BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Clin Oncol. Jun 24, 2025; 16(6): 106197
Published online Jun 24, 2025. doi: 10.5306/wjco.v16.i6.106197
NOTCH1 combined with chemotherapy synergistically inhibits triple-negative breast cancer
Wen-Jia Chen, Yang-Zheng Lan, Zheng Wu, Jing Liu, The Breast Center, Cancer Hospital of Shantou University Medical College, Shantou 515041, Guangdong Province, China
Hua-Tao Wu, Xin-Ning Yu, Department of General Surgery, First Affiliated Hospital of Shantou University Medical College, Shantou 515041, Guangdong Province, China
Wen-Ting Lin, Department of Pathology, Shantou University Medical College, Shantou 515041, Guangdong Province, China
ORCID number: Wen-Jia Chen (0000-0001-7157-3242); Hua-Tao Wu (0000-0002-1640-6094); Yang-Zheng Lan (0009-0000-4241-228X); Zheng Wu (0000-0002-1393-7586); Xin-Ning Yu (0009-0003-4658-4275); Jing Liu (0000-0002-7483-4572).
Co-first authors: Wen-Jia Chen and Hua-Tao Wu.
Author contributions: Chen WJ and Wu HT contribute equally to this study as co-first authors; Chen WJ responsible for bioscientific experiments, data base screening, figure preparation, study designation, and paper drafting; Wu HT responsible for bioscientific experiments, statistical analysis, and paper drafting; Lan YZ responsible for statistical analysis; Yu XN and Wu Z responsible for collecting and organizing raw data and figure preparation; Lin WT responsible for image quality control; Liu J responsible for study designation, supervising the project, statistical analysis, revising and polishing the whole study and the manuscript, and image quality control; all authors reviewed the manuscript and approved the submitted version.
Supported by National Natural Science Foundation of China, No. 82273457; the Natural Science Foundation of Guangdong Province, No. 2021A1515012180 and No. 2023A1515012762; Science and Technology Special Project of Guangdong Province, No. 210715216902829 and No. 200628175260810; and ‘Dengfeng Project’ for the Construction of High-Level Hospitals in Guangdong Province—First Affiliated Hospital of Shantou University College Supporting Funding, No. 202003-10.
Institutional animal care and use committee statement: The Animal Ethics Committee of Shantou University Medical College, Shantou, China, approved the protocol for the animal experiment. All animals received care as prescribed under the ‘Guide for the Care and Use of Laboratory Animals’.
Conflict-of-interest statement: The authors declare that they have no competing interests.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: No additional data are available.
Corresponding author: Jing Liu, MD, PhD, Associate Professor, The Breast Center, Cancer Hospital of Shantou University Medical College, No. 7 Raoping Road, Shantou 515041, Guangdong Province, China. jliu12@stu.edu.cn
Received: February 19, 2025
Revised: April 3, 2025
Accepted: May 7, 2025
Published online: June 24, 2025
Processing time: 121 Days and 22.6 Hours

Abstract
BACKGROUND

Chemotherapy for triple-negative breast cancer (TNBC) is often limited in efficacy due to drug resistance. The NOTCH1 pathway significantly contributes to the advancement of tumors, but its mechanism of action in sensitizing TNBC to chemotherapy and its association with the downstream molecule, NT5E, is unclear.

AIM

To explore the molecular mechanisms by which NOTCH1 regulates cisplatin sensitivity in TNBC cells, and to validate its synergistic effect with NT5E.

METHODS

Expression of NOTCH1 in MDA-MB-231 cells was silenced using RNA interference, and the changes in cell proliferation, migration and cisplatin sensitivity were measured in combination with cell function experiments. The regulatory relationship between NOTCH1 and NT5E was analyzed using qPCR and Western blotting, and the silencing effect of NOTCH1 was verified using NT5E overexpression experiments.

RESULTS

Knockdown of NOTCH1 hindered the growth and motility of TNBC cells and lowered cisplatin’s half-maximal inhibitory concentration. Expression of NOTCH1 and NT5E was positively correlated, and NOTCH1 silencing led to a decrease in the expression of NT5E. Elevated NT5E expression attenuated the suppressive effects of NOTCH1 knockdown on both cell proliferation and cisplatin response.

CONCLUSION

NOTCH1 enhances TNBC cisplatin chemosensitivity by regulating NT5E expression. This study provides a new target and experimental basis for the development of combination therapy strategies for TNBC.

Key Words: NOTCH1; Triple-negative breast cancer; Cisplatin; Sensitivity; NT5E

Core Tip: Chemoresistance in triple-negative breast cancer (TNBC) hampers chemotherapy effectiveness. This study shows that targeting NOTCH1 reduced cell proliferation and migration, enhancing cisplatin sensitivity. A positive correlation between NOTCH1 and NT5E expression was observed, with NT5E contributing to tumor progression and chemoresistance. NOTCH1 silencing downregulated NT5E, while NT5E overexpression partially reversed these effects. These findings suggest that targeting the NOTCH1-NT5E pathway could improve chemotherapy outcomes in TNBC.



INTRODUCTION

Triple-negative breast cancer (TNBC) refers to a subtype of breast cancer that lacks expression of three common biomarkers comprising the estrogen receptor, progesterone receptor, and HER2 receptor. TNBC accounts for approximately 15% to 20% of all breast cancer cases[1], and typically exhibits complex biological characteristics, rapid progression, and poor prognosis[2]. Due to absence of the aforementioned receptors, TNBC cannot be controlled by hormone therapy or HER2-targeted therapies, posing a significant challenge in treatment. Currently, treatment of TNBC mainly relies on traditional methods, such as surgery, radiation therapy, and chemotherapy[3]. Chemotherapy is the main therapeutic approach for TNBC, and commonly includes platinum-based drugs (e.g., cisplatin), anthracyclines (e.g., doxorubicin), and taxanes (e.g., docetaxel)[4,5]. Although these drugs control tumor growth to some extent, their effectiveness varies due to patient-specific differences, and they are often accompanied by severe side effects. One key factor is the influence of genetic and molecular mechanisms on response to chemotherapy. It has been reported that platinum-based drugs induce cell death by cross-linking DNA and blocking DNA replication. Mutations in the BRCA1/2 genes typically lead to defects in DNA repair mechanisms. TNBC patients with BRCA1/2 mutations show significantly higher disease control and remission rates when treated with platinum-based drugs compared to wild-type patients. In particular, platinum drugs exhibit more notable efficacy in patients with BRCA1 mutations[6]. On the other hand, mutations in the P-glycoprotein (MDR1) gene are closely related to drug transmembrane transport. Ketotifen, as an MDR1 inhibitor, suppresses both MDR1 activity and regulates cardiac protection mechanisms, improving the efficacy of breast cancer treatment while reducing side effects[7]. Although p53 mutations in TNBC patients may lead to reduced sensitivity to chemotherapy drugs, p53-mutant TNBC cells lack normal DNA damage repair mechanisms, making them more susceptible to cell cycle arrest and DNA repair defects following CDK inhibition and doxorubicin treatment[8]. Daurinoline can downregulate expression of NOTCH1 and inhibit the activity of NOTCH’s downstream effectors (such as Hes1, Hey1). Inhibition of the NOTCH1 signaling pathway helps restore tumor cell sensitivity to chemotherapy drugs, particularly paclitaxel[9].

Research on NOTCH1 in TNBC has attracted widespread attention in recent years, primarily due to its critical roles in various biological processes in TNBC cells, including proliferation, differentiation, apoptosis, and immune evasion, especially in tumor stem cell maintenance, tumorigenesis, and drug resistance[10-12]. As an evolutionarily highly conserved intercellular communication mechanism, the NOTCH signaling pathway regulates key biological processes such as cell fate determination, proliferation, differentiation, and apoptosis through the interaction of receptors and ligands, including the Jagged1/2 and Delta-like protein families[13-16]. The NOTCH1 signaling pathway is involved not only in tumor cell proliferation, differentiation, and survival, but also in chemotherapeutic response. Studies have reported that Bacteroides fragilis secretes BFT-1 toxin, which promotes stem cell characteristics and chemotherapy resistance in breast cancer cells by binding the breast cancer cell NOD1 pattern recognition receptor to activate the NOTCH1-HEY1 pathway[17]. By inhibiting the function of ADAM10, the NOTCH1 signaling pathway can be effectively modulated, reducing the expression of CD44 and PrPC, which in turn reduces chemotherapeutic resistance in TNBC cells (e.g., to doxorubicin and paclitaxel) and improves chemotherapeutic efficacy[18]. It has been found that miR-34a-5p enhances sensitivity of breast cancer cells to doxorubicin by downregulating the expression of NOTCH1, thus inhibiting the activation of NOTCH signaling[19]. Furthermore, NOTCH1 targets downstream molecules to inhibit cancer cell proliferation and make them more susceptible to chemotherapy. NOTCH1, through the AP-1 signaling pathway, upregulates the expression of microRNA-451, which, in turn, directly inhibits the expression of MDR1, enhancing chemotherapeutic resistance to taxane drugs in lung adenocarcinoma cells[20]. Knocking down NOTCH1 in breast cancer stem cells reduces tumor growth in vivo. When combined with paclitaxel treatment, NOTCH1 knockdown enhances the therapeutic efficacy of chemotherapy[21]. Recent studies have shown that NOTCH1, through its transcription factor Hes1, directly or indirectly upregulates NT5E, leading to cisplatin resistance[22]. The significant role of NOTCH1 in chemotherapy resistance, particularly cisplatin resistance in breast cancer, suggests that targeting and knocking down the NOTCH1 signaling pathway may effectively overcome cisplatin resistance, thereby enhancing the therapeutic effect of cisplatin and improving cancer treatment success rates.

Furthermore, the ecto-5'-nucleotidase CD73 (encoded by NT5E) has been identified as a key mediator in TNBC progression and therapeutic resistance. NT5E participates in the construction of an immunosuppressive tumor microenvironment and promotes immune escape from tumors by catalyzing the conversion of extracellular ATP to adenosine[23]. Studies have shown that NT5E expression levels are significantly elevated in TNBC compared to other breast cancer subtypes, and this phenomenon is strongly associated with poor clinical outcomes. Overexpression of NT5E inhibits adaptive anti-tumor immune responses through activation of A2A adenosine receptors, conferring chemo-resistance to adriamycin, a commonly used anthracycline[24]. The NT5E-mediated adenosine signaling pathway not only inhibits the anti-tumor immune response, but also directly promotes tumor cell invasion, metastasis and chemoresistance[25-27]. Given the potential synergistic role of the NOTCH signaling pathway and NT5E in chemoresistance, targeting both pathways simultaneously may provide a novel strategy for TNBC treatment.

This study focused on the role of NOTCH1 in TNBC and investigated its potential for combined therapy with cisplatin. Our results establish a conceptual framework for designing novel chemotherapy sensitization approaches, precision-targeted interventions, and customized therapeutic regimens.

MATERIALS AND METHODS
Cells and reagents

MDA-MB-231 and human embryonic kidney HEK293T cells were obtained from the ATCC and cultured according to ATCC guidelines. To verify molecular functions and mechanisms, viral packaging plasmids (psPAX.2 and pMD2), LV201-Sh, LV201-N1ICD, and NT5E were all sourced from Changsha Youbao Biotechnology (China). Cisplatin (DDP, H20040813) was obtained from Jiangsu Haosen. Puromycin was purchased from MedChemExpress.

Screening of stably-transfected cell lines

HEK293T cells were co-transfected, with the target plasmids and viral packaging plasmids, using Lipofectamine TM3000 (Invitrogen, 2304349). After 72 hours of incubation at 37 °C, the virus-containing supernatant was collected, filtered through a 0.45-micron filter, and used to infect MDA-MB-231 cells. The fluorescence intensity of the cells was observed under a fluorescence microscope, and puromycin was used to select stable transfectants.

RT-PCR

RNA isolation was performed with Trizol reagent followed by cDNA synthesis with the Accurate Biology reverse transcription kit (AG11706). Quantitative PCR analysis was conducted using Bio-Rad's 7500 system with SYBR Green super mix (1725124) as detection chemistry. Total mRNA extraction and RT-PCR was performed as previously described[28]. The primer sequences used were: NOTCH1 (F: CGGGTCCACCAGTTTGAATG; R: GTTGTATTGGTTCGGCACC AT), NT5E (F: GGTGGCTTT TAGGATGGCAAG; R: ACTGGAACGGTGAAGGTGACAG), β-actin (F: GGTGGCTTTTAGGATGGCAAG; R: ACTGGAACGGTGAAGGTGACAG).

CCK-8 assay

After treating the cells according to the experimental design, cells were digested with trypsin and resuspended for cell counting. One thousand cells per well were seeded into 96-well plates with 5 replicates per sample. The proliferative capacity of the cells was assayed by CCK-8 reagent at the same time point on days 1, 2, 3, 4, 5, and 6 after plate spreading. CCK-8 solution was added (medium:CCK-8 solution = 100:10), and 110 μL was added per well. Samples were incubated for 2 hours at 37 °C before measuring OD450 in a microplate reader.

Colony formation assay

After cell treatment, cells were digested with trypsin, resuspended, and counted. One thousand cells were seeded into 6-well plates and cultured for 10 days at 37 °C. The medium was discarded, and cells were washed 3 times with PBS, fixed in formaldehyde, stained with 0.1% crystal violet for 15 minutes, washed with PBS, and air-dried before photographing.

Transwell assay

After treating cells according to the experimental design, the cells were starved in medium without FBS for 12 hours. Following trypsinization, cells were washed and resuspended in serum-free medium. After quantification, cells were adjusted to 1 × 105 cells/mL, and 200 μL aliquots were plated in the upper compartments of transwell chambers. The lower chamber contained 800 μL of medium with 10% FBS. After 24 hours of incubation at 37 °C, the chambers were removed, and cells were stained with 0.1% crystal violet as in the colony formation assay. Non-migrated cells were removed with a cotton swab, and the remaining cells were air-dried and photographed under a microscope (magnification × 40).

Wound healing assay

After treating the cells, cells were digested with trypsin, resuspended, and seeded at an appropriate density into 6-well plates. After cells adhered, and a vertical scratch was made using a 200 μL pipette tip. Cells were washed with PBS, and 2% FBS medium was added. Images were taken under a microscope to measure the wound area. The cells were incubated at 37 °C, and images were taken at 24 and 48 hours to monitor wound closure.

Immunofluorescence staining

Following pretreatment, cells were plated on Millicell EZ slides (Merck Millipore) and allowed to attach. Subsequent processing included room temperature fixation with 4% paraformaldehyde, membrane permeabilization using Triton X-100, and blocking with 5% BSA solution. Slides were incubated with F-actin antibody (Invitrogen, 2157163) for 30 minutes at room temperature. After washing, nuclei were stained with DAPI for 5 minutes. Then, slides were mounted and photographed under a microscope (magnification × 630).

Determination of IC50 concentration

After treating the cells, cells were digested with trypsin, resuspended, and added at 2000 cells per well to each well of a 96-well plate. After cell adhesion, the medium was replaced with drug-containing medium and incubated for 48 hours. CCK-8 reagent was added, and cells were incubated at 37 °C for 2 hours. Absorbance was measured at 450 nm, and growth inhibition was calculated as [(control OD - experimental OD)/(control OD - blank OD)] × 100%.

TUNEL assay

After treating the cells, cells were digested with trypsin, resuspended, and counted. Appropriate cell numbers were seeded in 24-well plates. After cell adhesion, they were fixed with 4% paraformaldehyde for 30 minutes at room temperature and permeabilized with Triton X-100 for 5 minutes. The TUNEL assay working solution was freshly prepared following the protocol provided by Beyotime (Cat C1088), and each well received 50 μL of freshly prepared TUNEL reaction mixture, followed by a 60-minute incubation at 37 °C under light-protected conditions. After washing with PBS, cells were mounted with antifade mounting medium and observed under a fluorescence microscope.

Western blotting

Cellular proteins were lysed with RIPA buffer and concentration determined by BCA assay. Following SDS-PAGE separation and PVDF membrane transfer, membranes were probed with primary antibodies overnight. The membrane was then incubated with appropriate secondary antibody, and chemiluminescence detection was performed using a Bio-Rad ChemiDoc XRS + system.

In vivo animal model

Cells were digested with trypsin and resuspended, and the cell count was determined. MDA-MB-231 cells expressing a luciferase reporter gene were injected (1 × 106 cells/100 μL) into the flanks of nu/nu mice to generate xenograft tumors. After one week, tumors were visible, and their size was measured every three days using calipers. Luciferase activity was imaged using an IVIS system. Following completion of the experimental protocol, tumor-bearing mice were humanely sacrificed for tumor collection. These animal studies received ethical approval from Shantou University Medical College's Institutional Animal Care and Use Committee.

Data analysis and statistics

The correlation between NOTCH1 and NT5E was explored using the GEPIA2 database[29] and cBioPortal database[30]. PanCanSurvPlot (http://www.pancansurvplot.com/) was used to assess the relationship between the expression of NOTCH1 and NT5E with overall survival (OS) and distant relapse-free survival (DRFS) in breast cancer. Quantitative data are presented as mean ± SD. Statistical analyses were conducted using GraphPad Prism 9.0 software, employing Student's t-test or ANOVA as appropriate. Significance levels were designated as follows: cP < 0.001, bP < 0.01, and aP < 0.05. Minimum triplicate biological replicates were performed for all experimental procedures.

RESULTS
Knockdown of NOTCH1 inhibits the proliferation and migration of TNBC cells in vitro

Previous reports have shown that NOTCH1 is often highly expressed in TNBC and plays an important role in the proliferation, migration, and invasion of TNBC cells. Therefore, we constructed a stable NOTCH1-knockdown MDA-MB-231 cell line, by lentiviral transduction of MDA-MB-231 cells, and transduction efficiency was determined by observing virus-encoded green fluorescent protein under a fluorescence microscope (Figure 1A). Drug selection was performed to obtain stably transfected cells. The knockdown efficiency of NOTCH1 was further verified by RT-PCR and western blotting (Figure 1B and C). Subsequently, functional validation of stable NOTCH1-knockdown MDA-MB-231 cells was performed. CCK-8 and colony formation assays showed that, compared to the control group, proliferation and colony formation of cells were reduced after NOTCH1 knockdown (Figure 1D and E), indicating that NOTCH1 knockdown inhibited the proliferation of MDA-MB-231 cells. Transwell assays revealed that the invasiveness of MDA-MB-231 cells was also reduced after NOTCH1 knockdown (Figure 1F), and immunofluorescence staining showed that, after NOTCH1 knockdown, the filamentous arrangement of F-actin in MDA-MB-231 cells was suppressed, forming dense focal adhesions, and the number and length pseudopodia-like protrusions around the cells were reduced (Figure 1G). These results suggest that the migration and invasion of MDA-MB-231 cells were reduced after NOTCH1 knockdown.

Figure 1
Figure 1 Knockdown of NOTCH1 inhibits the proliferation and migration of TNBC cells in vitro. A: After viral transduction of MDA-MB-231 cells, successfully transduced cells exhibited green fluorescence under fluorescence microscopy; B and C: RT-PCR and western blotting validation of the knockdown efficiency of NOTCH1 in stable MDA-MB-231 cells; D: CCK-8 assay results show that the proliferation of stable NOTCH1-knockdown MDA-MB-231 cells is reduced compared to wild-type MDA-MB-231 cells; E: Colony formation assay showing that colony formation of stable NOTCH1-knockdown MDA-MB-231 cells was reduced compared to wild-type MDA-MB-231 cells; F: Transwell assay showing that the invasion of stable NOTCH1-knockdown MDA-MB-231 cells was reduced compared to wild-type MDA-MB-231 cells; G: Immunofluorescence showing that after NOTCH1 knockdown, the filamentous arrangement of F-actin in MDA-MB-231 cells was suppressed, and the lamellipodia-like protrusions around the cell periphery were reduced. aP < 0.001.
Knockdown of NOTCH1 enhances sensitivity of TNBC cells to cisplatin treatment

Cisplatin, as a commonly used chemotherapy drug for TNBC, has shown efficacy in treatment, but the issue of resistance persists. It has been reported that excessive activation of NOTCH1 is a key factor contributing to cisplatin resistance in TNBC patients. NOTCH1 is highly expressed in MDA-MB-231 cells, and we hypothesized that knocking down NOTCH1 will alter the sensitivity of TNBC cells to cisplatin. We measured the IC50 values of cisplatin cytotoxicity in stable NOTCH1 knockdown MDA-MB-231 cells and found that, compared to the control cells (IC50 = 15.36 μM), stable NOTCH1-knockdown MDA-MB-231 cells exhibited increased sensitivity to cisplatin treatment (IC50 = 10.20 μM; Figure 2A). CCK-8 assays showed that, compared to cisplatin treatment alone or NOTCH1 knockdown alone, the combination of NOTCH1 knockdown and cisplatin treatment exerted greater inhibition of cell proliferation (Figure 2B). TUNEL assays also demonstrated that, compared to cisplatin treatment alone or NOTCH1 knockdown alone, the combination of NOTCH1 knockdown and cisplatin treatment led to a significant increase in the proportion of apoptotic cells (Figure 2C). Thus, knocking down NOTCH1 in TNBC cells enhances their sensitivity to cisplatin, promoting tumor cell death.

Figure 2
Figure 2 Knockdown of NOTCH1 enhances the chemosensitivity of triple-negative breast cancer cells to cisplatin. A: Analysis of cell sensitivity to cisplatin showing that, compared to control cells (IC50 = 15.36 μM), stable NOTCH1-knockdown MDA-MB-231 cells exhibited higher sensitivity to cisplatin treatment (IC50 = 10.20 μM); B: CCK-8 assay indicating that the combination of NOTCH1 knockdown and cisplatin treatment significantly inhibited cell proliferation; C: TUNEL assay showing that after NOTCH1 knockdown and cisplatin treatment, the proportion of apoptotic cells significantly increases. aP < 0.05; bP < 0.01.
NOTCH1 and NT5E are positively correlated in TNBC

NOTCH1, as a transmembrane receptor, typically regulates the expression of multiple genes by activating its downstream transcription factors. Given the critical role of NOTCH1 in TNBC, researchers have proposed targeting NOTCH1 or its downstream effectors to enhance the chemotherapy sensitivity of TNBC. Studies have shown that NOTCH1 activation promotes the generation of adenosine by upregulating the expression of NT5E, thereby facilitating tumor progression and chemotherapy resistance. We hypothesized that the enhanced cisplatin chemotherapeutic sensitivity in TNBC cells following NOTCH1 knockdown may be due to the targeted inhibition of NT5E. Consistent with previous reports, NT5E protein and mRNA levels were downregulated in stable NOTCH1-knockdown MDA-MB-231 cells (Figure 3A and B). Bioinformatic analysis of public transcriptomic datasets revealed a significant co-expression pattern between NOTCH1 and NT5E mRNA levels (Figure 3C and D). We obtained a breast cancer expression matrix and clinical information from the breast cancer cohort in The Cancer Genome Atlas, which started with 1068 breast cancer patients. After excluding duplicate samples and specimens with invalid sequencing information and incomplete clinicopathologic information, 973 breast cancer patients remained, including 101 TNBC patients. Spearman rank correlation analysis demonstrated a positive correlation between NOTCH1 and NT5E expression in TNBC samples (Figure 3E). Moreover, low expression of either NOTCH1 or NT5E was associated with better OS and DRFS in patients (Figure 3F-I).

Figure 3
Figure 3 NOTCH1 and NT5E are positively correlated in triple-negative breast cancer cells. A and B: Western blot and RT-PCR results show that NT5E protein and mRNA levels are downregulated in stable NOTCH1-knockdown MDA-MB-231 cells; C and D: Online database prediction indicated a positive correlation between the mRNA expression levels of NOTCH1 and NT5E in breast cancer; E: In the 101 triple-negative breast cancer patients in The Cancer Genome Atlas, the mRNA expression levels of NOTCH1 and NT5E were positively correlated.; F-I: Online database prediction suggesting that low expression of NOTCH1 or NT5E was associated with better overall survival and disease-free survival in patients. aP < 0.05; bP < 0.01.
Knockdown of NOTCH1 targets NT5E to inhibit the proliferation and migration of breast cancer cells both in vitro and in vivo

Since NOTCH1 knockdown downregulated the expression level of NT5E, we performed a rescue experiment by using lentivirus encoding NT5E to transduce NOTCH1-knockdown MDA-MB-231 cells. Efficiency was validated by western blotting (Figure 4A). CCK-8 and colony formation assays showed that overexpression of NT5E reversed the inhibitory effects of NOTCH1 knockdown on breast cancer cell proliferation and colony formation (Figure 4B and C). Additionally, transwell and scratch assays demonstrated that NT5E overexpression could reverse the inhibitory effects of NOTCH1 knockdown on breast cancer cell invasion and wound healing (Figure 4D and E). Collectively, our findings demonstrate that NOTCH1 silencing attenuates breast cancer cell proliferation and migration through transcriptional regulation of NT5E expression. To further validate this conclusion, we constructed a mouse xenograft tumor model. In vivo, following NOTCH1 knockout, the tumor volume of TNBC cells was significantly reduced. However, NT5E overexpression was able to reverse the inhibitory effect of NOTCH1 knockdown on TNBC tumor growth (Figure 4F-H).

Figure 4
Figure 4 Knockdown of NOTCH1 decreases NT5E to inhibit breast cancer proliferation and migration both in vitro and in vivo. A: Western blot results validating the efficiency of stable NOTCH1 knockdown combined with stable NT5E overexpression in MDA-MB-231 cells; B and C: CCK-8 and colony formation assay showing that overexpression of NT5E reversed the inhibitory effect of NOTCH1 knockdown on breast cancer cell proliferation and colony formation; D and E: Transwell and scratch assays demonstrating that NT5E overexpression can reverse the inhibitory effect of NOTCH1 knockdown on breast cancer cell invasion and wound healing; F-H: Mouse xenograft tumor model showing that NT5E overexpression reversed the inhibitory effect of NOTCH1 knockdown on triple-negative breast cancer tumorigenesis in vivo. aP < 0.05; bP < 0.01; cP < 0.001.
Knockdown of NOTCH1 decreases NT5E to enhance cisplatin chemotherapy sensitivity in TNBC cells

We have previously shown that knockdown of NOTCH1 can enhance the chemotherapy sensitivity of TNBC cells to cisplatin. NT5E, on the other hand, can reverse the inhibitory effect of NOTCH1 knockdown on breast cancer progression. Therefore, we further investigated whether knockdown of NOTCH1 affects TNBC cell sensitivity to cisplatin through the inhibition of NT5E. The IC50 results showed that re-expression of NT5E in NOTCH1-knockdown cells increased the IC50 value of cisplatin (IC50 = 17.35 μM; Figure 5A). CCK-8 assays demonstrated that knockdown of NOTCH1 further inhibited cell proliferation, indicating that NOTCH1 knockdown increased the sensitivity of cells to cisplatin treatment. However, this effect was reversed by NT5E overexpression (Figure 5B). TUNEL assays also revealed that cisplatin treatment promoted cancer cell apoptosis, and knockdown of NOTCH1 in combination with cisplatin significantly increased the apoptotic rate. This effect was similarly reversed by NT5E overexpression (Figure 5C). These results suggest that in TNBC cells, knockdown of NOTCH1 enhances cisplatin sensitivity by inhibiting the expression of NT5E.

Figure 5
Figure 5 Knockdown of NOTCH1 decreases NT5E to enhance the chemosensitivity of triple-negative breast cancer cells to cisplatin. A: Cisplatin IC50 value analysis showing that re-expression of NT5E in NOTCH1-knockdown cells increased the resistance to cisplatin (IC50 = 17.35 μM); B: CCK-8 assay showing that knockdown of NOTCH1 combined with cisplatin treatment inhibits cell proliferation, but this effect is reversed by NT5E overexpression; C: TUNEL assay showing that knockdown of NOTCH1 combined with cisplatin treatment significantly increases the apoptosis of cells, but this effect is reversed by NT5E overexpression. aP < 0.001.
DISCUSSION

This study investigates the role of NOTCH1 knockdown in TNBC cells. Knockdown of NOTCH1 inhibited the proliferation and migration of TNBC cells in vitro and enhanced their sensitivity to cisplatin chemotherapy, further confirming that NOTCH1 plays a promotive role in the biological progression of TNBC. Furthermore, we explored the potential mechanisms by which NOTCH1 affects cisplatin sensitivity. Knockdown of NOTCH1 resulted in decreased expression of NT5E both in vivo and in vitro, thereby inhibiting the proliferation and migration of TNBC cells, and enhancing their sensitivity to cisplatin. These findings suggest that NOTCH1 and NT5E may synergistically promote TNBC development and could potentially serve as targets for combination therapy.

The role of NOTCH1 in TNBC is complex and multifaceted. It can promote tumor growth, invasion, and metastasis, and is closely related to tumor stem cell characteristics and chemotherapeutic resistance. Studies have shown that the high expression of GRWD1 in TNBC is strongly associated with malignant tumor features. GRWD1 promotes TNBC proliferation, migration, invasion, and anti-apoptotic effects by regulating the Notch signaling pathway[31]. Beauvericin, a natural product, inhibits TNBC invasive and metastatic potential by modulating the NOTCH1 signaling pathway, especially by reversing epithelial-mesenchymal transition[32]. Our results further confirm the role of NOTCH1 in TNBC cells. Stable knockdown of NOTCH1 in MDA-MB-231 cells significantly reduced their proliferation, migration, and invasion.

Given the important role of NOTCH1 in TNBC, targeting the NOTCH1 signaling pathway has become an effective strategy for treating TNBC. For instance, when the γ-secretase inhibitor DAPT is combined with cisplatin, it significantly enhances the antitumor effect of cisplatin, particularly in drug-resistant osteosarcoma cells. Combination therapy notably reduces tumor growth rate and decreases the survival and migration of tumor cells[33]. Due to various complex biological factors, TNBC generally shows poor response to chemotherapy. First, TNBC exhibits high molecular heterogeneity, and different tumor cell subpopulations may respond differently to chemotherapy[34]. Second, TNBC cells often have strong DNA repair capabilities, especially through homologous recombination repair and non-homologous end joining pathways, which repair DNA damage induced by chemotherapeutic drugs[35]. Additionally, TNBC cells often maintain their proliferation, migration, and self-renewal by activating key signaling pathways (such as Notch, Wnt/β-catenin, JAK/STAT, etc.). Abnormal activation of these pathways is also closely related to chemotherapeutic resistance. Inhibiting these pathways may help enhance chemotherapeutic sensitivity[36-38]. Studies have shown that knocking out NOTCH1 can increase the chemotherapeutic sensitivity of both wild-type and drug-resistant MDA-MB-231 cells to doxorubicin[39]. Furthermore, knockdown of NOTCH1 combined with paclitaxel treatment enhances the chemotherapeutic effect on breast cancer stem cells[21]. Our results also show that knockdown of NOTCH1 increases the sensitivity of TNBC MDA-MB-231 cells to cisplatin. These findings provide a theoretical basis for inhibiting NOTCH1 or using NOTCH1 inhibitors in combination to improve the sensitivity and therapeutic efficacy of cisplatin in TNBC patients. Although TNBC treatment involves multiple chemotherapeutic agents, we specifically investigated the role of NOTCH1 in cisplatin sensitivity because of a mechanistic interaction between NOTCH1 signaling and the DNA damage response (DDR)[40,41]. Cisplatin exerts its cytotoxic effects mainly by inducing DNA cross-linking, whereas NOTCH1 has been implicated in the regulation of the DDR pathway[42]. Therefore, targeting NOTCH1 may disrupt repair mechanisms, exacerbate cisplatin-induced DNA damage and improve therapeutic efficacy. These insights provide a solid theoretical basis for combining NOTCH1 inhibitors with cisplatin to improve the efficacy of chemotherapy for TNBC patients.

In addition to targeting NOTCH1 alone, targeting key downstream molecules of NOTCH1 can further improve the chemotherapeutic efficacy on TNBC cells. Studies have shown that during chemotherapy, NOTCH1 and SOX2 jointly regulate tumor cell self-renewal, proliferation, and migration, helping tumor cells evade effective chemotherapeutic attacks, leading to chemotherapeutic resistance. Combination therapy targeting both Notch and SOX2 is considered an effective strategy to reduce tumor cell resistance and restore the efficacy of chemotherapeutic drugs[43]. Recent research has suggested that NOTCH1 promotes cisplatin resistance in TNBC cells by upregulating CD73 (NT5E). The authors demonstrated by chromatin immunoprecipitation and reporter gene assays that the intracellular structural domain of NOTCH1 is able to directly bind the NT5E promoter region and activate its transcription. That is, it is clear that NT5E is a downstream target gene of NOTCH1[22]. NT5E is an extracellular enzyme primarily responsible for converting ATP to AMP and plays a crucial role in maintaining extracellular adenosine levels[44]. Its expression and activity are upregulated in various tumor types, including TNBC. High expression of NT5E can activate extracellular adenosine A2A receptors by increasing the release of adenosine, thereby suppressing the immune response against tumor cells and promoting tumor resistance[45,46]. It has been found that CD73 upregulates SOX9 expression and enhances SOX9 protein stability, thereby activating cancer stem cell-related signaling pathways. Through the CD73-SOX9 axis, HCC cells maintain cancer stem cell resistance to chemotherapy drugs[47]. In drug-resistant breast cancer cells, the CD73-A2AR-Akt-β-catenin signaling pathway promotes growth and metastasis of radiation-resistant breast cancer cells[48]. Additionally, CD73 influences gemcitabine resistance in pancreatic cancer cells through non-canonical mechanisms. Apart from signaling pathways mediated by adenosine receptors, CD73 enhances drug resistance by affecting immune cells, promoting tumor cell metabolic reprogramming, and reducing cell apoptosis[27]. Our results show that knocking down NOTCH1 inhibits TNBC proliferation, invasion, and migration by targeting NT5E. Furthermore, NT5E can reverse the enhanced cisplatin sensitivity in TNBC cells caused by NOTCH1 knockdown. This suggests the potential of combined targeting of NOTCH1 and NT5E, particularly in enhancing TNBC sensitivity to chemotherapeutic drugs, such as cisplatin. Given the synergistic role of NOTCH1 and NT5E in tumor resistance and immune evasion, combination therapy targeting both pathways may be more effective than targeting either one alone. This combined treatment should not only improve chemotherapeutic efficacy, but also mitigate tumor immune evasion, restoring the immune system’s anti-tumor function. These findings provide new theoretical support for targeted therapy in TNBC, and open new directions for future clinical applications.

Although our study reveals the potential roles of NOTCH1 and NT5E in TNBC, several issues remain to be further explored. For example, the other potential molecular mechanisms between NOTCH1 and NT5E are not yet fully understood, and future research could further investigate whether there are other interactions between the two. Moreover, the absence of NT5E knockdown experiments in vivo is a limitation of this study, and subsequent construction of a conditional NT5E knockout mouse model combined with NOTCH1 activation and cisplatin treatment is needed to validate the regulatory mechanism of this pathway in vivo. This study focuses on the NOTCH1/NT5E regulatory network in the MDA-MB-231 cell line, and the generalizability of this mechanism needs to be validated in the future in different TNBC subtypes and patient-derived xenograft models. NOTCH1 signaling plays an important role in TNBC progression and drug resistance, and NOTCH1 blockade can act synergistically with conventional chemotherapeutic agents, such as the previously mentioned doxorubicin and paclitaxel, and by disrupting key survival mechanisms[21,39]. Our study focuses on the synergistic effect of NOTCH1 with cisplatin. Thus further work is warranted to extend these findings to other TNBC-related chemotherapeutic agents, and we will also consider multidrug screening as a key direction for subsequent studies.

Additionally, while our study demonstrates that combined targeting of NOTCH1 and chemotherapy synergistically inhibits TNBC progression, it is important to acknowledge the potential side effects and off-target risks associated with NOTCH1 inhibition. Previous studies have shown that systemic NOTCH1 blockade (e.g., via γ-secretase inhibitors or antibodies) can cause dose-limiting toxicities, including gastrointestinal dysfunction due to goblet cell metaplasia and impaired hematopoiesis[49-51]. Similarly, NT5E (CD73) inhibition, though promising for immune modulation, may disrupt adenosine-mediated tissue protection in non-tumor contexts, such as cardiovascular or neuronal systems[52,53]. These observations underscore the need for tissue-specific delivery strategies (e.g., nanoparticle-based targeting or tumor microenvironment-activated prodrugs) to minimize systemic toxicity. Future studies should rigorously evaluate the safety profile of this combination therapy, including long-term organ function and immune homeostasis, in advanced preclinical models before clinical translation.

This study identifies a critical role for the NOTCH1/NT5E signaling axis in MDA-MB-231 chemoresistance, providing a new direction for the development of targeted intervention strategies. Although the γ-secretase inhibitor DAPT inhibits overall NOTCH signaling by blocking NOTCH receptor cleavage, its non-specificity as a pan-NOTCH inhibitor may limit clinical efficacy[54,55]. DAPT concurrently inhibits NOTCH1-4 activation, and studies have shown that NOTCH1, NOTCH3 and NOTCH4 are oncogenic in breast cancer[56,57]. However, NOTCH2 is oncogenic in some TNBC subtypes[58]. These limitations suggest that the development of selective NOTCH1 inhibitors is essential to achieve precision therapy.

CONCLUSION

In conclusion, our study emphasizes the important role of NOTCH1 and its downstream target NT5E in regulating cisplatin sensitivity and TNBC cell progression. By inhibiting cell proliferation and migration, NOTCH1 knockdown enhances cisplatin sensitivity, suggesting that co-targeting NOTCH1 and NT5E improves chemotherapeutic efficacy. These findings provide new perspectives for the development of TNBC-targeted therapies, but further studies on their molecular mechanisms and clinical applications are needed.

ACKNOWLEDGEMENTS

We are thankful to Prof. Stanley Lin for his critical and careful editing and proofreading of the manuscript.

References
1.  Geyer FC, Pareja F, Weigelt B, Rakha E, Ellis IO, Schnitt SJ, Reis-Filho JS. The Spectrum of Triple-Negative Breast Disease: High- and Low-Grade Lesions. Am J Pathol. 2017;187:2139-2151.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 75]  [Cited by in RCA: 140]  [Article Influence: 15.6]  [Reference Citation Analysis (0)]
2.  Zagami P, Carey LA. Triple negative breast cancer: Pitfalls and progress. NPJ Breast Cancer. 2022;8:95.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 587]  [Reference Citation Analysis (0)]
3.  Yagata H, Kajiura Y, Yamauchi H. Current strategy for triple-negative breast cancer: appropriate combination of surgery, radiation, and chemotherapy. Breast Cancer. 2011;18:165-173.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 75]  [Cited by in RCA: 96]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
4.  Wu J, Li S, Jia W, Su F. Response and prognosis of taxanes and anthracyclines neoadjuvant chemotherapy in patients with triple-negative breast cancer. J Cancer Res Clin Oncol. 2011;137:1505-1510.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 33]  [Cited by in RCA: 31]  [Article Influence: 2.1]  [Reference Citation Analysis (1)]
5.  Mason SR, Willson ML, Egger SJ, Beith J, Dear RF, Goodwin A. Platinum-based chemotherapy for early triple-negative breast cancer. Cochrane Database Syst Rev. 2023;9:CD014805.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 26]  [Article Influence: 8.7]  [Reference Citation Analysis (0)]
6.  Chai Y, Chen Y, Zhang D, Wei Y, Li Z, Li Q, Xu B. Homologous Recombination Deficiency (HRD) and BRCA 1/2 Gene Mutation for Predicting the Effect of Platinum-Based Neoadjuvant Chemotherapy of Early-Stage Triple-Negative Breast Cancer (TNBC): A Systematic Review and Meta-Analysis. J Pers Med. 2022;12.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 43]  [Cited by in RCA: 39]  [Article Influence: 9.8]  [Reference Citation Analysis (1)]
7.  Zhang Y, Berger SA. Ketotifen reverses MDR1-mediated multidrug resistance in human breast cancer cells in vitro and alleviates cardiotoxicity induced by doxorubicin in vivo. Cancer Chemother Pharmacol. 2003;51:407-414.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 21]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
8.  Jabbour-Leung NA, Chen X, Bui T, Jiang Y, Yang D, Vijayaraghavan S, McArthur MJ, Hunt KK, Keyomarsi K. Sequential Combination Therapy of CDK Inhibition and Doxorubicin Is Synthetically Lethal in p53-Mutant Triple-Negative Breast Cancer. Mol Cancer Ther. 2016;15:593-607.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 53]  [Article Influence: 5.3]  [Reference Citation Analysis (1)]
9.  Li DD, Qin XC, Yang Y, Chu HX, Li RL, Ma LX, Ding HW, Zhao QC. Daurinoline suppressed the migration and invasion of chemo-resistant human non-small cell lung cancer cells by reversing EMT and Notch-1 and sensitized the cells to Taxol. Environ Toxicol Pharmacol. 2019;66:109-115.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 9]  [Article Influence: 1.3]  [Reference Citation Analysis (4)]
10.  Duran CL, Karagiannis GS, Chen X, Sharma VP, Entenberg D, Condeelis JS, Oktay MH. Cooperative NF-κB and Notch1 signaling promotes macrophage-mediated MenaINV expression in breast cancer. Breast Cancer Res. 2023;25:37.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 12]  [Cited by in RCA: 12]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
11.  Pei J, Zhang S, Yang X, Han C, Pan Y, Li J, Wang Z, Sun C, Zhang J. Epigenetic regulator KDM4A activates Notch1-NICD-dependent signaling to drive tumorigenesis and metastasis in breast cancer. Transl Oncol. 2023;28:101615.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 14]  [Reference Citation Analysis (0)]
12.  Chen M, Pan Y, Liu H, Ning F, Lu Q, Duan Y, Gan X, Lu S, Hou H, Zhang M, Tian Y, Lash GE. Ezrin accelerates breast cancer liver metastasis through promoting furin-like convertase-mediated cleavage of Notch1. Cell Oncol (Dordr). 2023;46:571-587.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 10]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
13.  Andersson ER, Sandberg R, Lendahl U. Notch signaling: simplicity in design, versatility in function. Development. 2011;138:3593-3612.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 671]  [Cited by in RCA: 738]  [Article Influence: 49.2]  [Reference Citation Analysis (0)]
14.  Allenspach EJ, Maillard I, Aster JC, Pear WS. Notch signaling in cancer. Cancer Biol Ther. 2002;1:466-476.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 223]  [Cited by in RCA: 230]  [Article Influence: 9.6]  [Reference Citation Analysis (0)]
15.  Bray SJ. Notch signalling: a simple pathway becomes complex. Nat Rev Mol Cell Biol. 2006;7:678-689.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2189]  [Cited by in RCA: 2053]  [Article Influence: 102.7]  [Reference Citation Analysis (4)]
16.  Kandasamy K, Mohan SS, Raju R, Keerthikumar S, Kumar GS, Venugopal AK, Telikicherla D, Navarro JD, Mathivanan S, Pecquet C, Gollapudi SK, Tattikota SG, Mohan S, Padhukasahasram H, Subbannayya Y, Goel R, Jacob HK, Zhong J, Sekhar R, Nanjappa V, Balakrishnan L, Subbaiah R, Ramachandra YL, Rahiman BA, Prasad TS, Lin JX, Houtman JC, Desiderio S, Renauld JC, Constantinescu SN, Ohara O, Hirano T, Kubo M, Singh S, Khatri P, Draghici S, Bader GD, Sander C, Leonard WJ, Pandey A. NetPath: a public resource of curated signal transduction pathways. Genome Biol. 2010;11:R3.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 437]  [Cited by in RCA: 365]  [Article Influence: 22.8]  [Reference Citation Analysis (0)]
17.  Ma W, Zhang L, Chen W, Chang Z, Tu J, Qin Y, Yao Y, Dong M, Ding J, Li S, Li F, Deng Q, Yang Y, Feng T, Zhang F, Shao X, He X, Zhang L, Hu G, Liu Q, Jiang YZ, Zhu S, Xiao Z, Su D, Liu T, Liu S. Microbiota enterotoxigenic Bacteroides fragilis-secreted BFT-1 promotes breast cancer cell stemness and chemoresistance through its functional receptor NOD1. Protein Cell. 2024;15:419-440.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 69]  [Cited by in RCA: 55]  [Article Influence: 27.5]  [Reference Citation Analysis (0)]
18.  Cheng Y, Lin L, Li X, Lu A, Hou C, Wu Q, Hu X, Zhou Z, Chen Z, Tang F. ADAM10 is involved in the oncogenic process and chemo-resistance of triple-negative breast cancer via regulating Notch1 signaling pathway, CD44 and PrPc. Cancer Cell Int. 2021;21:32.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 8]  [Cited by in RCA: 36]  [Article Influence: 7.2]  [Reference Citation Analysis (0)]
19.  Chen NN, Zhou KF, Miao Z, Chen YX, Cui JX, Su SW. Exosomes regulate doxorubicin resistance in breast cancer via miR-34a-5p/NOTCH1. Mol Cell Probes. 2024;76:101964.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 10]  [Reference Citation Analysis (0)]
20.  Huang J, Chen Y, Li J, Zhang K, Chen J, Chen D, Feng B, Song H, Feng J, Wang R, Chen L. Notch-1 Confers Chemoresistance in Lung Adenocarcinoma to Taxanes through AP-1/microRNA-451 Mediated Regulation of MDR-1. Mol Ther Nucleic Acids. 2016;5:e375.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 24]  [Cited by in RCA: 43]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
21.  Mao J, Song B, Shi Y, Wang B, Fan S, Yu X, Tang J, Li L. ShRNA targeting Notch1 sensitizes breast cancer stem cell to paclitaxel. Int J Biochem Cell Biol. 2013;45:1064-1073.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 27]  [Cited by in RCA: 30]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
22.  Qi Y, Li M, Li S, Zeng D, Xiao Y, Li J, Ye Q, Bremer E, Zhang GJ. Notch1 promotes resistance to cisplatin by up-regulating Ecto-5'-nucleotidase (CD73) in triple-negative breast cancer cells. Cell Death Discov. 2023;9:204.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 14]  [Reference Citation Analysis (0)]
23.  Allard B, Longhi MS, Robson SC, Stagg J. The ectonucleotidases CD39 and CD73: Novel checkpoint inhibitor targets. Immunol Rev. 2017;276:121-144.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 576]  [Cited by in RCA: 761]  [Article Influence: 84.6]  [Reference Citation Analysis (0)]
24.  Loi S, Pommey S, Haibe-Kains B, Beavis PA, Darcy PK, Smyth MJ, Stagg J. CD73 promotes anthracycline resistance and poor prognosis in triple negative breast cancer. Proc Natl Acad Sci U S A. 2013;110:11091-11096.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 315]  [Cited by in RCA: 407]  [Article Influence: 31.3]  [Reference Citation Analysis (1)]
25.  Petruk N, Tuominen S, Åkerfelt M, Mattsson J, Sandholm J, Nees M, Yegutkin GG, Jukkola A, Tuomela J, Selander KS. CD73 facilitates EMT progression and promotes lung metastases in triple-negative breast cancer. Sci Rep. 2021;11:6035.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 55]  [Article Influence: 11.0]  [Reference Citation Analysis (0)]
26.  Zhu J, Du W, Zeng Y, Liu T, Li J, Wang A, Li Y, Zhang W, Huang JA, Liu Z. CD73 promotes non-small cell lung cancer metastasis by regulating Axl signaling independent of GAS6. Proc Natl Acad Sci U S A. 2024;121:e2404709121.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 10]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
27.  Yu X, Liu W, Wang Z, Wang H, Liu J, Huang C, Zhao T, Wang X, Gao S, Ma Y, Wu L, Li X, Yang S, Hao J. CD73 induces gemcitabine resistance in pancreatic ductal adenocarcinoma: A promising target with non-canonical mechanisms. Cancer Lett. 2021;519:289-303.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 32]  [Cited by in RCA: 26]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
28.  Wu Y, Yuan MH, Wu HT, Chen WJ, Zhang ML, Ye QQ, Liu J, Zhang GJ. MicroRNA-488 inhibits proliferation and motility of tumor cells via downregulating FSCN1, modulated by Notch3 in breast carcinomas. Cell Death Dis. 2020;11:912.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 21]  [Cited by in RCA: 22]  [Article Influence: 3.7]  [Reference Citation Analysis (0)]
29.  Li C, Tang Z, Zhang W, Ye Z, Liu F. GEPIA2021: integrating multiple deconvolution-based analysis into GEPIA. Nucleic Acids Res. 2021;49:W242-W246.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 164]  [Cited by in RCA: 390]  [Article Influence: 78.0]  [Reference Citation Analysis (0)]
30.  Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, Sun Y, Jacobsen A, Sinha R, Larsson E, Cerami E, Sander C, Schultz N. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 2013;6:pl1.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11788]  [Cited by in RCA: 12013]  [Article Influence: 924.1]  [Reference Citation Analysis (8)]
31.  Yao L, Tian F. GRWD1 affects the proliferation, apoptosis, invasion and migration of triple negative breast cancer through the Notch signaling pathway. Exp Ther Med. 2022;24:473.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 7]  [Reference Citation Analysis (1)]
32.  Patra A, Arora A, Ghosh SS, Kaur Saini G. Beauvericin Reverses Epithelial-to-Mesenchymal Transition in Triple-Negative Breast Cancer Cells through Regulation of Notch Signaling and Autophagy. ACS Pharmacol Transl Sci. 2024;7:2878-2893.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
33.  Dai G, Deng S, Guo W, Yu L, Yang J, Zhou S, Gao T. Notch pathway inhibition using DAPT, a γ-secretase inhibitor (GSI), enhances the antitumor effect of cisplatin in resistant osteosarcoma. Mol Carcinog. 2019;58:3-18.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 49]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
34.  Asleh K, Riaz N, Nielsen TO. Heterogeneity of triple negative breast cancer: Current advances in subtyping and treatment implications. J Exp Clin Cancer Res. 2022;41:265.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 156]  [Reference Citation Analysis (0)]
35.  Nath A, Mitra S, Mistry T, Pal R, Nasare VD. Molecular targets and therapeutics in chemoresistance of triple-negative breast cancer. Med Oncol. 2021;39:14.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 29]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
36.  Speiser JJ, Erşahin C, Osipo C. The functional role of Notch signaling in triple-negative breast cancer. Vitam Horm. 2013;93:277-306.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 28]  [Cited by in RCA: 38]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
37.  Merikhian P, Eisavand MR, Farahmand L. Triple-negative breast cancer: understanding Wnt signaling in drug resistance. Cancer Cell Int. 2021;21:419.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 15]  [Cited by in RCA: 82]  [Article Influence: 16.4]  [Reference Citation Analysis (0)]
38.  Furth PA. STAT signaling in different breast cancer sub-types. Mol Cell Endocrinol. 2014;382:612-615.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 52]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
39.  Alkaraki A, Alshaer W, Wehaibi S, Gharaibeh L, Abuarqoub D, Alqudah DA, Al-Azzawi H, Zureigat H, Souleiman M, Awidi A. Enhancing chemosensitivity of wild-type and drug-resistant MDA-MB-231 triple-negative breast cancer cell line to doxorubicin by silencing of STAT 3, Notch-1, and β-catenin genes. Breast Cancer. 2020;27:989-998.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 32]  [Article Influence: 5.3]  [Reference Citation Analysis (0)]
40.  Miao K, Lei JH, Valecha MV, Zhang A, Xu J, Wang L, Lyu X, Chen S, Miao Z, Zhang X, Su SM, Shao F, Rajendran BK, Bao J, Zeng J, Sun H, Chen P, Tan K, Chen Q, Wong KH, Xu X, Deng CX. NOTCH1 activation compensates BRCA1 deficiency and promotes triple-negative breast cancer formation. Nat Commun. 2020;11:3256.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 25]  [Cited by in RCA: 81]  [Article Influence: 13.5]  [Reference Citation Analysis (0)]
41.  Vermezovic J, Adamowicz M, Santarpia L, Rustighi A, Forcato M, Lucano C, Massimiliano L, Costanzo V, Bicciato S, Del Sal G, d'Adda di Fagagna F. Notch is a direct negative regulator of the DNA-damage response. Nat Struct Mol Biol. 2015;22:417-424.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 57]  [Cited by in RCA: 71]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
42.  Ming X, Michaelson-Richie ED, Groehler AS 4th, Villalta PW, Campbell C, Tretyakova NY. Cross-linking of the DNA repair protein O(6)-alkylguanine DNA alkyltransferase to DNA in the presence of cisplatin. DNA Repair (Amst). 2020;89:102840.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 10]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
43.  Li X, Tao Z, Wang H, Deng Z, Zhou Y, Du Z. Dual inhibition of Src and PLK1 regulate stemness and induce apoptosis through Notch1-SOX2 signaling in EGFRvIII positive glioma stem cells (GSCs). Exp Cell Res. 2020;396:112261.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 12]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
44.  Gao ZW, Dong K, Zhang HZ. The roles of CD73 in cancer. Biomed Res Int. 2014;2014:460654.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 81]  [Cited by in RCA: 150]  [Article Influence: 12.5]  [Reference Citation Analysis (0)]
45.  Bach N, Winzer R, Tolosa E, Fiedler W, Brauneck F. The Clinical Significance of CD73 in Cancer. Int J Mol Sci. 2023;24.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 52]  [Reference Citation Analysis (0)]
46.  Sun BY, Zhang D, Gan W, Wu JF, Wang ZT, Sun GQ, Zhou J, Fan J, Yi Y, Hu B, Zhang BH, Qiu SJ. Targeting CD73 limits tumor progression and enhances anti-tumor activity of anti-PD-1 therapy in intrahepatic cholangiocarcinoma. J Cancer Res Clin Oncol. 2024;150:348.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 13]  [Reference Citation Analysis (0)]
47.  Ma XL, Hu B, Tang WG, Xie SH, Ren N, Guo L, Lu RQ. CD73 sustained cancer-stem-cell traits by promoting SOX9 expression and stability in hepatocellular carcinoma. J Hematol Oncol. 2020;13:11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 33]  [Cited by in RCA: 122]  [Article Influence: 20.3]  [Reference Citation Analysis (0)]
48.  Jin H, Lee JS, Kim DC, Ko YS, Lee GW, Kim HJ. Increased Extracellular Adenosine in Radiotherapy-Resistant Breast Cancer Cells Enhances Tumor Progression through A2AR-Akt-β-Catenin Signaling. Cancers (Basel). 2021;13.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 21]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
49.  van Es JH, van Gijn ME, Riccio O, van den Born M, Vooijs M, Begthel H, Cozijnsen M, Robine S, Winton DJ, Radtke F, Clevers H. Notch/gamma-secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature. 2005;435:959-963.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1316]  [Cited by in RCA: 1233]  [Article Influence: 58.7]  [Reference Citation Analysis (8)]
50.  Real PJ, Tosello V, Palomero T, Castillo M, Hernando E, de Stanchina E, Sulis ML, Barnes K, Sawai C, Homminga I, Meijerink J, Aifantis I, Basso G, Cordon-Cardo C, Ai W, Ferrando A. Gamma-secretase inhibitors reverse glucocorticoid resistance in T cell acute lymphoblastic leukemia. Nat Med. 2009;15:50-58.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 373]  [Cited by in RCA: 354]  [Article Influence: 20.8]  [Reference Citation Analysis (0)]
51.  Kannan S, Sutphin RM, Hall MG, Golfman LS, Fang W, Nolo RM, Akers LJ, Hammitt RA, McMurray JS, Kornblau SM, Melnick AM, Figueroa ME, Zweidler-McKay PA. Notch activation inhibits AML growth and survival: a potential therapeutic approach. J Exp Med. 2013;210:321-337.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 103]  [Cited by in RCA: 129]  [Article Influence: 9.9]  [Reference Citation Analysis (1)]
52.  Borg N, Alter C, Görldt N, Jacoby C, Ding Z, Steckel B, Quast C, Bönner F, Friebe D, Temme S, Flögel U, Schrader J. CD73 on T Cells Orchestrates Cardiac Wound Healing After Myocardial Infarction by Purinergic Metabolic Reprogramming. Circulation. 2017;136:297-313.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 39]  [Cited by in RCA: 69]  [Article Influence: 7.7]  [Reference Citation Analysis (0)]
53.  Eckle T, Krahn T, Grenz A, Köhler D, Mittelbronn M, Ledent C, Jacobson MA, Osswald H, Thompson LF, Unertl K, Eltzschig HK. Cardioprotection by ecto-5'-nucleotidase (CD73) and A2B adenosine receptors. Circulation. 2007;115:1581-1590.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 348]  [Cited by in RCA: 377]  [Article Influence: 19.8]  [Reference Citation Analysis (0)]
54.  Han J, Shen Q. Targeting γ-secretase in breast cancer. Breast Cancer (Dove Med Press). 2012;4:83-90.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 14]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
55.  Farnie G, Clarke RB. Mammary stem cells and breast cancer--role of Notch signalling. Stem Cell Rev. 2007;3:169-175.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 277]  [Cited by in RCA: 253]  [Article Influence: 13.3]  [Reference Citation Analysis (3)]
56.  Hu C, Diévart A, Lupien M, Calvo E, Tremblay G, Jolicoeur P. Overexpression of activated murine Notch1 and Notch3 in transgenic mice blocks mammary gland development and induces mammary tumors. Am J Pathol. 2006;168:973-990.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 133]  [Cited by in RCA: 153]  [Article Influence: 7.7]  [Reference Citation Analysis (0)]
57.  Harrison H, Farnie G, Howell SJ, Rock RE, Stylianou S, Brennan KR, Bundred NJ, Clarke RB. Regulation of breast cancer stem cell activity by signaling through the Notch4 receptor. Cancer Res. 2010;70:709-718.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 431]  [Cited by in RCA: 415]  [Article Influence: 25.9]  [Reference Citation Analysis (0)]
58.  Kim SH, Hahm ER, Arlotti JA, Samanta SK, Moura MB, Thorne SH, Shuai Y, Anderson CJ, White AG, Lokshin A, Lee J, Singh SV. Withaferin A inhibits in vivo growth of breast cancer cells accelerated by Notch2 knockdown. Breast Cancer Res Treat. 2016;157:41-54.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 33]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Invited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Oncology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade B, Grade C, Grade C

Novelty: Grade B, Grade B, Grade C

Creativity or Innovation: Grade B, Grade C, Grade C

Scientific Significance: Grade B, Grade B, Grade C

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Demirli Atici S; Shen D; Zhu G S-Editor: Lin C L-Editor: A P-Editor: Zhang L

Write to the Help Desk