Effects of Kalanchoe pinnata, exercise, and stimulation on neuroinflammation, redox homeostasis, and neuropathic pain in a Wistar-rat model

Abstract

BACKGROUND

Neuropathic pain is a persistent, treatment-resistant condition driven not only by peripheral nerve injury but also by maladaptive neuroplasticity in central pain-regulatory networks. Evidence increasingly points to dysfunction in the prefrontal cortex (PFC), a vital area for top-down control of pain, emotions, and autonomic functions, as a key factor in maintaining pain hypersensitivity.

AIM

To examine the combined effects of Kalanchoe pinnata (KP), treadmill exercise, and vagus nerve stimulation (VNS) on neuroinflammation, redox homeostasis, and neuropathic pain in a rat model.

METHODS

Neuropathic pain was induced via partial sciatic nerve ligation. KP was administered orally at an effective dose of 100 mg/kg. Rats were assigned to 7 groups: (1) Sham; (2) Partial sciatic nerve ligation-neuropathic pain-induced; (3) Gabapentin; (4) KP alone; (5) KP + exercise; (6) KP + VNS; and (7) KP + exercise + VNS. Pain behaviors were assessed using mechanical allodynia and thermal hyperalgesia tests. Biochemical analysis of the PFC measured oxidative stress markers, pro-inflammatory cytokines [nuclear factor-kappa B, tumor necrosis factor alpha, interleukin (IL)-1β, IL-6], anti-inflammatory cytokine (IL-10), nitric oxide, monoaminergic and cholinergic biomarkers. Molecular analysis measured nuclear factor erythroid 2-related factor 2, heme-oxygenase 1, Kelch-like ECH-associated protein 1, B-cell lymphoma 2 associated X-protein, B-cell lymphoma 2, caspase-3, brain-derived neurotrophic factor, and cAMP response element-binding protein in the PFC.

RESULTS

Results showed that treatments significantly (P < 0.05) reduced pain behaviors compared to untreated controls. Treatments also significantly (P < 0.05) decreased lipid peroxidation, lowered pro-inflammatory cytokine levels, increased antioxidant activity, and restored the balance between neuronal and apoptotic processes. The combination therapies produced greater biochemical normalization than KP monotherapy, suggesting enhanced therapeutic responses through multimodal intervention. The triple treatment produced the most notable effects, significantly normalizing multiple inflammatory and redox parameters.

CONCLUSION

KP alleviated neuropathic pain, and the enhancement with exercise and VNS highlights the potential of multimodal strategies targeting cortical pain-control networks. This therapeutic approach demonstrates potential as a multimodal preclinical strategy for neuropathic pain management and warrants further investigation.

Key Words: Neuropathic pain; Prefrontal cortex; Kalanchoe pinnata; Treadmill exercise; Vagus nerve stimulation

Core Tip: Neuropathic pain is a persistent, treatment-resistant condition driven not only by peripheral nerve injury but also by maladaptive neuroplasticity in central pain-regulatory networks. Evidence increasingly points to dysfunction in the prefrontal cortex, a vital area for top-down control of pain, emotions, and autonomic functions, as a key factor in maintaining pain hypersensitivity. This study examined the combined effects of Kalanchoe pinnata, treadmill exercise, and vagus nerve stimulation on neuroinflammation, redox homeostasis, and neuropathic pain in a rat model. This study shows that combining Kalanchoe pinnata, treadmill exercise, and vagus nerve stimulation offers better relief for neuropathic pain than any single treatment or drug. This triple therapy activates the nuclear factor erythroid 2-related factor 2/heme-oxygenase 1 pathway, reduces neuroinflammation, restores neuroplasticity, decreases cell death, and normalizes neurotransmission by correcting molecular imbalances in the prefrontal cortex.

INTRODUCTION

Neuropathic pain is a long-lasting and debilitating neurological disorder caused by injury or dysfunction of the somatosensory nervous system, marked by ongoing pain hypersensitivity, mechanical allodynia, thermal hyperalgesia, and spontaneous pain. Unlike acute nociceptive pain, neuropathic pain often persists well after the initial injury has healed, due to significant maladaptive changes in both peripheral and central nervous system circuits[1]. Recent evidence suggests that neuropathic pain is not just due to abnormal peripheral nerve signaling. Still, it involves a complex neurobiological condition driven by ongoing neuroinflammation, oxidative stress, mitochondrial issues, an imbalance of excitatory and inhibitory neurotransmitters, impaired neuroplasticity, and neuronal cell death[2]. These pathological processes interact in a self-reinforcing cycle, leading to continuous sensitization of pain pathways and the progression from acute injury to chronic pain[3]. The diverse nature of neuropathic pain makes it a difficult condition to treat and highlights the importance of finding therapies that can target multiple interconnected mechanisms at once.

Central nervous system dysfunction significantly contributes to the development and worsening of neuropathic pain. Although spinal sensitization has long been the focus, increasing attention is now directed toward supraspinal structures that influence sensory, emotional, cognitive, and autonomic aspects of pain. The prefrontal cortex (PFC), in particular, has been recognized as a key hub in the top-down regulation of pain signals. It integrates sensory input with emotional and cognitive responses and controls descending pathways that modulate pain[4]. Chronic neuropathic pain leads to notable biochemical and molecular changes in the PFC, such as elevated reactive oxygen and nitrogen species, activation of inflammatory pathways, disruption of monoaminergic and cholinergic neurotransmission, reduced neurotrophic support, and increased neuronal vulnerability[5-7]. These changes impair cortical function and help sustain pain sensitivity, emotional issues, and cognitive deficits often seen in neuropathic conditions.

Neuroinflammation and oxidative stress are increasingly seen as key factors in neuropathic pain development. When peripheral nerves are injured, a series of inflammatory responses is triggered, including activation of immune cells, infiltration of inflammatory mediators from the periphery, and continuous release of cytokines and chemokines in the central and peripheral nervous systems[8]. At the same time, excess reactive oxygen species (ROS) are produced, overwhelming the body’s antioxidant defenses and resulting in lipid peroxidation, protein oxidation, mitochondrial problems, and DNA damage[9]. The close link between inflammation and oxidative stress worsens neuronal dysfunction and activates pathways that promote cell death, further damaging nerves. Additionally, disruption of transcription regulators that control antioxidant responses and cell survival maintains a harmful neurochemical environment[10]. Therefore, treatments that restore redox balance and reduce neuroinflammation may effectively slow neuropathic pain and promote recovery.

Natural products and non-drug therapies are increasingly recognized as valuable complementary treatments because they can act on multiple disease-related pathways at once. Kalanchoe pinnata (KP) is a medicinal plant rich in bioactive compounds with antioxidant, anti-inflammatory, neuroprotective, and cell-protective properties[11,12]. By modulating oxidative and inflammatory signaling, KP shows promise in reducing neuronal damage and maintaining cellular balance during disease. Similarly, aerobic exercise provides extensive neuroprotective benefits by boosting antioxidant defenses, enhancing mitochondrial function, promoting vascular adaptation in the brain, and activating neurotrophic pathways that support neuronal survival and synaptic plasticity[13,14]. Changes in neurotransmitter activity and inflammation caused by exercise further underline its potential to treat chronic neurological conditions. Meanwhile, vagus nerve stimulation (VNS) has become a significant neuromodulation technique capable of affecting inflammation in both the brain and body through the cholinergic anti-inflammatory reflex[15]. Beyond its immune effects, VNS promotes neuroplasticity, enhances neuronal resilience, and improves communication within neural circuits involved in pain control[16].

While the therapeutic effects of KP, treadmill exercise (TE), and VNS have been studied separately, their combined impact on the molecular and behavioral changes associated with neuropathic pain remains poorly understood. These treatments target distinct yet complementary pathways implicated in chronic pain, including oxidative stress, neuroinflammation, neurotransmitter imbalance, impaired neuroplasticity, and cell death signaling. This mechanistic complementarity suggests that combined therapy could yield enhanced neuroprotective and pain-relief benefits that exceed those of individual approaches. In this study, we examined how KP, TE, and VNS, alone and combined, affect pain behaviors and key molecular pathways in the PFC of rats with partial sciatic nerve ligation (PSNL).

MATERIALS AND METHODS

Chemicals and reagents

Reagents and chemicals were of analytical grade and were all obtained from reputable suppliers. Gabapentin, thiobarbituric acid, trichloroacetic acid, standards of reduced glutathione, hydrogen peroxide, epinephrine, and other chemicals used in this study were obtained from Sigma-Aldrich (St. Louis, MO, United States). Distilled water was used throughout the experiments.

Animal handling and ethical approval

All animal procedures followed the United States NIH Guidelines for the Care and Use of Laboratory Animals. Ethical approval (No. FUTA/ETH/25/471) was granted by the Animal Ethics Committee at the Center for Research and Development, Federal University of Technology, Akure (FUTA). Forty-two adult male Wistar rats (Rattus norvegicus), averaging 220 ± 12 g, were housed in a controlled environment (25-27 °C, 60%-70% humidity, 12-hour light/dark cycle) with unlimited access to water and food. They were acclimatized for two weeks before the experiment.

Induction of PSNL

Neuropathic pain was triggered using the PSNL model described by Seltzer et al[17] and Riego et al[18], a well-established method for replicating the behavioral and neurochemical aspects of human neuropathic pain. Adult male Wistar rats (210-240 g) were anesthetized with ketamine (80 mg/kg, i.p.) and xylazine (10 mg/kg, i.p.) and placed on a temperature-controlled surgical platform to maintain body temperature. After disinfecting the surgical area, a longitudinal incision was made on the right mid-thigh’s lateral side, and the underlying muscles (biceps femoris and gluteus superficialis) were carefully separated to reveal the sciatic nerve. Under a microscope, about one-third to one-half of the dorsal sciatic nerve was tightly ligated with an 8-0 sterile silk suture, avoiding complete nerve interruption or excessive traction. The muscles were then repositioned and sutured with absorbable 4-0 Vicryl, and the skin was closed with non-absorbable 4-0 silk. Sham-operated animals underwent the same procedure, except without nerve ligation. After surgery, animals recovered in warmed cages and were monitored daily for distress, infection, or motor issues.

Experimental procedure

After acclimatization, the rats were divided randomly into seven (7) groups of six (6) animals each: (1) Sham: Sham rats (normal control); (2) PSNL: PSNL induced rats; (3) PSNL + Gaba: Gabapentin-treated PSNL-induced rats; (4) PSNL + KP: 100 mg/kg body weight KP – treated PSNL-induced rats; (5) PSNL + KP + VNS: KP and VNS – treated PSNL-induced rats; (6) PSNL + KP + TE: KP and TE – treated PSNL-induced rats; and (7) PSNL + KP + TE + VNS: KP, TE, and VNS – treated PSNL-induced rats.

All animals administered KP extract received the same aqueous vehicle under consistent handling conditions. Although there was no separate control group for vehicle gavage, the extract was prepared with distilled water and no active solvents. Gavage-related stress was considered minimal since all animals experienced similar handling throughout the study. Behavioral assessments were carried out over time at specific postoperative intervals, while biochemical and molecular analyses took place at the end of the treatment. This approach allowed for the evaluation of functional progression and ultimate molecular responses but did not permit direct observation of molecular changes over time.

Sample collection and preparation

Fresh leaves of KP were collected from the botanical garden of the Federal University of Technology, Akure, and authenticated. The leaves were dried and blended with a blender (Warring, Model 37BL18; 24ØCB6) into a fine powder. The powdered leaves were soaked in water at 37 °C for 24 hours. The obtained mixture was filtered, centrifuged, freeze-dried, and reconstituted to a concentration of 100 mg/kg body weight, as previously reported by Adebayo et al[19] and Boatemaa et al[20].

Non-invasive VNS

Non-invasive VNS was delivered using a gammaCore^® stimulator with two 6-mm electrodes spaced 6 mm apart. It delivers controlled sine-wave bursts to activate the vagus nerve transcutaneously. Animals were restrained, and the fur over the right cervical area was shaved to reduce impedance. Conductive gel ensured contact. Electrodes were placed over the right cervical vagus nerve along the sternocleidomastoid. Brief inhalation anesthesia (2% isoflurane) was used during electrode placement; subsequent stimulations were performed in awake animals. Stimulation involved 1 millisecond bursts of 5 kHz sine-wave pulses at 25 Hz, around 7.7 V, with 2-minute trains every 10 minutes for 30 minutes daily over four weeks. Controls had sham stimulation over the quadriceps. Stimulation timing was consistent, impedance was checked, and animals were monitored to minimize variables and anesthesia effects[21,22]. The stimulation parameters were chosen based on established experimental tVNS protocols targeting the auricular branch of the vagus nerve. However, because this study lacked direct physiological confirmation of vagal engagement, the stimulation should be viewed as an intervention aimed at enhancing vagal pathways rather than a definitive measure of vagal nerve activation.

TE

The exercise setup utilizes a SixBros^® Electric Treadmill (JDB 1370, 6.0 HP, 12 km/hour, United Kingdom) with modifications. An acrylic box with eight compartments was added to enable rats to run and was sealed with a lid to prevent escape. Copper wires bent into hooks lined the box and functioned as panel terminals, making contact with the rats’ bare rear ends to deliver a safe electric shock (132 V, 1.2 mA). This mild shock acts as a motivational stimulus to prevent rats from lagging during exercise. Importantly, electrical stimulation was used solely to encourage treadmill compliance and remained within tolerable levels[23]. Groups PSNL + KP + TE and PSNL + KP + TE + VNS were first acclimated to treadmill running at 0.5 m/second for 10 minutes daily over a week, and they continued this daily exercise throughout the study.

Behavioral tests

Mechanical allodynia was assessed with the von Frey filament test, following a modified procedure of Riego et al[18] and Möller et al[24]. Each rat was placed in a transparent acrylic chamber on an elevated wire mesh and allowed to acclimate for 15-20 minutes before testing. Calibrated von Frey filaments of increasing force were applied perpendicularly to the plantar surface of the ipsilateral hind paw until the filament slightly bent. A quick paw withdrawal, shaking, or licking was considered a positive response. The paw withdrawal threshold was calculated using the up-down method and expressed in g. Three measurements were taken at 5-minute intervals, and the average was recorded for each animal.

Thermal hyperalgesia was evaluated with the Hargreaves plantar test, following a modified procedure of Hargreaves et al[25] and Deuis and Vetter[26]. Animals were individually placed in transparent chambers on a glass surface and given time to acclimate before testing. A focused beam of radiant heat was directed onto the plantar surface of their hind paw, and the paw withdrawal latency was automatically recorded when the animal withdrew its paw. To avoid tissue damage, a maximum cut-off time of 20 seconds was set. Each animal performed three trials with at least 5-minute intervals between trials, and the average latency was reported in seconds.

The acetone drop test was used to assess cold allodynia, following a modified procedure of Ruan et al[27]. After acclimating in individual testing chambers, about 50 μL of acetone was gently placed on the hind paw’s plantar surface using a blunt-tipped syringe, avoiding direct skin contact. Immediate paw withdrawal, flicking, shaking, or licking behaviors after applying acetone indicated positive nociceptive responses. Each paw underwent five trials with at least 5 minutes between them, and the number of positive responses was recorded as the withdrawal frequency.

All behavioral assessments were conducted at baseline (day 0, before ligation) and on postoperative days 7, 14, and 21 by investigators blinded to treatment groups.

Tissue processing

Twenty-four hours after the behavioral test, the animals were sacrificed, and the PFC was extracted for further analysis[28].

Gene expression analysis via reverse transcription-quantitative polymerase chain reaction

Total RNA was extracted from rat PFC samples using Trizol^®. RNA concentration was measured with a NanoDrop 2000TM, visualized on a 1.5% agarose gel, and treated with DNase I (Invitrogen). Then, 1 μg of cDNA was synthesized using the iScriptTM kit. Expression analysis used the reference gene β-actin. Reverse transcription-quantitative polymerase chain reaction analyses were performed to evaluate transcriptional changes in target genes (Table 1); however, these measurements do not directly reflect protein abundance or functional pathway activation. Therefore, molecular interpretations were based on gene expression changes and should be considered within this context. Reactions involved 40 cycles: 15 seconds at 94 °C, 10 seconds at 60 °C, 30 seconds at 72 °C, in 20 μL with 2.5 ng/μL cDNA, PCR buffer, primers, dNTPs, MgCl2, SYBR^® Green, and Platinum Taq. Dissociation curves confirmed specific amplification: (1) 94 °C for 10 seconds; (2) 55 °C for 1 minute; and (3) 94 °C for 15 seconds. StepOne^™ software analyzed SYBR Green fluorescence. Reactions were triplicated in 3-6 experiments. Gene expression was calculated by 2^-ΔCT as reported by Akerele et al[29].

Table 1 Reverse transcription-quantitative polymerase chain reaction primer sequence.

Gene	Ascension number	Sequence
β-actin	NM_031144.3	Forward: TCTTCCAGCCTTCCTTCCTG
		Reverse: CACACAGAGTACTTGCGCTC
Nrf2	NM_001399173.1	Forward: TGTCAGCTACTCCCAGGTTG
		Reverse: ATCAGGGGTGGTGAAGACTG
HO-1	NM_012580.2	Forward: TTCAGAAGGGTCAGGTGTCC
		Reverse: CTGTGTGGCTGGTGTGTAAG
Keap1	NM_057152.2	Forward: TTCGTAGCCTCCATGAAGCA
		Reverse: GATGTCAAGCGGGTCACTTC
Bax	NM_017059.2	Forward: TGGCCTCCTTTCCTACTTCG
		Reverse: AAAATGCCTTTCCCCGTTCC
Bcl-2	AJ495801.1	Forward: ACCTCCTCCCGACCTATGAT
		Reverse: TTACTACAACCACCCACCCC
Caspase-3	NM_001436899.1	Forward: CATGCACATCCTCACTCGTG
		Reverse: CCCACTCCCAGTCATTCCTT
BDNF	D10938.1	Forward: TCTCTGCTTCCTTCCCACAG
		Reverse: GTGCTCAAAAGTGTCAGCCA
CREB	AH007348.2	Forward: AGTGACGGAGGAGCTTGTAC
		Reverse: TCCGCCGCCATTATTCTTTG

Nrf2: Nuclear factor erythroid 2-related factor 2; HO-1: Heme-oxygenase 1; Keap1: Kelch-like ECH-associated protein 1; Bax: B-cell lymphoma 2 associated X-protein; Bcl-2: B-cell lymphoma 2; BDNF: Brain-derived neurotrophic factor; CREB: CAMP response element-binding protein.

Biochemical analysis

Monoamine oxidase (MAO) activity was determined using 0.0125 mol/L semicarbazide, 0.025 mol/L phosphate buffer (pH 7.0), 10 mmol/L benzylamine, acetic acid, 0.1 N NaOH, 2,4-dinitrophenylhydrazine, and benzene, with readings at 450 nm[30]. Dopamine levels were measured, and absorbance was recorded at 735 nm against a reagent blank, and dopamine concentrations were calculated using a calibration curve prepared with dopamine hydrochloride[31]. ROS levels were estimated using ferrous sulfate (4.37 μM) in 0.1 M sodium acetate (pH 4.8) and N, N-diethyl-para-phenylenediamine (6 mg/mL), with hydrogen peroxide production measured at 505 nm[32]. Acetylcholinesterase (AChE) activity was assessed via the Ellman colorimetric method, monitoring absorbance at 412 nm over time, with activity expressed as μmol of substrate hydrolyzed per hour per mg of protein[33]. Nitric oxide (NO) levels were estimated using Griess reagent[34]. Concentrations of tumor necrosis factor-alpha (TNF-α), nuclear factor-kappa B (NF-κB), interleukin (IL)-1β, IL-10, and lactate dehydrogenase (LDH) were measured using commercial ELISA kits according to the manufacturer’s instructions, and data were normalized to protein content[35].

Statistical analysis

The normality of the data distribution was assessed using the Shapiro-Wilk test. The sample size was determined via power analysis[36]. Each data point corresponds to a replicate of six. Results are shown as mean ± SEM (n = 6). Differences among experimental groups were analyzed with one-way analysis of variance (ANOVA). When significant group effects were detected, Tukey’s honestly significant difference post hoc test was used for multiple pairwise comparisons to control the family-wise error rate. No uncorrected multiple pairwise t-tests were performed. Statistical significance was set at P < 0.05. All analyses were conducted using GraphPad Prism version 8.0.2. Additionally, effect size analyses were conducted to quantify the magnitude of treatment effects. Pairwise mean differences, corresponding 95%CIs, and Cohen’s d effect sizes were calculated for relevant comparisons and are presented in Supplementary Table 1. The overall magnitude of treatment effects across experimental groups was further assessed using one-way ANOVA effect size estimation (partial η²), with results provided in Supplementary Table 2. These complementary measures were used to facilitate interpretation of biological relevance beyond statistical significance alone.

RESULTS

Behavioral assessments confirmed the development of neuropathic pain after PSNL, marked by increasing mechanical allodynia, thermal hyperalgesia, and cold allodynia (Figure 1). No notable differences were seen among groups at baseline (day 0) (P > 0.05), indicating similar pre-surgical nociceptive responses. From day 3 onward, PSNL animals showed significant decreases in paw withdrawal threshold and latency, along with an increased frequency of cold allodynia compared to Sham rats (P < 0.05). These changes persisted throughout the study, confirming sustained neuropathic pain. Gabapentin treatment significantly reduced these behavioral deficits, which may be related to higher mechanical thresholds, longer thermal latencies, and lower cold allodynia than untreated PSNL rats (P < 0.05). KP also significantly improved all behavioral measures, outperforming gabapentin in restoring nociceptive thresholds (P < 0.05). To supplement statistical significance testing, we calculated effect size estimates, mean differences, confidence intervals, and ANOVA-based effect size measures to offer further insights into the magnitude and biological importance of the treatment effects. These results are summarized in Supplementary Tables 1 and 2.

Figure 1 The effects of Kalanchoe pinnata, vagus nerve stimulation, and treadmill exercise on behavioral tests: Mechanical allodynia, thermal hyperalgesia, and cold allodynia, after partial sciatic nerve ligation. A: Mechanical allodynia; B: Thermal hyperalgesia; C: Cold allodynia. Data are presented as mean ± SEM. Statistical significance was assessed using one-way analysis of variance followed by Tukey’s honestly significant difference multiple comparison test. Effect sizes and confidence intervals were calculated to complement P value interpretation (Supplementary Table 1). Sham: Normal control; PSNL: Partial sciatic nerve ligation; KP: Kalanchoe pinnata; TE: Treadmill exercise; VNS: Vagus nerve stimulation; Gaba: Gabapentin.

The PSNL significantly reduced nuclear factor erythroid 2-related factor 2 (Nrf2) mRNA expression compared with the Sham group (P < 0.05), indicating suppression of endogenous antioxidant defenses (Figure 2A). Treatment with gabapentin and KP significantly increased Nrf2 expression relative to the untreated PSNL group (P < 0.05), although levels remained lower than in Sham. Combined interventions with KP and VNS, or with TE, produced further elevations (P < 0.05 vs PSNL and PSNL + KP). At the same time, the PSNL + KP + TE + VNS group exhibited the highest Nrf2 expression among treatment groups, significantly exceeding all other PSNL-treated groups (P < 0.05).

Figure 2 The effects of Kalanchoe pinnata, vagus nerve stimulation, and treadmill exercise on prefrontal cortex related mRNA expression after partial sciatic nerve ligation. A: Nuclear factor erythroid 2-related factor 2 mRNA; B: Heme-oxygenase 1 mRNA; C: Kelch-like ECH-associated protein 1 mRNA; D: B-cell lymphoma 2 associated X-protein mRNA; E: B-cell lymphoma 2 mRNA; F: Caspase-3 mRNA; G: Brain-derived neurotrophic factor mRNA; H: The cAMP response element-binding protein mRNA. Data are presented as mean ± SEM. Statistical significance was assessed using one-way analysis of variance followed by Tukey’s honestly significant difference multiple comparison test. Effect sizes and confidence intervals were calculated to complement P value interpretation (Supplementary Table 1). ^aP < 0.05, ^bP < 0.01, ^cP < 0.001 compared with the normal control group. ^eP < 0.05, ^fP < 0.01, ^gP < 0.001 compared with partial sciatic nerve ligation group. Sham: Normal control; PSNL: Partial sciatic nerve ligation; KP: Kalanchoe pinnata; TE: Treadmill exercise; VNS: Vagus nerve stimulation; Nrf2: Nuclear factor erythroid 2-related factor 2; HO-1: Heme-oxygenase 1; Keap1: Kelch-like ECH-associated protein 1; Bax: B-cell lymphoma 2 associated X-protein; Bcl-2: B-cell lymphoma 2; BDNF: Brain-derived neurotrophic factor; CREB: CAMP response element-binding protein; Gaba: Gabapentin.

Figure 2B shows that heme-oxygenase 1 (HO-1) expression was significantly decreased after PSNL induction compared with Sham animals (P < 0.05). Administration of gabapentin and KP significantly restored HO-1 expression relative to untreated PSNL rats (P < 0.05). Adding either VNS or TE further increased HO-1 levels, whereas the combined KP + TE + VNS treatment produced the greatest increase, significantly higher than in all other treatment groups (P < 0.05) and approaching normal control values.

Kelch-like ECH-associated protein 1 (Keap1) mRNA expression was significantly higher in the PSNL group than in Sham controls (P < 0.05) (Figure 2C). Gabapentin, KP, KP + VNS, and KP + TE significantly reduced Keap1 expression compared with untreated PSNL rats (P < 0.05). The greatest suppression occurred in the KP + TE + VNS group, which had significantly lower Keap1 levels than all other intervention groups (P < 0.05), suggesting enhanced expression of the Nrf2 antioxidant pathway.

Figure 2D shows that PSNL significantly increased B-cell lymphoma 2 associated X-protein (Bax) expression compared with the Sham group (P < 0.05), indicating enhanced pro-apoptotic signaling. All treatment groups showed significant reductions in Bax expression relative to untreated PSNL animals (P < 0.05). These reductions were more pronounced in the KP + VNS and KP + TE groups than in the KP-alone group (P < 0.05), and the KP + TE + VNS group had the lowest Bax expression among all PSNL-treated groups (P < 0.05).

Figure 2E shows that B-cell lymphoma 2 (Bcl-2) expression was significantly depleted after sciatic nerve injury compared to Sham animals (P < 0.05). Treatment with gabapentin and KP significantly increased Bcl-2 expression compared with untreated PSNL rats (P < 0.05). Combined therapies produced greater improvements than monotherapy, with KP + TE + VNS inducing the highest Bcl-2 expression and significantly outperforming all other treatment groups (P < 0.05).

Figure 2F also showed that caspase-3 expression was significantly higher in untreated PSNL rats than in Sham controls (P < 0.05). All treatment regimens significantly reduced caspase-3 expression compared with PSNL animals (P < 0.05). The greatest attenuation occurred in the KP + TE + VNS group, which had significantly lower caspase-3 levels than the gabapentin, KP, KP + VNS, and KP + TE groups (P < 0.05).

A significant decrease in brain-derived neurotrophic factor (BDNF) expression was observed in the PSNL group compared with Sham rats (P < 0.05) (Figure 2G). Treatment with KP significantly increased BDNF expression compared with PSNL animals (P < 0.05). Co-administration of VNS or TE with KP further enhanced BDNF levels, and the KP + TE + VNS group exhibited the highest expression, which was significantly greater than that of all other treatment groups (P < 0.05).

Figure 2H shows that cAMP response element-binding protein (CREB) mRNA expression was significantly suppressed after PSNL induction compared with Sham controls (P < 0.05). All treatment groups showed significantly higher CREB expression than the PSNL group (P < 0.05). The greatest restoration occurred in the KP + TE + VNS group, which showed significantly higher CREB expression than gabapentin, KP, KP + VNS, and KP + TE groups (P < 0.05).

MAO activity was significantly heightened in untreated PSNL rats compared with the Sham group (P < 0.05) (Figure 3A). KP treatments significantly reduced MAO activity compared with PSNL animals (P < 0.05), while KP + VNS and KP + TE produced further reductions. The KP + TE + VNS combination yielded the lowest MAO activity among treatment groups and differed significantly from all other PSNL-treated groups (P < 0.05). Figure 3B showed that dopamine concentrations were significantly reduced in the PSNL group compared to Sham controls (P < 0.05). All treatment groups showed significantly higher dopamine levels than untreated PSNL rats (P < 0.05). The highest dopamine concentration was observed in the KP + TE + VNS group, which significantly exceeded levels in the gabapentin, KP, KP + VNS, and KP + TE groups (P < 0.05).

Figure 3 The effects of Kalanchoe pinnata, vagus nerve stimulation, and treadmill exercise on the prefrontal cortex monoaminergic neurotransmission system, monoamine oxidase activity and dopamine concentration after partial sciatic nerve ligation. A: Monoamine oxidase activity; B: Dopamine concentration. Data are presented as mean ± SEM. Statistical significance was assessed using one-way analysis of variance followed by Tukey’s honestly significant difference multiple comparison test. Effect sizes and confidence intervals were calculated to complement P value interpretation (Supplementary Table 1). ^aP < 0.05, ^bP < 0.01, ^cP < 0.001 compared with the normal control group. ^eP < 0.05, ^fP < 0.01, ^gP < 0.001 compared with partial sciatic nerve ligation group. Sham: Normal control; PSNL: Partial sciatic nerve ligation; KP: Kalanchoe pinnata; TE: Treadmill exercise; VNS: Vagus nerve stimulation; Gaba: Gabapentin.

ROS levels were significantly higher after sciatic nerve injury than in Sham animals (P < 0.05) (Figure 4A). Treatment with KP significantly reduced ROS production compared with the untreated PSNL group (P < 0.05). Combination therapies produced stronger antioxidant effects, with KP + TE + VNS yielding the greatest reduction in ROS levels and significantly outperforming all other treatment groups (P < 0.05).

Figure 4 The effects of Kalanchoe pinnata, vagus nerve stimulation, and treadmill exercise on prefrontal cortex reactive oxygen species levels, acetylcholinesterase activity, nitric oxide concentration after partial sciatic nerve ligation. A: Reactive oxygen species levels; B: Acetylcholinesterase activity; C: Nitric oxide concentration. Data are presented as mean ± SEM. Statistical significance was assessed using one-way analysis of variance followed by Tukey’s honestly significant difference multiple comparison test. Effect sizes and confidence intervals were calculated to complement P value interpretation (Supplementary Table 1). ^aP < 0.05, ^bP < 0.01, ^cP < 0.001 compared with the normal control group. ^eP < 0.05, ^fP < 0.01, ^gP < 0.001 compared with partial sciatic nerve ligation group. Sham: Normal control; PSNL: Partial sciatic nerve ligation; KP: Kalanchoe pinnata; TE: Treadmill exercise; VNS: Vagus nerve stimulation; Gaba: Gabapentin.

Figure 4B shows that AChE activity was significantly higher in PSNL rats than in Sham controls (P < 0.05). All treatment interventions significantly reduced AChE activity compared with untreated PSNL animals (P < 0.05). The KP + TE + VNS group had the lowest AChE activity among all PSNL-treated groups and differed significantly from the other intervention groups (P < 0.05).

NO levels were significantly higher in untreated PSNL rats than in Sham controls (P < 0.05) (Figure 4C). Treatment with KP, KP + VNS, and KP + TE significantly reduced NO concentrations compared with PSNL animals (P < 0.05). The largest reduction occurred in the KP + TE + VNS group, which had significantly lower NO levels than all other treated groups (P < 0.05). Figure 5A showed that TNF-α levels were significantly higher after PSNL induction than in Sham rats (P < 0.05). All therapeutic interventions significantly reduced TNF-α concentrations compared with the untreated PSNL group (P < 0.05). The KP + TE + VNS group showed the greatest anti-inflammatory effect, with significantly lower TNF-α levels than the gabapentin, KP, KP + VNS, and KP + TE groups (P < 0.05).

Figure 5 The effects of Kalanchoe pinnata, vagus nerve stimulation, and treadmill exercise on inflammatory markers: Tumor necrosis factor-α, nuclear factor-kappa B, interleukin-1β, interleukin-10, after partial sciatic nerve ligation. A: Tumor necrosis factor-α; B: Nuclear factor-kappa B; C: Interleukin-1β; D: Interleukin-10. Data are presented as mean ± SEM. Statistical significance was assessed using one-way analysis of variance followed by Tukey’s honestly significant difference multiple comparison test. Effect sizes and confidence intervals were calculated to complement P value interpretation (Supplementary Table 1). ^aP < 0.05, ^bP < 0.01, ^cP < 0.001, ^dP < 0.0001 compared with the normal control group. ^eP < 0.05, ^fP < 0.01, ^gP < 0.001, ^hP < 0.0001 compared with partial sciatic nerve ligation group. Sham: Normal control; PSNL: Partial sciatic nerve ligation; KP: Kalanchoe pinnata; TE: Treadmill exercise; VNS: Vagus nerve stimulation; NF-κB: Nuclear factor-kappa B; Gaba: Gabapentin.

A significant increase in NF-κB concentration was observed in PSNL animals compared with Sham controls (P < 0.05) (Figure 5B). KP treatment significantly reduced NF-κB levels (P < 0.05), and combination therapies produced greater suppression. The KP + TE + VNS group had the lowest NF-κB concentration among all PSNL-treated groups and differed significantly from all other interventions (P < 0.05). IL-1β concentration was significantly higher in untreated PSNL rats than in Sham animals (P < 0.05) (Figure 5C). All treatment groups showed a significant decrease in IL-1β levels compared with PSNL controls (P < 0.05). The greatest reduction was observed in the KP + TE + VNS group, which had significantly lower IL-1β concentrations than all other treatment groups (P < 0.05).

Figure 5D showed that PSNL induction significantly reduced the anti-inflammatory cytokine IL-10 compared with Sham controls (P < 0.05). Treatment with KP significantly heightened IL-10 concentrations compared with untreated PSNL rats (P < 0.05). Combined therapies produced greater improvements, with KP + TE + VNS yielding the highest IL-10 concentration and significantly exceeding all other PSNL-treated groups (P < 0.05). LDH activity was significantly higher in untreated PSNL rats than in Sham animals (P < 0.05), indicating increased cellular injury (Figure 6). All treatment regimens significantly reduced LDH activity compared with the PSNL group (P < 0.05). The KP + TE + VNS combination produced the greatest reduction in LDH activity and was significantly more effective than gabapentin, KP, KP + VNS, and KP + TE treatments (P < 0.05).

Figure 6 The effects of Kalanchoe pinnata, vagus nerve stimulation, and treadmill exercise on prefrontal cortex lactate dehydrogenase concentration after partial sciatic nerve ligation. Data are presented as mean ± SEM. Statistical significance was assessed using one-way analysis of variance followed by Tukey’s honestly significant difference multiple comparison test. Effect sizes and confidence intervals were calculated to complement P value interpretation (Supplementary Table 1). ^aP < 0.05, ^bP < 0.01, ^cP < 0.001 compared with the normal control group. ^eP < 0.05, ^fP < 0.01, ^gP < 0.001 compared with partial sciatic nerve ligation group. Sham: Normal control; PSNL: Partial sciatic nerve ligation; KP: Kalanchoe pinnata; TE: Treadmill exercise; VNS: Vagus nerve stimulation; Gaba: Gabapentin.

DISCUSSION

Neuropathic pain has long been viewed as a disorder involving peripheral nerve dysfunction and spinal cord sensitization. However, growing evidence shows that higher brain structures, especially the PFC, undergo significant changes after nerve injury and actively sustain chronic pain. The PFC processes pain signals alongside emotional, cognitive, and autonomic information, and its connections to the periaqueductal gray are key to the brain’s descending pain inhibition system[5]. Behavioral results show that PSNL leads to a clear neuropathic condition characterized by increased mechanical allodynia, thermal hyperalgesia, and cold allodynia, indicating ongoing sensitization across sensory modalities[37]. Notably, recovery patterns over time varied with different treatments: Gabapentin provided early but incomplete relief from hypersensitivity, whereas KP offered a more comprehensive recovery of pain thresholds that improved gradually. Adding TE or VNS enhanced these effects, and combining all three produced the greatest normalization of behavioral signals. Thus, the combined therapy improved not only responses to mechanical and thermal stimuli but also cold hypersensitivity, a sensation linked to distinct neuroimmune and central sensitization pathways. This alignment across modalities suggests that the benefits extend beyond simple pain relief and may involve restoring balance in sensory networks through cortical pain regulation, autonomic control, and activity-driven neuroplasticity[38]. The gradual improvement in behavioral parameters seen across postoperative assessments suggests ongoing functional recovery after treatment. However, because molecular and biochemical analyses were conducted only at the final time point, the study cannot establish the sequence of molecular events leading to this behavioral enhancement. Therefore, the molecular changes observed at the endpoint should be viewed as correlates linked to recovery induced by treatment, rather than as evidence of continuous molecular activation over time.

KP monotherapy led to significant improvements in both behavioral and molecular measures, establishing a solid basis for further benefits from TE and VNS. Its therapeutic effects are attributed to a variety of phytochemicals, such as flavonoids (quercetin, kaempferol, apigenin), bufadienolides, triterpenoids, and phenolics[39]. These compounds provide different pharmacological effects, including free radical scavenging, inhibition of pro-inflammatory enzymes, reduction of NF-κB activity, and modulation of the Keap1-Nrf2 antioxidant pathway. Specifically, quercetin and kaempferol inhibit COX-2 and iNOS, decrease TNF-α and IL-1β, and promote Nrf2’s movement into the nucleus, enhancing the expression of HO-1 and other antioxidant genes[40,41]. The observed decreases in Keap1 and increases in Nrf2 and HO-1 in rats treated with KP are consistent with flavonoids interfering with Keap1-Nrf2 binding, thereby promoting Nrf2 translocation to the nucleus and enhancing protective genes[42]. This results in heightened antioxidant enzyme activity, reduced lipid peroxidation, and diminished NF-κB-driven inflammation. Lowered levels of ROS and NO, alongside reductions in TNF-α, IL-1β, and NF-κB, suggest that KP acts both directly as an antioxidant through polyphenols and indirectly by enhancing the Nrf2 pathway. The increased IL-10 levels also point to an anti-inflammatory shift, potentially aiding the resolution of neuroinflammation and restoring balanced signaling in cortical pain networks[43].

Adding TE to KP treatment may be related to the further improvements across all tested parameters, suggesting that exercise and phytotherapy act through partly distinct yet complementary neurobiological pathways. Aerobic exercise is known to promote neuroplasticity, reduce neuroinflammation, and enhance neurotrophic signaling in the central nervous system[44]. In this study, the KP + TE group showed higher levels of BDNF and CREB than the KP-only group, consistent with exercise-enhanced expression of the BDNF-TrkB-CREB pathway[45]. CREB regulates genes involved in neuronal plasticity, survival, and neurotransmission, and its expression in the PFC correlates with better cognitive and emotional outcomes in chronic pain models[4]. The additional reductions in Bax and caspase-3, along with increased Bcl-2, further suggest that exercise boosts anti-apoptotic signaling, likely via BDNF-triggered PI3K/Akt survival pathways. Moreover, exercise decreased MAO activity and increased dopamine levels beyond what KP alone achieved, indicating an enhancement in monoaminergic tone that may strengthen descending pain inhibition through noradrenergic and serotonergic pathways[46].

VNS offers additional therapeutic benefits when combined with KP, achieving effects comparable to or better than those of exercise across various inflammatory and redox markers. Its analgesic and anti-inflammatory effects primarily act via the cholinergic anti-inflammatory pathway, in which efferent vagus nerve fibers release acetylcholine in peripheral ganglia. This enhances α7 nicotinic acetylcholine receptors on macrophages, reducing pro-inflammatory cytokine production[47,48]. In this study, decreased AChE activity in the tVNS groups indicates higher synaptic acetylcholine levels, thereby enhancing endogenous cholinergic regulation of pain and neuroinflammation. Acetylcholine exerts potent anti-inflammatory effects by enhancing α7 nAChRs on microglia and astrocytes, suppressing pro-inflammatory release, and promoting anti-inflammatory expression[49]. The observed reductions in NF-κB, TNF-α, and IL-1β and the rise in IL-10 in the KP + VNS group support CAP-mediated immune modulation. Additionally, tVNS enhances Nrf2, increasing antioxidant gene expression, which may explain the greater reductions in ROS and the stronger upregulation of Nrf2 and HO-1 in VNS-treated animals compared to KP alone[50]. Thus, tVNS may contribute to anti-inflammatory and neuroprotective effects by engaging vagal afferent pathways. Although auricular tVNS targets the auricular branch of the vagus nerve and has been widely used to modulate neuroimmune and autonomic responses, this study did not include physiological measures such as heart rate variability, vagus-evoked potentials, or other autonomic biomarkers to confirm target engagement. Future research incorporating objective measures of vagal activity will be crucial to confirm stimulation efficacy and better understand the mechanisms underlying tVNS effects.

The KP + TE + VNS therapy consistently yielded the best results across behavioral, molecular, and biochemical measures, including increased Nrf2 and HO-1 expression and decreased Keap1, NF-κB, NO, ROS, and pro-inflammatory cytokines. It also restored BDNF and CREB signaling. These findings suggest that the intervention modulated genes involved in the Keap1-Nrf2-HO-1 antioxidant response. Although the increased Nrf2 and HO-1 mRNA expression alongside reduced Keap1 expression supports enhanced transcriptional regulation of antioxidant defense mechanisms, confirmation of pathway activation requires additional protein-level analyses and functional assays[40]. Nrf2 enhancement boosts protective gene expression, reduces oxidative stress, dampens NF-κB-driven inflammation, raises IL-10 levels, and lessens nitrosative injury[51]. KP likely contributed to this response via its phytochemicals, while TE improves mitochondrial function, neurotrophic signaling, and monoaminergic activity. VNS enhances anti-inflammatory cholinergic effects, cerebral blood flow, and metabolic adaptation. The combination of these mechanisms within the PFC, a critical region for pain regulation and immune response, likely explains the enhanced effect seen with the triple therapy.

The multimodal intervention not only reduces oxidative and inflammatory damage but also promotes neuronal survival and recovery by regulating neuroplastic, anti-apoptotic, and neurotransmitter pathways. The significant increase in BDNF and CREB suggests a restoration of adaptive neuroplasticity and the strengthening of cortical networks that control pain, emotions, and cognition[52]. The treatment was associated with a favorable shift in apoptosis-related gene expression, characterized by increased Bcl-2 and reduced Bax and caspase-3 expression. These changes suggest a potential reduction in apoptotic processes, although direct confirmation requires additional functional assays. Reduced LDH activity indicates maintained cell membrane integrity and lowered neurodegeneration[53]. Meanwhile, normalized monoaminergic and cholinergic transmission, as evidenced by decreased MAO and AChE activity and increased dopamine levels, may have restored pain-inhibitory pathways and reduced emotional and motivational issues associated with chronic pain[54]. Lower NO levels further show suppressed iNOS-driven nitrosative stress, likely due to Nrf2 enhancement, NF-κB inhibition, and antioxidant effects from KP phytochemicals[55]. This trend of results suggests a therapeutic pathway in which KP, TE, and VNS together stimulate antioxidant defenses, inhibit neuroinflammation and nitrosative stress, boost neuroplasticity, preserve neurons, and balance neurotransmitter levels, leading to a strong and lasting reduction in neuropathic pain. Despite these promising results, certain limitations should be noted. The current experimental setup lacked vehicle-only gavage controls and separate TE-alone and VNS-alone treatment groups. As a result, although the improvements seen with KP-containing combination therapies suggest enhanced therapeutic effects, the exact roles of each intervention and whether true pharmacological synergy exists remain unclear. Future research with a factorial design, including KP, TE, VNS, vehicle controls, and their individual combinations, will be essential to evaluate interaction effects and verify synergistic mechanisms.

The discovery that gabapentin yields milder improvements than KP-based therapies and less benefit than combination treatments has important clinical implications. Gabapentin, a primary drug for neuropathic pain, acts via its binding to the α2δ subunit of calcium channels, reducing neurotransmitter release and modulating NMDA receptors[56]. While it can enhance the Nrf2/HO-1 pathway and has anti-inflammatory properties, its main effect is neuromodulatory rather than providing broad neuroprotection[57]. KP and its combinations are more effective, suggesting that targeting multiple mechanisms may offer more comprehensive pain relief.

Several limitations should be kept in mind when interpreting this study’s results. While the combination of KP, TE, and VNS improved neuropathic pain behaviors and showed positive molecular changes, its translational relevance is limited due to the preclinical nature of the research. Further studies are needed, including pharmacokinetic profiling, safety assessments, dose optimization, and clinical validation, before considering human application. Additionally, multiple biological endpoints related to oxidative stress, inflammation, apoptosis, neuroplasticity, and neurotransmission were analyzed. Although Tukey’s honestly significant difference correction helped address multiple comparisons within each endpoint, the findings remain exploratory. Future research with larger datasets and methods like false discovery rate correction could clarify pathway-specific results. Most molecular analyses focused on mRNA levels; thus, confirming functional pathway changes with protein validation methods such as Western blotting and immunohistochemistry is essential. Causal relationships cannot be conclusively established, as pathway-specific inhibitors, gene manipulation, or loss-of-function experiments were not used. The study also lacked TE-alone and VNS-alone groups, limiting the understanding of individual and combined effects. Other limitations include a small sample size, no direct verification of VNS activation, no long-term follow-up after treatment, and analysis restricted to the PFC without examining other pain-related regions like the spinal cord. Addressing these issues in future research will enhance understanding of the mechanisms and translational potential.

CONCLUSION

This study shows that combining KP, TE, and VNS provides better relief for neuropathic pain than any single treatment or drug. This triple therapy was associated with increased expression of antioxidant-related genes, reduced inflammatory responses, improved expression of neuroplasticity-related genes, and reduced expression of apoptosis-associated markers in the PFC. These findings suggest involvement of antioxidant, inflammatory, neuroplasticity, and cell survival mechanisms, although further protein-level validation is required. The results underscore the PFC’s importance as a target for multimodal pain therapies. They also show that combining KP with exercise and VNS yields stronger neuroprotective responses than KP monotherapy or dual KP-based interventions. Further longitudinal molecular investigations are required to establish the temporal mechanisms underlying these effects. However, additional studies with standalone exercise and VNS groups are needed to confirm true synergistic interactions. This method, which combines phytotherapy, exercise, and neuromodulation, presents a promising and sustainable option for managing chronic neuropathic pain and supporting long-term recovery.

ACKNOWLEDGEMENTS

All authors express their sincere gratitude to the Federal University of Technology, Akure, Nigeria.