (0)]
4.  Li P, Liang X, Luo J, Li J. Omics in acute-on-chronic liver failure. Liver Int. 2025;45:e15634.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 12]  [Article Influence: 12.0]  [Reference Citation Analysis (0)]
5.  Li J, Liang X, Jiang J, Yang L, Xin J, Shi D, Lu Y, Li J, Ren K, Hassan HM, Zhang J, Chen P, Yao H, Li J, Wu T, Jin L, Ye P, Li T, Zhang H, Sun S, Guo B, Zhou X, Cai Q, Chen J, Xu X, Huang J, Hao S, He J, Xin S, Wang D, Trebicka J, Chen X, Li J; Chinese Group on the Study of Severe Hepatitis B (COSSH). PBMC transcriptomics identifies immune-metabolism disorder during the development of HBV-ACLF. Gut. 2022;71:163-175.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 110]  [Cited by in RCA: 116]  [Article Influence: 29.0]  [Reference Citation Analysis (0)]
6.  Moreau R, Clària J, Aguilar F, Fenaille F, Lozano JJ, Junot C, Colsch B, Caraceni P, Trebicka J, Pavesi M, Alessandria C, Nevens F, Saliba F, Welzel TM, Albillos A, Gustot T, Fernández J, Moreno C, Baldassarre M, Zaccherini G, Piano S, Montagnese S, Vargas V, Genescà J, Solà E, Bernal W, Butin N, Hautbergue T, Cholet S, Castelli F, Jansen C, Steib C, Campion D, Mookerjee R, Rodríguez-Gandía M, Soriano G, Durand F, Benten D, Bañares R, Stauber RE, Gronbaek H, Coenraad MJ, Ginès P, Gerbes A, Jalan R, Bernardi M, Arroyo V, Angeli P; CANONIC Study Investigators of the EASL Clif Consortium;  Grifols Chair;  European Foundation for the Study of Chronic Liver Failure (EF Clif). Blood metabolomics uncovers inflammation-associated mitochondrial dysfunction as a potential mechanism underlying ACLF. J Hepatol. 2020;72:688-701.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 302]  [Cited by in RCA: 287]  [Article Influence: 47.8]  [Reference Citation Analysis (2)]
7.  Zhang IW, Curto A, López-Vicario C, Casulleras M, Duran-Güell M, Flores-Costa R, Colsch B, Aguilar F, Aransay AM, Lozano JJ, Hernández-Tejero M, Toapanta D, Fernández J, Arroyo V, Clària J. Mitochondrial dysfunction governs immunometabolism in leukocytes of patients with acute-on-chronic liver failure. J Hepatol. 2022;76:93-106.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 99]  [Cited by in RCA: 96]  [Article Influence: 24.0]  [Reference Citation Analysis (0)]
8.  Zhang Y, Tian XL, Li JQ, Wu DS, Li Q, Chen B. Mitochondrial dysfunction affects hepatic immune and metabolic remodeling in patients with hepatitis B virus-related acute-on-chronic liver failure. World J Gastroenterol. 2024;30:881-900.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 1]  [Cited by in RCA: 11]  [Article Influence: 5.5]  [Reference Citation Analysis (1)]
9.  Zhang W, Lang R. Succinate metabolism: a promising therapeutic target for inflammation, ischemia/reperfusion injury and cancer. Front Cell Dev Biol. 2023;11:1266973.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 56]  [Article Influence: 18.7]  [Reference Citation Analysis (0)]
10.  Chen H, Jin C, Xie L, Wu J. Succinate as a signaling molecule in the mediation of liver diseases. Biochim Biophys Acta Mol Basis Dis. 2024;1870:166935.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 21]  [Cited by in RCA: 21]  [Article Influence: 10.5]  [Reference Citation Analysis (0)]
11.  Tannahill GM, Curtis AM, Adamik J, Palsson-McDermott EM, McGettrick AF, Goel G, Frezza C, Bernard NJ, Kelly B, Foley NH, Zheng L, Gardet A, Tong Z, Jany SS, Corr SC, Haneklaus M, Caffrey BE, Pierce K, Walmsley S, Beasley FC, Cummins E, Nizet V, Whyte M, Taylor CT, Lin H, Masters SL, Gottlieb E, Kelly VP, Clish C, Auron PE, Xavier RJ, O'Neill LA. Succinate is an inflammatory signal that induces IL-1β through HIF-1α. Nature. 2013;496:238-242.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3601]  [Cited by in RCA: 3456]  [Article Influence: 265.8]  [Reference Citation Analysis (6)]
12.  Sang PM, Dahubayar, Wang LS, Zhang SM, Ye ZW, Liu JF, Chen B. [Survival analysis of patients with hepatitis B-related acute-on-chronic liver failure treated with syndrome differentiation of Yang jaundice-Yin-Yang jaundice-Yin jaundice combined with western medicine]. Zhongyi Zazhi. 2019;60:582-586..  [PubMed]  [DOI]  [Full Text]
13.  Wang XB, Wang XJ. [Clinical practice guideline for traditional Chinese medicine in the diagnosis and treatment of acute-on-chronic liver failure]. Linchuang Gandan Zazhi. 2019;35:494-503.  [PubMed]  [DOI]  [Full Text]
14.  Tan N, Jian G, Peng J, Tian X, Chen B. Chishao - Fuzi herbal pair restore the macrophage M1/M2 balance in acute-on-chronic liver failure. J Ethnopharmacol. 2024;328:118010.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 11]  [Reference Citation Analysis (0)]
15.  Zhang Y, Tian XL, Fu Q, Du S, Peng J, Chen B. [Mechanism of Chishao-Fuzi in regulating HIF-1α-mediated glycolysis to intervene immune injury in rats with acute-on-chronic liver failure based on the theory of ‘clearing and warming concurrently’]. Shanghai Zhongyiyao Zazhi. 2025;59:85-93.  [PubMed]  [DOI]  [Full Text]
16.  Huang Y, Zhang T, Ding L, Sun KW. [Effect of medicated plasma containing Wenyang Jiedu Huayu Formula on hepatocyte injury based on PINK1/Parkin pathway]. Hunan Zhongyiyao Daxue Xuebao. 2025;45:845-855.  [PubMed]  [DOI]  [Full Text]
17.  Zhao L, Li T, Dang M, Li Y, Lu J, Lu Z, Chen Z, Huang Q, Chen Y, Yang Y, Feng Y, Wang X, Jian Y, Wang H, Guo Y, Zhang L, Jiang Y, Fan S, Wu S, Fan H, Kuang F, Zhang G. Succinate Dehydrogenase Subunit A (SDHA) Mediated Microglia Extracellular Traps Formation Participating in Cerebral Ischemic Reperfusion Injury. Adv Sci (Weinh). 2025;12:e11873.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 6]  [Reference Citation Analysis (0)]
18.  Xiang C, Yu S, Ren Q, Jiang B, Li J, Zhang D, Wei Y. Metabolomics analysis in rat hearts with ischemia/reperfusion injury after diazoxide postconditioning. Front Mol Biosci. 2023;10:1196894.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
19.  Cao K, Xu J, Cao W, Wang X, Lv W, Zeng M, Zou X, Liu J, Feng Z. Assembly of mitochondrial succinate dehydrogenase in human health and disease. Free Radic Biol Med. 2023;207:247-259.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 44]  [Reference Citation Analysis (3)]
20.  Dalla Pozza E, Dando I, Pacchiana R, Liboi E, Scupoli MT, Donadelli M, Palmieri M. Regulation of succinate dehydrogenase and role of succinate in cancer. Semin Cell Dev Biol. 2020;98:4-14.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 63]  [Cited by in RCA: 165]  [Article Influence: 23.6]  [Reference Citation Analysis (0)]
21.  Ji W, Tang X, Du W, Lu Y, Wang N, Wu Q, Wei W, Liu J, Yu H, Ma B, Li L, Huang W. Optical/electrochemical methods for detecting mitochondrial energy metabolism. Chem Soc Rev. 2022;51:71-127.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 10]  [Cited by in RCA: 64]  [Article Influence: 12.8]  [Reference Citation Analysis (4)]
22.  Zhang Y, Wu D, Tian X, Chen B. From hepatitis B virus infection to acute-on-chronic liver failure: The dynamic role of hepatic macrophages. Scand J Immunol. 2024;99:e13349.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 8]  [Reference Citation Analysis (0)]
23.  Liang X, Li P, Jiang J, Xin J, Luo J, Li J, Chen P, Ren K, Zhou Q, Guo B, Zhou X, Chen J, He L, Yang H, Hu W, Ma S, Li B, Chen X, Shi D, Li J; Chinese Group on the Study of Severe Hepatitis B (COSSH). Transcriptomics unveils immune metabolic disruption and a novel biomarker of mortality in patients with HBV-related acute-on-chronic liver failure. JHEP Rep. 2023;5:100848.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 10]  [Reference Citation Analysis (0)]
24.  Zhang D, Shi C, Wang Y, Guo J, Gong Z. Metabolic Dysregulation and Metabolite Imbalances in Acute-on-chronic Liver Failure: Impact on Immune Status. J Clin Transl Hepatol. 2024;12:865-877.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 7]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
25.  Zeng J, Liu J, Zhao N, Wong IN, Huang R. Caulerpa chemnitzia polysaccharide exerts immunomodulatory activity in macrophages by mediating the succinate/PHD2/HIF-1α/IL-1β pathway. Int J Biol Macromol. 2024;277:134450.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 9]  [Reference Citation Analysis (0)]
26.  Huang H, Li G, He Y, Chen J, Yan J, Zhang Q, Li L, Cai X. Cellular succinate metabolism and signaling in inflammation: implications for therapeutic intervention. Front Immunol. 2024;15:1404441.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 123]  [Cited by in RCA: 99]  [Article Influence: 49.5]  [Reference Citation Analysis (2)]
27.  Atallah R, Gindlhuber J, Heinemann A. Succinate in innate immunity: linking metabolic reprogramming to immune modulation. Front Immunol. 2025;16:1661948.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 18]  [Reference Citation Analysis (0)]
28.  Winther S, Trauelsen M, Schwartz TW. Protective succinate-SUCNR1 metabolic stress signaling gone bad. Cell Metab. 2021;33:1276-1278.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 14]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
29.  Fernández-Veledo S, Ceperuelo-Mallafré V, Vendrell J. Rethinking succinate: an unexpected hormone-like metabolite in energy homeostasis. Trends Endocrinol Metab. 2021;32:680-692.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 85]  [Article Influence: 17.0]  [Reference Citation Analysis (0)]
30.  Gobelli D, Serrano-Lorenzo P, Esteban-Amo MJ, Serna J, Pérez-García MT, Orduña A, Jourdain AA, Martín-Casanueva MÁ, Á de la Fuente M, Simarro M. The mitochondrial succinate dehydrogenase complex controls the STAT3-IL-10 pathway in inflammatory macrophages. iScience. 2023;26:107473.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 46]  [Reference Citation Analysis (0)]
31.  Rahman MA, Rahaman KA, Harrath AH, Al-Zharani M, Jalouli M. Hypoxia-inducible factor-1α in cardiovascular disease, mechanistic insights, pathophysiological roles, and therapeutic targeting strategies. Biochem Pharmacol. 2026;246:117753.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 4]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
32.  Lia A, Annese T, Fornaro M, Giannini M, D'Abbicco D, Errede M, Lorusso L, Amati A, Tampoia M, Trojano M, Virgintino D, Ribatti D, Serlenga L, Iannone F, Girolamo F. Perivascular and endomysial macrophages expressing VEGF and CXCL12 promote angiogenesis in anti-HMGCR immune-mediated necrotizing myopathy. Rheumatology (Oxford). 2022;61:3448-3460.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 18]  [Reference Citation Analysis (0)]
33.  Strickland J, Garrison D, Copple BL. Hypoxia upregulates Cxcl12 in hepatocytes by a complex mechanism involving hypoxia-inducible factors and transforming growth factor-β. Cytokine. 2020;127:154986.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 23]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
34.  Gkotinakou IM, Kechagia E, Pazaitou-Panayiotou K, Mylonis I, Liakos P, Tsakalof A. Calcitriol Suppresses HIF-1 and HIF-2 Transcriptional Activity by Reducing HIF-1/2α Protein Levels via a VDR-Independent Mechanism. Cells. 2020;9:2440.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 12]  [Cited by in RCA: 24]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade B, Grade B

Novelty: Grade A, Grade A

Creativity or innovation: Grade A, Grade B

Scientific significance: Grade B, Grade B

P-Reviewer: Cao Y, Associate Professor, China; Lai SJ, Assistant Professor, China S-Editor: Wu S L-Editor: A P-Editor: Wang CH

Write to the Help Desk