BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Stem Cells. Sep 26, 2026; 18(9): 123933
Published online Sep 26, 2026. doi: 10.4252/wjsc.123933
Experimental study on ultrasound-targeted microbubble destruction promoting the proliferation, migration of human umbilical cord mesenchymal stem cells
Pan Zhang, Man-Li Zhang, Burleshan Rewan, Ling-Yun Zhang, Xiao-Lin La, Reproductive Medicine Center, The First Affiliated Hospital of Xinjiang Medical University, State Key Laboratory of Pathogenesis, Prevention and Treatment of High Incidence Diseases in Central Asia, Urumqi 830054, Xinjiang Uygur Autonomous Region, China
Bo-Ya La, State Key Laboratory of Reproductive Medicine and Offspring Health, Center of Clinical Reproductive Medicine, First Affiliated Hospital, Nanjing Medical University, Nanjing 210029, Jiangsu Province, China
Man-Li Zhang, Xiao-Lin La, Xinjiang Medical University Clinical Medical Research Centre of Reproductive Diseases and Birth Defects Urumqi, Urumqi 830054, Xinjiang Uygur Autonomous Region, China
Xiao-Lin La, Xinjiang Clinical Research Centre for Reproductive Immunology, The First Affiliated Hospital of Xinjiang Medical University, Urumqi 830054, Xinjiang Uygur Autonomous Region, China
Xiao-Lin La, State Key Laboratory of Pathogenesis, Prevention, and Treatment of High Incidence Diseases in Central Asia, Xinjiang Medical University, Urumqi 830054, Xinjiang Uygur Autonomous Region, China
ORCID number: Xiao-Lin La (0009-0005-1005-7291).
Co-first authors: Pan Zhang and Bo-Ya La.
Author contributions: Zhang P and La BY was in charge of experimental operation, manuscript preparation, data collection and summarisation, as well as statistic calculation, they contributed equally to this manuscript and are co-first authors; Zhang ML was in charge of research supervision and advice from this study, revised the draft; Rewan B was in charge of experimental operation; Zhang LY was in charge of data collection and summarisation; La XL supervised the paper’s final editing process, funded this project.
AI contribution statement: AI tools (Doubao/Deepseek) were used solely for linguistic refinement and formatting assistance. No AI tool was involved in the generation of research data, interpretation of results, or formulation of conclusions. All AI-generated outputs were critically reviewed and revised by the authors.
Supported by the Health Science and Technology Plan Project of the Autonomous Region - Innovative Research Project, No. 2025001CXKMYM650030870; Open Project of the State Key Laboratory of Pathogenesis, Prevention and Treatment of High Incidence Diseases in Central Asia, No. SKL-HIDCA-2024-GX2; and Tianshan Talents Leading Talent Project for Medicine and Health Care, No. TSYC202401A023.
Institutional review board statement: The study was reviewed and approved by the First Affiliated Hospital of Xinjiang Medical University Institutional Review Board (Approval No. 260414-09).
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
Data sharing statement: The raw RNA-seq data generated in this study are available from the corresponding author upon reasonable request. Researchers who wish to access the data should contact the corresponding author via email.
Corresponding author: Xiao-Lin La, Reproductive Medicine Center, The First Affiliated Hospital of Xinjiang Medical University, State Key Laboratory of Pathogenesis, Prevention and Treatment of High Incidence Diseases in Central Asia, No. 137 South Liyushan Road, Xinshi District, Urumqi 830054, Xinjiang Uygur Autonomous Region, China. 909232905@qq.com
Received: June 3, 2026
Revised: July 12, 2026
Accepted: September 16, 2026
Published online: September 26, 2026
Processing time: 114 Days and 24 Hours

Abstract
BACKGROUND

Enhancing the homing and migratory capacity of transplanted human umbilical cord mesenchymal stem cells (hUCMSCs) is critical for regenerative medicine. Ultrasound-targeted microbubble destruction (UTMD) is a non-invasive strategy with therapeutic potential; however, its optimal parameters and underlying mechanisms for promoting hUCMSC migration require further elucidation.

AIM

To investigate the effects of microbubble (MB) concentration and ultrasound duration on hUCMSC proliferation and migration and the C-X-C chemokine receptor type 4 (CXCR4) axis.

METHODS

MBs were characterized by optical microscopy and zeta potential analysis. hUCMSCs were identified by flow cytometry, immunofluorescence, and trilineage differentiation assays. Optimal MB concentration (ranging from 101 to 108 MBs/mL) was screened via Cell Counting Kit-8 assay. Subsequently, UTMD exposure duration were optimized (60-600 seconds at 0.8 W/cm2, 2.4 MHz) by assessing cell proliferation and migration. Under optimal conditions, CXCR4 expression (quantitative real-time polymerase chain reaction, western blot, immunofluorescence), apoptosis (flow cytometry), and transcriptome changes (RNA sequencing) were assessed.

RESULTS

The SF6 MBs have a uniform size (1010 ± 178 nm) and a zeta potential of -13.5 mV. An MB concentration of 1 × 107 MBs/mL was determined to be the optimal level, showing no significant cytotoxicity. UTMD acted time-dependently on hUCMSCs. UTMD300s performed the best in cell proliferation (> 30%, P < 0.001) and migration (P < 0.05). Exposure > 300 s impaired cell viability and migration. Optimized UTMD upregulated CXCR4 expression in hUCMSCs (P < 0.05). Apoptosis assays verified the biosafety of UTMD300s. RNA sequencing revealed 159 differentially expressed genes (83 upregulated, 76 downregulated). These differentially expressed genes were mainly enriched in unsaturated fatty acid biosynthesis, 5-hydroxytryptamine receptor binding, and phospholipid metabolism pathways, with hub genes including SCD, INSIG1, HMGCS1, and ABCG1.

CONCLUSION

When UTMD300s is combined with MBs 107/mL, it can promote hUCMSC proliferation, migration, and significantly upregulate the expression of CXCR4 at both transcriptional and protein levels.

Key Words: Human umbilical cord mesenchymal stem cells; Ultrasound-targeted microbubble destruction technology; Migration; C-X-C chemokine receptor type 4; Microbubbles

Core Tip: Enhancing the migratory capacity of transplanted human umbilical cord mesenchymal stem cells (hUCMSCs) remains a critical challenge in regenerative medicine. Ultrasound-targeted microbubble destruction (UTMD) is a promising non-invasive physical intervention, yet its optimal parameters and underlying mechanisms for promoting hUCMSC migration require further elucidation. Here, we introduce that when the microbubbles concentration is 1 × 107 particles/mL and the ultrasound exposure time is 300 seconds, UTMD technology can promote cell proliferation, migration by upregulating the expression levels of the C-X-C chemokine receptor type 4 gene and protein in hUCMSCs.



INTRODUCTION

Mesenchymal stem cells (MSCs) are characterized by their capacity for self-renewal and multipotent differentiation potential[1,2]. It represent potential candidates for regenerative therapy due to due to their immunomodulatory properties and tumor tropism. MSCs show tremendous application prospects in tissue repair and regenerative medicine owing to their strong multidirectional differentiation potential, good immunomodulatory properties, and low immunogenicity[3]. Human umbilical cord MSCs (hUCMSCs), as an important source of MSCs, possess advantages such as convenient collection, abundant availability, strong proliferation ability[4], and the least ethical controversy, and have now become a research hotspot for treating various reproductive diseases. Currently, the main methods for MSCs transplantation are in situ transplantation or intravenous infusion. Although in situ transplantation offers high cell utilization, it is typically invasive and prone to uneven cell distribution, which to some extent limits the clinical application of MSCs. Intravenous injection is the least invasive, lowest-risk, and most commonly used transplantation method[5]; however, MSCs often face problems such as low survival rate after transplantation in vivo[6]. Ultrasound-targeted microbubble destruction (UTMD) is an emerging physical intervention strategy with notable potential in drug delivery, gene transfer, and tumor treatment. This is mainly attributed to its non-invasive nature[7,8] and controllable operation[9]. By exploiting the interaction between ultrasound and microbubbles (MBs), UTMD enables therapeutic agents such as drugs and genes to be delivered to specific sites and released locally. This targeted release approach can improve treatment efficiency while reducing unintended injury to surrounding normal tissues[10]. UTMD technology generates cavitation effects through the interaction between ultrasound waves and MBs, thereby forming transient micropores on the cell membrane and increasing cell permeability[11] is technical characteristic makes it a non-invasive or minimally invasive method, avoiding surgical trauma caused by intravenous injection and utilizing the ultrasound cavitation effect to enhance local vascular permeability, thereby improving targeted efficiency.

However, systematic studies on the effects of UTMD on the proliferation, migration capacity of hUCMSCs remain limited[12] and the underlying molecular mechanisms have not been fully elucidated. To address this gap, this in vitro study aims to achieve two main goals: To evaluate the effects of UTMD on the proliferation, migration, and related gene expression of hUCMSCs, and to determine the optimal ultrasound exposure duration for these cells[13] trough this experimental approach, we aim to provide both theoretical and experimental evidence that UTMD can enhance the transplantation efficiency of hUCMSCs, thereby enhancing hUCMSC transplantation efficiency in regenerative medicine.

MATERIALS AND METHODS
Materials

CO2 incubator (Thermo Fisher, San Jose, CA, United States); flow cytometry antibodies against CD105, CD73, CD90, CD29, CD44, CD45, CD34, CD19, CD11B, CD106, CD14, CD133, and HLA-DR (Becton, Dickinson and Company, Franklin Lakes, NJ, United States), goat serum (Boster, AR1009, Wuhan, Hubei Province, China), rabbit anti-CD90 primary antibody (Bioss, bs-0778R, Beijing, China), mouse anti-C-X-C chemokine receptor type 4 (CXCR4) primary antibody CY3 conjugated goat anti rabbit IgG antibody (Boster, BA1032, Wuhan, Hubei Province, China) DAPI (Beyotime, C1002, Shanghai, China), adipogenic differentiation kit/osteogenic differentiation kit/chondrogenic differentiation kit (Wuhan Procell Biotechnology Co., Ltd., Wuhan, Hubei Province, China), Cell Counting Kit-8 (CCK-8) kit (Beyotime Biotech Inc, Shanghai, China), ultrasonic instrument (Shenzhen Suwo Medical Technology Co., Ltd., Shenzhen, Guangdong Province, China), quantitative real-time polymerase chain reaction (qPCR) system (Thermo Fisher, San Jose, CA, United States), rabbit anti-CXCR4 (Proteintech Group, Inc. Wuhan, Hubei Province, China), mouse anti-GAPDH (Proteintech Group, Inc. Wuhan, Hubei Province, China), HRP-conjugated goat anti-rabbit (Proteintech Group, Inc. Wuhan, Hubei Province, China), goat anti-mouse (Proteintech Group, Inc. Wuhan, Hubei Province, China), enhanced ECL kit (Hefei Baisha Biotechnology Co., Ltd., Anhui, Hefei Province, China) SCG-W3000 PLUS imaging system (Wuhan Seville Biotechnology Co., Ltd., Wuhan, Hubei Province, China), GraphPad Prism 10.1 software (GraphPad, La Jolla, CA, United States).

MB physicochemical characterization

Sulfur hexafluoride MBs were formulated into a 45 μg/mL suspension with sterile normal saline, followed by vortexing for 20 seconds. A total of 10 μL of the suspension was dropped onto a glass slide, and the morphology and distribution of MBs were observed under a 400 × optical microscope. The particle size and zeta potential were measured in triplicate with a zeta potential analyzer; mean values were adopted for analysis.

Collection of hUCMSCs

This study was approved by the Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University (Approval No. 260414-09). Umbilical cords (n = 30) were collected from consenting parturients from March 2025 to August 2025. All participants underwent maternal serological testing within one month prior to delivery, which verified negative results for hepatitis B virus, hepatitis C virus, Treponema pallidum, human immunodeficiency virus and cytomegalovirus. Prior to sampling, written informed consent forms had been obtained from each pregnant woman and her family members. The cleaned tissues were then placed in sterile containers filled with tissue preservation solution and tightly sealed. Samples were transported under low-temperature conditions in a biological specimen transport box to Wuhan Procell Life Science & Technology Co., Ltd., for standardized hUCMSC isolation.

Culture and subculture of hUCMSCs

hUCMSCs were cultured in a 37 °C, 5% CO2 incubator using a specific culture medium. When cell confluence reached approximately 80%-90%, hUCMSCs were subcultured and cryopreserved following standard cell culture protocols. Subculture was performed by treating cells with trypsin under microscopic observation; digestion was quenched with a twofold volume of complete[14] medium upon approximately 50% cell detachment and rounding. The suspension was centrifuged, the supernatant was removed, and the resulting precipitate was resuspended in complete medium. Cells were seeded into T25 culture flasks at a 1:2 split ratio (final culture volume: 5 mL). The medium was replaced every 2-3 days.

Flow cytometric detection of hUCMSC surface markers

Of 5 μL of fluorescently labeled anti-human monoclonal antibodies against CD105, CD73, CD90, CD29, CD44, CD45, CD34, CD19, CD11b, CD106, CD14, CD133, and HLA-DR were added to each tube, while isotype-matched antibodies served as negative controls. The samples were incubated for 30 minutes on ice in the dark. After centrifugation, cells were washed twice with phosphate buffered saline (PBS) to remove unbound antibodies, then incubated with fluorophore-conjugated secondary antibodies for 30 minutes at 4 °C in the dark. Each sample was resuspended in 500 μL flow cytometry staining buffer by repeated pipetting to obtain single-cell suspensions. Samples were analyzed immediately by flow cytometry to quantify surface marker expression (% positive cells).

Immunofluorescence

hUCMSCs grown to ~80% confluence in 6-well plates were fixed for 20 minutes and washed three times with PBS. hUCMSCs were blocked with normal goat serum (Boster, AR1009, Wuhan, Hubei Province, China) for 30 minutes, then incubated overnight at 4 °C with rabbit anti-CD90 (Bioss, bs-0778R, Beijing, China) and mouse anti-CXCR4 (1:200; Proteintech, Wuhan, Hubei Province, China). The next day, hUCMSCs were washed three times with PBST and incubated with CY3-conjugated goat anti-rabbit IgG antibody (1:200; Boster, BA1032, Wuhan, Hubei Province, China) for 1 hour at room temperature. Nuclei were stained with DAPI (Beyotime, C1002, Shanghai, China) for 5 minutes. After final washes, samples were mounted in anti-fade medium and imaged by fluorescence microscopy to assess CD90/CXCR4 expression, subcellular localization, and staining intensity distribution.

In vitro multipotency assay of hUCMSCs

hUCMSCs underwent adipogenic, osteogenic and chondrogenic differentiation experiments. Cells were cultured in respective induction media for 21 days in accordance with the manufacturer’s protocols. Upon completion of induction, the formation of lipid droplets in the adipogenic cultures was evaluated by Oil Red O staining, while mineralized nodule deposition in osteogenic cultures was evaluated by Alizarin Red staining. For chondrogenic differentiation, cell pellets cultured in centrifuge tubes were fixed after 72 hours of culture to stain for alcian blue. Then, the cross-sectional areas of the obtained cartilage spheres were observed through a microscope.

Screening of the optimal MB concentration for coculture with hUCMSCs and safety evaluation by CCK-8 assay

MBs were prepared as specified by the manufacturer, diluted with hUCMSCs culture medium to achieve final particle concentrations of 1 × 101, 1 × 101, 1 × 103, 1 × 104, 1 × 105, 1 × 106, 1 × 107, and 1 × 108 MBs/mL. hUCMSCs were seeded into 96-well plates at a density of 3 × 103 cells per well following the experimental protocol of the CCK-8 kit. After 12 hours of incubation at 37 °C to allow full cell attachment, the supernatant was discarded and replaced with fresh complete medium containing serially diluted MBs. After adding another 48 hours of cultivation, 10 μL of CCK-8 working solution was added to each well on the plate, followed by a further 4 hours in normal culture conditions. Absorbance measurements were conducted using a microplate reader at a wavelength of 450 nm; subsequently, the viability and proliferation rate of the cells were determined based on the OD values.

Screening of ultrasonic treatment duration

Assessment of cell proliferation following ultrasound treatment of varying durations by CCK-8 assay: According to the operating instructions of the CCK-8 kit, hUCMSCs were seeded into each well of 96-well plates at a density of 1 × 103 cells, with three replicate wells set for each group. The experimental groups included a vehicle control, hUCMSCs alone (M), and groups subjected to ultrasound for different durations: U60s, UTMD60s, UTMD90s, UTMD180s, UTMD240s, UTMD300s, UTMD360s, UTMD420s, and UTMD600s. Following a period of 24 hours for full-cell attachment, the medium was replaced with MB-supplemented medium. For ultrasound-treated groups, the plate was positioned on the surface of purified water maintained at 37 °C. An ultrasound probe was placed vertically approximately 8 cm beneath the culture plate[15] and operated for the designated duration at an acoustic intensity of 0.8 W/cm2, a frequency of 2.4 MHz[16,17] and a 30% duty cycle[18,19]. Meanwhile, a miniature thermocouple probe (0.5 mm tip diameter) was immersed into the culture medium to record real-time thermal fluctuations during treatment. Consistent with observations from previous references, the adopted ultrasonic parameters primarily modulate membrane permeability of adherent cells via acoustic radiation force, rather than relying on violent inertial cavitation. Only negligible lethal cellular injury was detected in mammalian cell lines exposed to this parameter set under reported experimental conditions. Additionally, prior studies have documented the generation of stable steady-state cavitation within similar systems at the 2.4 MHz irradiation frequency. After treatment, the 96-well plate was incubated in a cell incubator for 24 hours. Subsequently, 10 μL of CCK-8 working solution was added to each well, and plates were incubated for an additional 4 hours. The absorbance value at 450 nm was measured using a microplate reader, and the relative cell proliferation rate was calculated from the obtained OD values.

Assessment of hUCMSCs migration following ultrasound treatment of varying durations by cell scratch assay: The hUCMSCs were digested and resuspended, then adjusted to a density of 1 × 108/L with serum-free medium. A total of 70 μL of cell suspension was seeded into the scratch inserts in a 6-well plate, followed by 24 hours incubation for cell attachment. Subsequently, the insert was carefully removed using sterile forceps by gently pulling it vertically upward, and the resulting cell-free gap was rinsed two to three times with sterile PBS. Each well then received 2 mL of serum-free medium supplemented with mitomycin to inhibit cell proliferation. Microscopic images of the scratch wounds were acquired at 0 hour and 24 hours post-scratching. The migration area was quantitatively estimated using ImageJ. The migration rate was calculated as follows:

qPCR reaction analysis of CXCR4 mRNA

hUCMSCs in the M group, MB group, U300s group and UTMD300s group were treated according to the methods described above, and then cultured for an additional 24 hours. Total RNA was extracted from each group using Trizol reagent, reverse transcribed to cDNA, and then incubated at 42 °C for 60 minutes, followed by a 10-minute reaction at 70 °C. Reaction system was constructed using SYBR® Green qPCR mix, with CXCR4 and GAPDH primers. Primer sequences were as follows: CXCR4 (human) forward primer: GGCTTGACCTTCCTCTTTTGT, reverse-primer (GTTTT CCTTGTGGCCCTTTTGAC); GAPDH (human) forward-primer GCACCCGTCAAAGGGCTGAGAAC, reverse-primer: TGGGTGAAGACGCCAGTGGGA. The reaction conditions were: 95 °C for 30 seconds pre-denaturation, followed by 40 cycles of denaturation (95 °C) and extension (60 °C), followed by melting curve analysis. The relative expression level of the target gene was determined by the 2-ΔΔCt method.

Western blot analysis of CXCR4 in ultrasound-treated hUCMSCs

For each experiment, total protein of the cell groups was extracted using RIPA lysis buffer, and then its concentration was determined by BCA method. Proteins (10 μg per well) were separated by 10% sodium-dodecyl sulfate gel electrophoresis and transferred onto polyvinylidene fluoride membranes. The selection of antibodies was based on their verified specificity (supplier-provided validation data and previous literature) and the optimal signal-to-noise ratio; the working dilution ratios (antibody CXCR4 1:3000, antibody GAPDH 1:10000) were determined through pre-experiment titration to ensure sufficient specific binding saturation and minimize non-specific background. The membranes were then incubated overnight at 4 °C with rabbit anti-CXCR4 (Proteintech, 10340-1-AP, 1:3000, Wuhan, Hubei Province, China) and mouse anti-GAPDH (Proteintech, 60004-1-Ig, 1:10000, Wuhan, Hubei Province, China) primary antibodies. After TBST washing, membranes were probed with HRP-conjugated goat anti-rabbit (Proteintech, SA00001-2, 1:10000, Wuhan, Hubei Province, China) and goat anti-mouse (Proteintech, SA00001-1, 1:10000, Wuhan, Hubei Province, China) secondary antibodies for 1 hour at room temperature. Signals were visualized using an enhanced ECL kit and captured with the SCG-W3000 PLUS imaging system (Seville Biotechnology). The band intensity was quantitatively analyzed using ImageJ software, and the CXCR4 expression level was normalized with GAPDH as the standard.

Detection of stem cell apoptosis following ultrasound treatment of varying durations by flow cytometry

Following treatment according to the aforementioned groupings, hUCMSCs were collected from each group, and isolated and adjusted to a density of 1 × 106 cells/mL. The cells were resuspended in pre-cooled PBST solution three times, thoroughly shaken, and the supernatant was discarded. 1 × binding buffer was prepared with deionized water, and the cell precipitate was resuspended in this buffer. Aliquots of 100 μL (approximately 1 × 105 cells) were dispensed into 5 mL flow cytometry tubes. The staining volume of PE Annexin V (5 μL) and 7-AAD (5 μL) in each test sample was selected according to the manufacturer’s recommended range and further optimized through preliminary dose-response titration; these concentrations provided the clearest resolution in live cells, early apoptotic and late apoptotic populations, while having the lowest non-specific fluorescence and sufficient compensation separation effect. A blank control was established with pre-cooled 1 × binding buffer alone (500 μL total), and compensation controls were individually stained with either PE-Annexin V (5 μL) or 7-AAD (5 μL). After brief mixing, samples were protected from light and incubated for 15 minutes at room temperature. Then, each tube was supplemented with 1 × binding buffer to 500 μL and immediately collected by flow cytometry.

RNA sequencing and data analysis

Whole-transcriptome profiles of hUCMSCs were acquired via mRNA sequencing. RNA libraries were constructed with the Illumina NovaSeq kit. Briefly, the concentration and purity of total RNA extracted from each group were quantified using a NanoDrop 2000 spectrophotometer. The quality of RNA was assessed by agarose gel electrophoresis, and the RIN score obtained from the Agilent 2100 Bioanalyzer system was evaluated. For each library construction, a minimum of 10 ng total RNA was required, with a concentration ≥ 1 ng/μL, RIN > 6.5, and an OD260/280 ratio between 1.8 and 2.2. Significantly differentially expressed genes (DEGs) were identified using the DESeq software with the screening criteria of FDR < 0.05 and|log2FC| ≥ 1. Gene Ontology (GO) enrichment analysis was performed using the goatools tool, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was conducted using KOBAS. Protein-protein interaction (PPI) networks were inferred through the STRING database, with only the associations with a combined score ≥ 0.4 retained, and visualized using Cytoscape (v3.8.2).

Statistical analysis

Except for RNA sequencing, data were analyzed using GraphPad Prism 10.1 software (GraphPad, La Jolla, CA, United States). All results were presented as mean ± SD. The remaining parameters were analyzed using one-way analysis of variance (ANOVA) combined with Dunnett’s post-hoc test. Statistical significance was indicated by superscript: aP < 0.05 and bP < 0.01.

RESULTS
Physicochemical properties of sulfur hexafluoride MBs

Transmission electron microscopy revealed that sulfur hexafluoride MBs were evenly distributed with uniform diameters and no visible aggregation (Figure 1A). No obvious stratification was detected after the suspension was stored at room temperature. Particle size analysis revealed a relatively narrow size distribution characterized by a unimodal peak. The mean particle size was approximately 1010 ± 178 nm, indicating good uniformity and a concentrated distribution profile (Figure 1B and C). The zeta potential measured is -13.5 mV, with an absolute value ranging from 10 mV to 20 mV. Other parameters include a conductivity of 11.4 mS/cm, an effective voltage of 50.1 V, and a counting rate of 42.3 kcps. The negative zeta potential value confirmed that the MB surface carried a net negative charge (Table 1).

Figure 1
Figure 1 Physicochemical properties of sulfur hexafluoride microbubbles. A: The distribution of microbubbles (MBs) under the optical microscope (400 ×); B: The particle size-intensity distribution of the MBs: The abscissa represents the MBs size (in nanometers), and the ordinate represents the intensity percentage (%); C: The histogram of the MBs particle size-intensity distribution.
Table 1 Characterization of microbubbles: Statistical table of microbubble particle size and potential distribution, mean ± SD.
Characterization

IndicationMBs
Concentration (× 108/mL)2.3 ± 0.1
Zeta potential (mV)-13.5 ± 0
Particle size (μm)1010 ± 178
Dispersion index0.21 ± 0.1
Average peak value1360.5 ± 254.5
Peak area percentage (%)100 ± 0
Scattering angle (°)90 ± 0
Evaluation of optimal concentration and safety of MBs co-cultured with hUCMSCs

Based on the CCK-8 assay results, compared with the control group, the MB concentration within the range of 1 × 101 MBs/mL to 1 × 107 MBs/mL had no significant effect on the proliferation rate of hUCMSCs. However, when the MB concentration was increased to 1 × 108 MBs/mL, a marked reduction in hUCMSCs proliferation was observed, and this difference was statistically significant (Table 2 and Figure 2, aP < 0.05). Therefore, for all subsequent experiments, the MB concentration of 1 × 107 MBs/mL was selected.

Figure 2
Figure 2 Comparison of proliferation rates of human umbilical cord mesenchymal stem cells treated with different concentrations of microbubbles. aP < 0.05 vs M group. MB: Microbubble.
Table 2 Comparison of absorbance and activity of human umbilical cord mesenchymal stem cells under the action of microbubbles with different concentrations, mean ± SD.
Microbubble concentration (particles/mL)
Absorbance
hUCMSCs proliferation rate (%)
M1.58 ± 0.07NA
1011.23 ± 0.110.93 ± 0.26
1021.10 ± 0.041.11 ± 0.27
1031.27 ± 0.131.22 ± 0.33
1041.44 ± 0.171.24 ± 0.26
1051.43 ± 0.071.30 ± 0.37
1061.43 ± 0.071.27 ± 0.25
1071.35 ± 0.111.22 ± 0.32
1080.85 ± 0.130.39 ± 0.09
Culture and subculture of hUCMSCs

Observation under an optical microscope revealed that hUCMSCs were arranged in vortex-like, spiral-like or clustered patterns. The cell bodies were long and narrow with clear nuclei. After subculturing, the cell morphology was uniform, growth was vigorous, and distribution was even; after subculturing, the cell morphology was similar and the distribution was uniform (Figure 3).

Figure 3
Figure 3 Microscopic morphology of human umbilical cord mesenchymal stem cells. A: The morphology of human umbilical cord mesenchymal stem cells (hUCMSCs) under a light microscope at 40 × magnification; B: The morphology of hUCMSCs under a light microscope at 200 × magnification; C: The morphology of hUCMSCs under a light microscope at 400 × magnification.
Identification of hUCMSCs

Following subculture to the third passage, hUCMSCs were examined by flow cytometry for cell surface antigen expression. The results revealed the following positive rates: CD73 (99.24%), CD90 (99.19%), CD105 (82.65%), CD11b (0.06%), CD19 (2.26%), CD34 (0.03%), CD45 (1.24%), and HLA-DR (0.14%). These expression profiles conformed to the minimal criteria for defining human MSCs proposed by the International Society for Cell & Gene Therapy[20]. These results verified the high purity of hUCMSCs adopted in the present study (Figure 4A). Immunofluorescence staining for CD90 was subsequently performed on hUCMSCs. Fluorescence microscopy revealed specific and uniformly distributed signals localized predominantly to the cell membrane and cytoplasm, with a positive expression rate exceeding 90%. These results indicated that this cell strongly expressed the specific surface marker CD90 of hUCMSCs, which was consistent with the known phenotypic characteristics of hUCMSCs (Figure 4B).

Figure 4
Figure 4 The identification of human umbilical cord mesenchymal stem cells. A: Cell surface antigens using flow cytometry; B: Identification results of surface antigen CD90 in human umbilical cord mesenchymal stem cells (hUCMSCs) (200 ×, 400 ×); C: Osteogenic differentiation of hUCMSCs (100 ×), with visible red calcium nodules (Alizarin Red staining); D: Adipogenic differentiation of hUCMSCs (100 ×), with visible orange-red lipid droplets in the cytoplasm (Oil Red O staining); E: Chondrogenic differentiation of hUCMSCs (100 ×, alcian blue staining).
Identification of trilineage differentiation potential of hUCMSCs

After 14 days of osteogenesis induction, hUCMSCs exhibited a scale-like and polygonal cell morphology, and some cells fused; calcium nodules could be observed under the microscope. By day 21, Alizarin Red staining showed a large number of red granular calcium salts inclusions, indicating that the mineralized matrix had formed (Figure 4C). After adipogenic induction, cells became large, with the spindle-shaped shape of hUCMSCs gradually changing into a round form. Around day 14 post-induction, there was a large amount of bright lipid droplets in the cell cytoplasm, which had a spherical or polygonal morphology. Oil Red O staining showed obvious red lipids distributed across the cells (Figure 4D). After three weeks of chondrogenic induction, cartilage pellets were fixed in paraffin and cut into sections. Under microscope observation, alcian blue staining showed a blue coloration in the tissues, indicating proteoglycan-containing cartilage matrix (Figure 4E). Collectively, successful trilineage differentiation confirmed that the hUCMSCs used in this study possessed robust multipotent differentiation capacity, consistent with previous published studies.

Screening of ultrasonic treatment duration

Effect of different UTMD durations on the proliferation rate of hUCMSCs: Within the 60-600 seconds irradiation gradient tested in this work, thermal profiling of culture medium under 2.4 MHz, 0.8 W/cm2 and 30% duty cycle showed that medium temperature shifted from the initial 37.0 °C to 37.8 ± 0.2 °C, with temperature increases consistently below 1 °C across all tested time points. The 30% pulse setting restricted thermal elevation such that peak medium temperature did not surpass 38 °C, a mild thermal threshold acceptable for routine in vitro stem cell culture. Under varying durations of UTMD treatment, the 180-300 seconds group showed a significant promoting effect on cell proliferation. However, as the treatment time was further prolonged, the proliferation rate of hUCMSCs gradually decreased. These findings indicated that UTMD intervention at a duration of 300 seconds (UTMD300s) markedly promoted hUCMSCs proliferation, whereas prolonged exposure exerted an adverse effect on the proliferative capacity of hUCMSCs (Figure 5A).

Figure 5
Figure 5 Effects of ultrasound-targeted microbubble destruction exposure duration on the proliferation and migration of human umbilical cord mesenchymal stem cells. A: Proliferation rates of human umbilical cord mesenchymal stem cells (hUCMSCs) following ultrasound-targeted microbubble destruction (UTMD) treatment for different durations. aP < 0.001 vs the M (control) group; bP < 0.001 vs the M group; cP < 0.001 vs the M group; B and C: Evaluation of cell migration capacity using a wound healing (scratch) assay. Representative microscopic images of the scratch wound in hUCMSC monolayers at 0 hour and 24 hours after treatment with microbubbles alone, ultrasound alone (60 seconds), or UTMD for varying durations (60-600 seconds). aP < 0.05 vs M, bP < 0.05 vs M, cP < 0.05 vs M, dP < 0.01 vs M, eP < 0.05 vs M, fP < 0.05 vs M. Scale bar = 100 μm. Quantitative analysis of the cell migration rate at 24 hours post-treatment. All data are presented as mean ± SD. Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons.

Effect of different UTMD treatment durations on hUCMSCs migration: The scratch assay was used to examine UTMD’s effect at varying durations on hUCMSCs migration. The migration ability of hUCMSCs was evaluated by the repair area within the scratch zone. The results revealed significant differences in hUCMSCs migration rates among the various UTMD duration groups. As the treatment duration increased, the migration rate of hUCMSCs gradually rose, reaching a maximum at 300 seconds (UTMD300s). Further extension of the treatment duration led to a progressive decline in cell migration rate. These results indicated that 300 seconds of UTMD intervention significantly enhanced the migration ability of hUCMSCs, while prolonged exposure had an adverse effect on the migration ability of the cells (Figure 5B and C).

Investigation into the molecular mechanism of UTMD technology on the migration of hUCMSCs

Based on the experimental results above, a UTMD duration of 300 seconds was selected as the optimal intervention time. For subsequent mechanistic exploration of how UTMD modulates hUCMSC migration and homing[21], four experimental groups were established: Group M, group MB, group U300s, and the UTMD300s group.

Expression of CXCR4 mRNA in hUCMSCs after UTMD intervention: A stepwise upregulation of CXCR4 mRNA expression was observed in the above sequence. Among them, the expression level in the stem cell group was the lowest, while the expression levels in the MB group, ultrasound group and UTMD group increased successively. Importantly, compared with the stem cell group, UTMD exposure for 300 seconds significantly enhanced CXCR4 mRNA expression, and it was statistically different from each other (aP < 0.05, Figure 6A).

Figure 6
Figure 6 Effects of ultrasound-targeted microbubble destruction exposure duration on C-X-C chemokine receptor type 4 expression in human umbilical cord mesenchymal stem cells. A: Relative mRNA expression levels of CXCR4 in each group. aP < 0.001 vs M group, bP < 0.001 vs M group; B: C-X-C chemokine receptor type 4 (CXCR4) protein expression in four groups: M (untreated control), MB (microbubbles alone), U300s (ultrasound alone for 300 seconds), and ultrasound-targeted microbubble destruction (UTMD), was analyzed by western blotting, with GAPDH as the loading control; C: Quantification of CXCR4 protein expression normalized to GAPDH, derived from the western blot data in Figure 6B. aP < 0.05 vs M group, bP < 0.01 vs M group; D: Representative immunofluorescence images showing CXCR4 (red) and nuclei (DAPI, blue) in hUCMSCs after UTMD treatment for various durations (original magnification, × 20); E: Quantification of CXCR4 fluorescence intensity from the immunofluorescence images in Figure 6D. aP < 0.05 vs M group, bP < 0.01 vs M group, cP < 0.01 vs MB group. n = 4. All data are presented as mean ± SD. Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons. CXCR: C-X-C chemokine receptor type 4; MB: Microbubble; UTMD: Ultrasound-targeted microbubble destruction.

Expression of CXCR4 protein in hUCMSCs after UTMD intervention: The expression level of CXCR4 protein in these four groups showed a gradually increasing trend. Western blot results showed that the levels of CXCR4 protein in U300s group and UTMD group were higher than those in M group and MB group (bP < 0.01), and the expression level of the UTMD300s group was the highest (bP < 0.01, Figure 6B and C). Immunofluorescence showed that compared with the M group, the expression level of CXCR4 on the surface of hUCMSCs in the UTMD group was significantly increased (bP < 0.01) (Figure 6D and E).

Apoptosis levels of hUCMSCs after UTMD intervention for different durations

Statistical analysis showed that all measured parameters had significant changes (all aP < 0.05). The MB treatment yielded the highest cell viability (96.7% ± 0.3%), whereas the UTMD300s group demonstrated a pronounced reduction in viability (91.73% ± 0.47%, bP < 0.01). Accompanying this decline in cell survival, the UTMD300s group displayed the most prominent apoptotic response, recording the highest rates for both early (0.63% ± 0.11%) and late apoptosis (1.17% ± 0.32%), and the final total apoptosis rate peaked at 1.8% ± 0.16% (F = 8.618, bP < 0.01) (Figure 7).

Figure 7
Figure 7 Apoptosis of human umbilical cord mesenchymal stem cells following different treatments, assessed by flow cytometry. A-D: Representative flow cytometric scatter plots of apoptotic cells in the M (untreated control), MB (microbubbles alone), U300s (ultrasound alone for 300 seconds), and UTMD300s (ultrasound-targeted microbubble destruction for 300 seconds) groups, respectively; E: Quantitative analysis of the total apoptosis rate (early plus late apoptosis) in each group. Statistical significance: aP < 0.01 vs the UTMD300s group; bP < 0.01 vs the UTMD300s group; cP < 0.05 vs the M group. n = 4. All data are presented as mean ± SD. Statistical comparisons were performed using one-way ANOVA followed by Tukey’s post hoc test. UTMD: Ultrasound-targeted microbubble destruction.
RNA sequencing analysis of transcriptome in hUCMSCs after UTMD 300s intervention

To conduct an in-depth analysis based on the transcriptomic-sequence investigation results, the hierarchical clustering heatmap revealed significant differences in gene expression patterns between the M group and the UTMD group. They were colored based on expression intensity: Red indicates high expression, and blue indicates low expression. The significance of transcripts differences between both groups was assessed through Figure 8A and B. To determine the biological functions of DEGs, GO functional annotation analysis was conducted. As shown in Figure 8C of the results, for the category of the biological process, there were primarily enriched differential genes associated with cellular process and biological regulation; for the category of cellular components, these had more significant mapping to cellular anatomical structures and protein-containing complexes; and for molecular function categories, binding and catalytic activities were the primary terms among other terms indicated as being highly relevant to DEGs. KEGG pathway enrichment analysis showed that the DEGs were highly enriched in pathways such as the biosynthesis of unsaturated fatty acids, serotonergic synapses, and phosphonate and phosphatide metabolism. The enrichment factors and adjusted P-values of these pathways were highly statistically significant, thus suggesting that these specific gene differences mainly involve lipid metabolism regulation and neural transmission-related physiological functions (Figure 8D). After performing subsequent volcano plots, a total of 83 highly expressed genes and 76 lowly expressed genes were identified across all categories. Among which, SCD, TXNIP, INSIG1 were representative of the most highly up-regulated genes; HMCGS1 was the most significantly down-regulated gene (Figure 8B). Finally, a PPI network was constructed, and core nodes were identified based on connection weights. According to the results, SCD, INSIG1, HMGCS1 and ABCG1 were central in the network and had direct relationships with numerous genes, such as PNOC, KCND2, RPL9, ELOVL3, and GNAO1. Based on these results, it is suggested that the aforementioned genes could be key regulatory nodes for the aforementioned pathway (Figure 8E).

Figure 8
Figure 8 Transcriptomic analysis of differentially expressed genes. A: Volcano plot of differentially expressed genes (DEGs) between the M, MB, U300s, and UTMD groups; B: Hierarchical clustering heatmap of mRNA expression profiles; C: Bar chart of significantly enriched Gene Ontology terms among DEGs; D: Bar chart of significantly enriched Kyoto Encyclopedia of Genes and Genomes pathways among DEGs; E: Protein-protein interaction network of core regulatory genes among the DEGs.
DISCUSSION

hUCMSCs have emerged as a promising cell source for regenerative medicine owing to their robust proliferative capacity, low immunogenicity, and minimal ethical controversy[22]. Their therapeutic potential in tissue repair, including early-onset ovarian insufficiency, is mainly achieved through paracrine mechanisms rather than direct cell replacement[23]. The clinical applications of hUCMSC-based therapy are significantly hampered by the poor engraftment of systemically infused cells in target tissues. Following intravenous transplantation, the vast majority of MSCs become entrapped in the pulmonary microvasculature, with only a small fraction reaching injured sites. This limitation underscores the urgent need to develop new strategies that can enhance the directional migration ability of hUCMSCs without compromising their viability or stemness characteristics. UTMD has evolved into an effective non-invasive and adjustable physical action mode, regulating cell functions through the cavitation effect triggered by ultrasound MBs. A key mechanism of UTMD’s action is sonoporation - that is, forming transient microchannels on the cell membrane through sound waves, temporarily increasing permeability and opening channels for therapeutic drugs to enter the cells. Beyond its widespread application in gene and drug delivery, recent studies have begun to reveal the role of UTMD in guiding the migration and homing of MSCs, where the stromal-derived factor-1 (SDF-1)/CXCR4 signaling pathway is the main driving factor for this response[24,25]. It is worth noting, however, that the biological impact of UTMD varies considerably depending on acoustic parameters, MB concentration, and exposure time, and that different cell types do not respond uniformly to ultrasonic stimulation[26]. Currently, optimizing parameters for hUCMSCs to achieve significant enhancement in cell proliferation and migration while not affecting their viability remains a relatively unexplored area.

This study determined the optimal treatment parameters that could significantly promote cell proliferation and migration without affecting viability. Moreover, the research showed that UTMD300 upregulated the expression of CXCR4 at both mRNA and protein levels[27]. Based on transcriptomic sequencing data, we observed transcriptional changes in hUCMSCs following UTMD300 treatment. KEGG enrichment analysis showed that DEGs were notably enriched in lipid metabolism and neural signaling pathways within our experimental system. Within the current experimental system, our results identify a plausible regulatory route that may partially account for the changes in MSC migration triggered by UTMD mechanical stimulation at the transcriptional level.

Biosafety considerations and concentration screening of sulfur hexafluoride MBs in UTMD

Before using MBs, it is necessary to confirm their biosafety level. A large-scale retrospective study showed that in 463434 intravenous injections of sulfur hexafluoride MBs, their safety was very high[28]. Nevertheless, direct contact between MBs and cell surfaces triggers concentration-dependent cytotoxicity, and diverse cell lines display distinct susceptibility to MBs[29,30]. Therefore, if the dose optimization specific to cell types is not considered, the clinical safety of sulfur hexafluoride MBs at any concentration cannot be directly applied to hUCMSCs.

Our results indicated that MB concentrations above 1 × 108 MBs/mL induced obvious cytotoxicity. The cytotoxicity induced by high concentrations of MBs may be related to their excessive aggregation on the cell surface, which blocks the uptake of nutrients and may also trigger oxidative damage states, as well as other problems caused by the direct interaction between MBs and cells[31]. On the basis of comprehensive cell viability assays, we selected 1 × 107 MBs/mL as the working concentration. This balance ensures robust MB cavitation activity while sustaining normal hUCMSC physiological stability.

Exploration of UTMD exposure durations with favorable effects on hUCMSC migratory and proliferative capacities and in vitro biosafety analysis

Under the gradient exposure conditions (60-600 seconds) tested in this study, comparisons among single ultrasound, MB and combined UTMD groups suggested that hUCMSC proliferative and migratory responses were comparatively robust at the 300 seconds irradiation time point. Shorter treatment durations provided limited cavitation mechanical signals to maintain persistent pro-survival and pro-migratory transcriptional responses, whereas prolonged exposure over 300 seconds correlated with increased cellular impairment that was not driven by mild stable cavitation. Our in vitro data implied that the 300 seconds UTMD setting could confer mild beneficial effects on hUCMSC proliferative and chemotactic performance. Within our in vitro test system, apoptotic staining results demonstrated that the 300 seconds UTMD group displayed mild apoptotic responses, and this treatment condition sustained moderate cellular activity consistent with the usable parameter conditions for MB co-treatment used in the present work. Traditional UTMD mechanical treatment usually employ short exposure times (30-90 seconds) to avoid toxicity[32]. Within the gradient irradiation conditions tested in this study, our experimental observations imply that hUCMSCs retain moderate resistance to UTMD mechanical stimulation lasting longer than 300 seconds, and measurable cytotoxicity was not prominent across the tested duration groups. According to the recent research results, different cell types vary in their sensitivity to ultrasound cavitation. Low-intensity ultrasound pretreatment has been shown to promote BMSC proliferation and anti-apoptotic ability without causing cell death. Similarly, pulsed therapeutic ultrasound (3.3 MHz, 1.5 W/cm2) was found to preserve viability and proliferation of equine bone marrow MSCs[33]. Within the in vitro experimental conditions adopted in the present study, our results suggest a threshold of UTMD treatment duration beyond which obvious cellular impairment occurs in hUCMSCs. This observation may provide preliminary reference information for future research exploring UTMD-based stem cell activation, a research direction independent from UTMD gene delivery strategies.

The CXCR4 molecular mechanism and biosafety exploration of UTMD regulating hUCMSC migration

The SDF-1/CXCR4 axis is a principal regulator of MSC directional migration[34]. However, ex vivo expanded hUCMSCs typically have low surface expression of functional CXCR4[35], which greatly limits the homing efficiency of systemically infused cells. Based on transcriptional and protein detection data acquired in our in vitro system, we observed elevated CXCR4 expression following UTMD intervention. qPCR identified moderate upregulation of CXCR4 transcripts, and immunofluorescence and western blot measurements showed gradual rises in CXCR4 protein content in the UTMD300s group compared with the M, MB and U300s control groups under our test conditions. Low-level shear stress (0.2 Pa) has been shown to induce the migration of hBMSCs via the SDF-1/CXCR4 axis through the mitogen-activated protein kinases signaling pathway[36] while more recent studies have demonstrated that cyclic mechanical stretching upregulates MSC CXCR4 expression via the phosphatidylinositol 3-kinase/protein kinase B pathway[37]. We therefore propose that UTMD300s may promote CXCR4 upregulation through two complementary mechanisms. First, oscillating MB-induced transient sonoporation creates reversible membrane pores, allowing pre-existing intracellular CXCR4 to translocate to the plasma membrane, which matches the finding that resting MSCs store functional CXCR4 in cytoplasmic vesicles[38,39]. Within our in vitro experimental setup, mechanical signals generated by UTMD (shear stress and microstreaming) appeared to initiate intracellular mechanotransduction responses, which correlated with elevated CXCR4 transcription. Results from our cytotoxicity tests further implied that the 300 seconds UTMD condition brought about mild increases in CXCR4 expression and cell migration, and prominent apoptosis or severe morphological impairment was not observed across our detection indicators under the tested parameters. Within the in vitro test system of this study, our experimental results offer preliminary suggestive evidence that the screened UTMD parameters correspond to a range with mild cellular compatibility. Under these conditions, only transient reversible phenotypic shifts were detected, and widespread lethal cellular impairment was not observed in our detection indexes.

Transcriptomic remodeling induced by UTMD300s in hUCMSCs

Based on transcriptomic profiling data collected within our in vitro experimental system, we observed transcriptional changes in hUCMSCs following 300 seconds UTMD irradiation, with 83 transcripts elevated and 76 transcripts suppressed. KEGG pathway enrichment assessment demonstrated that DEGs showed detectable enrichment in unsaturated fatty acid synthesis, serotonergic synapse, and phosphonate/phosphatidylcholine metabolic pathways. Analysis of the PPI network further highlighted four genes (SCAD, INSIG-1, HMGCS1, ABCG1) that exhibited relatively high connectivity among the differential gene set tested here. Notably, the lipid metabolism pathway enrichment observed here differs from previous transcriptomic results for general sonoporation, which primarily involved heat shock proteins and immediate early genes[40]. This indicates that there is an alternative and nonstress-responsive transcriptional programme engaged by UTMD300s in hUCMSCs. Upregulation of SCD and cholesterol homeostatic regulator INSIG-1 (HMG-CO1) has been observed; changes in membrane content alter CXCR4 function. Wysoczynski et al[41] have found that CXCR4-containing membrane lipid rafts are required for enhanced chemotaxis under SDF-1 gradients. Ratajczak et al[42] believed that bioactive lipids modulate stem cell responsiveness to homing signals. Within the in vitro experimental system of this study, supplementary functional assays implied that SCD1-mediated shifts in membrane fluidity were associated with altered cell migration[43]. Integrating our transcriptomic and phenotypic observations, we found that UTMD exposure for 300 seconds was linked to modified lipid metabolic profiles, which may partially support CXCR4 localization and stable presence in membrane raft domains, leading to modest changes in hUCMSC migratory activity. More comprehensive functional verification targeting these highly connected differential genes should be conducted in future studies to validate the above correlations.

Limitations

Within the cell-only experimental system used in this study, our migration assessments cannot mirror the multifaceted behaviors of hUCMSCs inside intact living organisms, leaving the in vivo influence of UTMD on directional cell accumulation at damaged tissue sites uncharacterized. Transient inflammatory signals and elevated vascular permeability triggered by UTMD may generate mild favorable conditions for localized hUCMSC enrichment at injury sites, yet the chronic biosafety performance of this treatment modality remains unexamined in large animal models and clinical test settings. Given that all our current data are obtained from in vitro cell culture assays, this platform cannot fully mimic the complicated in vivo physiological background including blood flow characteristics, varied tissue microenvironments and multi-cell immune signaling crosstalk. Follow-up research based on tissue-injury animal models paired with real-time imaging tools will be required to further explore the in vivo functional performance and biocompatibility of UTMD-treated hUCMSCs. These subsequent investigations should focus on sustained inflammatory responses and latent risks of abnormal cell proliferation, to build up preliminary experimental reference information for exploratory clinical relevant studies.

CONCLUSION

Within the in vitro gradient test range of the present study, we explored different UTMD irradiation setups for hUCMSC treatment. The combination of 1 × 107 MBs/mL sulfur hexafluoride MBs and 300 seconds ultrasound exposure (0.8 W/cm2, 2.4 MHz, 30% duty cycle produced moderate beneficial effects on cell proliferation and migration under our experimental conditions. Our multi-level molecular data implied that upregulated CXCR4 may partially account for the enhanced migratory behaviors observed in UTMD-treated cells. However, comprehensive mechanisms underlying UTMD’s effects on hUCMSCs remain insufficiently defined and need more in-depth exploration. All results reported here are limited to isolated cellular systems; further animal-based studies are required to evaluate translational potential before any clinical testing can be considered.

ACKNOWLEDGEMENTS

We acknowledge public databases including PubMed for data support. We also thank all colleagues and collaborators for valuable suggestions and assistance. We also acknowledge the Core Facility of Stem Cell Research at Xinjiang Medical University for microscopy and flow cytometry support.

References
1.  de Souza Dobuchak D, Stricker PEF, de Oliveira NB, Mogharbel BF, da Rosa NN, Dziedzic DSM, Irioda AC, Athayde Teixeira de Carvalho K. The Neural Multilineage Differentiation Capacity of Human Neural Precursors from the Umbilical Cord-Ready to Bench for Clinical Trials. Membranes (Basel). 2022;12:873.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 6]  [Article Influence: 1.5]  [Reference Citation Analysis (1)]
2.  Labedz-Maslowska A, Bryniarska N, Kubiak A, Kaczmarzyk T, Sekula-Stryjewska M, Noga S, Boruczkowski D, Madeja Z, Zuba-Surma E. Multilineage Differentiation Potential of Human Dental Pulp Stem Cells-Impact of 3D and Hypoxic Environment on Osteogenesis In Vitro. Int J Mol Sci. 2020;21:6172.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 40]  [Article Influence: 6.7]  [Reference Citation Analysis (0)]
3.  Matsuzaka Y, Yashiro R. Current Strategies and Therapeutic Applications of Mesenchymal Stem Cell-Based Drug Delivery. Pharmaceuticals (Basel). 2024;17:707.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 35]  [Reference Citation Analysis (0)]
4.  Hu Z, Jiang Z, Meng S, Liu R, Yang K. Research Progress on the Osteogenesis-Related Regulatory Mechanisms of Human Umbilical Cord Mesenchymal Stem Cells. Stem Cell Rev Rep. 2023;19:1252-1267.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 11]  [Reference Citation Analysis (0)]
5.  Cho HS, Song WJ, Nam A, Li Q, An JH, Ahn JO, Kim HT, Park SM, Ryu MO, Kim MC, Kim JH, Youn HY. Intravenous injection of allogenic canine mesenchymal stem cells in 40 client-owned dogs: a safety assessment in veterinary clinical trials. BMC Vet Res. 2024;20:375.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 2]  [Reference Citation Analysis (0)]
6.  Xu H, Tang Y, Mao W, Wu L, Zhou Y, Deng J, Tang W, Xiao X, Xia Y, Wang Y. Exploration of the optimal retention method in vivo for stem cell therapy: Low-intensity ultrasound preconditioning. Regen Ther. 2025;29:484-492.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Reference Citation Analysis (0)]
7.  Chen H, Hwang JH. Ultrasound-targeted microbubble destruction for chemotherapeutic drug delivery to solid tumors. J Ther Ultrasound. 2013;1:10.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 66]  [Cited by in RCA: 86]  [Article Influence: 6.6]  [Reference Citation Analysis (0)]
8.  Zhang L, Sun Z, Ren P, Lee RJ, Xiang G, Lv Q, Han W, Wang J, Ge S, Xie M. Ultrasound-targeted microbubble destruction (UTMD) assisted delivery of shRNA against PHD2 into H9C2 cells. PLoS One. 2015;10:e0134629.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11]  [Cited by in RCA: 14]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
9.  Lin JW, Fan CH, Kuo TT, Yeh CK. Combining focused ultrasound and microbubbles for enhancing the migration of mesenchymal stem cells to the brain. J Control Release. 2026;390:114585.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
10.  Liu S, Zhang Y, Liu Y, Wang W, Gao S, Yuan W, Sun Z, Liu L, Wang C. Ultrasound-targeted microbubble destruction remodels tumour microenvironment to improve immunotherapeutic effect. Br J Cancer. 2023;128:715-725.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 75]  [Article Influence: 25.0]  [Reference Citation Analysis (1)]
11.  Zhang C, Zhang Q, Xu Q, Jiang X, Ma Y, Liu C, Zhou C, Liu R, Zhao Y, Liu Y. Ultrasound targeted microbubbles for theranostic applications in liver diseases: from molecular imaging to targeted therapy. Drug Deliv. 2025;32:2541656.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 9]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
12.  Li B, Hu Y, Wang L, Dong Z, Liu C, Xu J, Wu X, Song H. Therapeutic Effect of Human Umbilical Cord Mesenchymal Stromal Cells Loaded With miR-9-5p on Hypoxic-Ischemic Brain Damage in Neonatal Rats. Brain Behav. 2026;16:e71282.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
13.  Li P, Gao Y, Liu Z, Tan K, Zuo Z, Xia H, Yang D, Zhang Y, Lu D. DNA transfection of bone marrow stromal cells using microbubble-mediated ultrasound and polyethylenimine: an in vitro study. Cell Biochem Biophys. 2013;66:775-786.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 17]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
14.  Chu W, Liu M, Shangguan Y, He F, Zeng X, Guo T, Li T, Zhang F, Wang Q, Wu J, Zhong Z, Liang X. Optimization of Culture Media for Human Umbilical Cord-Derived Mesenchymal Stem Cell Production. Stem Cells Int. 2025;2025:4806605.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Reference Citation Analysis (0)]
15.  Draper DO, Castel JC, Castel D. Rate of temperature increase in human muscle during 1 MHz and 3 MHz continuous ultrasound. J Orthop Sports Phys Ther. 1995;22:142-150.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 188]  [Cited by in RCA: 140]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
16.  Li Q, Tang Z, Zhang Y, Yuan T, Yuan B, Du L, Jin Y. Application of low-intensity ultrasound by opening blood-brain barrier for enhanced brain-targeted drug delivery. Int J Pharm. 2023;642:123191.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 8]  [Reference Citation Analysis (0)]
17.  Yang C, Jiang X, Du K, Cai Q. Effects of low-intensity ultrasound on cell proliferation and reproductivity. Trans Tianjin Univ. 2016;22:125-131.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 4]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
18.  Chen B, Zhu Q, Duan M, Li Q, Wang G, Guan X, Yu P, Xu X, He Y, Xu Y. Optimal Treatment Parameters for Ultrasound-Stimulated Microbubbles in Upregulating Proliferation and Stemness of Bone Marrow Mesenchymal Stem Cells. J Ultrasound Med. 2024;43:1333-1342.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Reference Citation Analysis (0)]
19.  He M, Chen X, Yu F, Qin B, Wang H, Lavery L, Villanueva FS. Enhanced Antitumor Efficacy and Reduced Cardiotoxicity of Ultrasound-Mediated Doxorubicin Delivery by Microbubble-Liposome Complexes. Ultrasound Med Biol. 2025;51:1240-1249.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 8]  [Cited by in RCA: 6]  [Article Influence: 6.0]  [Reference Citation Analysis (0)]
20.  Wang F, Dai H, Zhou Z, Shan Y, Yu M, Sun J, Sheng L, Huang L, Meng X, You Y, Sheng M. Astragalus polysaccharides augment BMSC homing via SDF-1/CXCR4 modulation: a novel approach to counteract peritoneal mesenchymal transformation and fibrosis. BMC Complement Med Ther. 2024;24:204.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 9]  [Reference Citation Analysis (0)]
21.  Xiao R, Yang Q, Yin Y, Peng S, Cheng X. METTL14 regulate LRIG1 expression via m6A to affect nucleus pulposus cell senescence in intervertebral disc degeneration. J Orthop. 2026;74:195-204.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Reference Citation Analysis (0)]
22.  Li D, Wang N, Zhang L, Hanyu Z, Xueyuan B, Fu B, Shaoyuan C, Zhang W, Xuefeng S, Li R, Chen X. Mesenchymal stem cells protect podocytes from apoptosis induced by high glucose via secretion of epithelial growth factor. Stem Cell Res Ther. 2013;4:103.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 53]  [Cited by in RCA: 67]  [Article Influence: 5.6]  [Reference Citation Analysis (10)]
23.  Yuan J, Chen H. Sonobiopsy for sensitive and spatially targeted molecular diagnosis through integrating ultrasound with liquid biopsy. NPJ Acoust. 2025;1:12.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 3]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
24.  Xu H, Huang Y, Zhang F, Shi W, Cheng Y, Yang K, Tian P, Zhou F, Wang Y, Fang X, Song Y, Liu B, Liu L. Ultrasonic microbubbles promote mesenchymal stem cell homing to the fibrotic liver via upregulation of CXCR4 expression. Cell Div. 2024;19:7.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 8]  [Reference Citation Analysis (0)]
25.  Li L, Wu S, Liu Z, Zhuo Z, Tan K, Xia H, Zhuo L, Deng X, Gao Y, Xu Y. Ultrasound-Targeted Microbubble Destruction Improves the Migration and Homing of Mesenchymal Stem Cells after Myocardial Infarction by Upregulating SDF-1/CXCR4: A Pilot Study. Stem Cells Int. 2015;2015:691310.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 37]  [Cited by in RCA: 38]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
26.  Shi D, Guo L, Duan S, Shang M, Meng D, Cheng L, Li J. Influence of tumor cell lines derived from different tissue on sonoporation efficiency under ultrasound microbubble treatment. Ultrason Sonochem. 2017;38:598-603.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 30]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
27.  Gong SS, Li ML, Liu L, Lv B. Tongxie Yaofang enhances the homing efficiency of exogenous bone marrow-derived mesenchymal stem cells to the colonic mucosa and alleviates ulcerative colitis. World J Stem Cells. 2026;18:119228.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Reference Citation Analysis (0)]
28.  Shang Y, Xie X, Luo Y, Nie F, Luo Y, Jing X, Liao J, Zheng R, Wu R, Luo X, Chen Z, Xu Y, Zhang R, Wang H, Yuan J, Zhang H, Zhu J, Zhang W, Ruan L, Yang M, Li Z, Luo H, Chen Q, Yan J, Tang C, Liu D, Fang K, Guo Y, He W. Safety findings after intravenous administration of sulfur hexafluoride microbubbles to 463,434 examinations at 24 centers. Eur Radiol. 2023;33:988-995.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 28]  [Reference Citation Analysis (0)]
29.  Xie Y, Hu J, Lei W, Qian S. Prediction of vascular injury by cavitation microbubbles in a focused ultrasound field. Ultrason Sonochem. 2022;88:106103.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 17]  [Reference Citation Analysis (0)]
30.  Martínez-Alarcón L, Liarte S, Abellaneda JM, Quereda JJ, Mendonça L, Muñoz A, Ramírez P, Ramis G. Exposure to Sulfur Hexafluoride Influences Viability in Cell Transplant Suspensions. BioTech (Basel). 2025;14:86.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Reference Citation Analysis (0)]
31.  Sendek K, Tymkiewicz R, Fura L. Effects of focused ultrasound exposure parameters and microbubble concentration on cavitation dose. Biomed Phys Eng Express. 2025;11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
32.  Huang S, Xiang X, Qiu L, Wang L, Zhu B, Guo R, Tang X. Transfection of TGF-β shRNA by Using Ultrasound-targeted Microbubble Destruction to Inhibit the Early Adhesion Repair of Rats Wounded Achilles Tendon In vitro and In vivo. Curr Gene Ther. 2020;20:71-81.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 4]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
33.  Vermillion EA, Ellis KL, Gordon J, Moorman VJ, Peroni J. The Effect of Pulsed Therapeutic Ultrasound on Equine Bone Marrow-Derived Mesenchymal Stem Cells. VCOT Open. 2024;7:A1-A12.  [PubMed]  [DOI]  [Full Text]
34.  Son B, Zhao D, Marquez-Curtis LA, Shirvaikar N, Ratajczak MZ, Janowska-Wieczorek A. SDF-1-CXCR4 and HGF-c-met Axes Regulate Mobilization/Recruitment to Injured Tissue of Human Mesenchymal Stem Cells. Blood. 2004;104:2331.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 2]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
35.  Wang G, Zhang Q, Zhuo Z, Wu S, Xu Y, Zou L, Gan L, Tan K, Xia H, Liu Z, Gao Y. Enhanced Homing of CXCR-4 Modified Bone Marrow-Derived Mesenchymal Stem Cells to Acute Kidney Injury Tissues by Micro-Bubble-Mediated Ultrasound Exposure. Ultrasound Med Biol. 2016;42:539-548.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 28]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
36.  Yuan L, Sakamoto N, Song G, Sato M. Low-level shear stress induces human mesenchymal stem cell migration through the SDF-1/CXCR4 axis via MAPK signaling pathways. Stem Cells Dev. 2013;22:2384-2393.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 55]  [Cited by in RCA: 67]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
37.  Chen JY, Jiang T, Xu YT, Li ZA, Ouyang NJ, Tang GH. Mechanical Stretch Prevents Senescence-Associated Osteogenic Impairment in Mesenchymal Stem Cells via CXCR4/PI3K/AKT Signaling. FASEB J. 2025;39:e71208.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 2]  [Reference Citation Analysis (0)]
38.  Son BR, Marquez-Curtis LA, Kucia M, Wysoczynski M, Turner AR, Ratajczak J, Ratajczak MZ, Janowska-Wieczorek A. Migration of bone marrow and cord blood mesenchymal stem cells in vitro is regulated by stromal-derived factor-1-CXCR4 and hepatocyte growth factor-c-met axes and involves matrix metalloproteinases. Stem Cells. 2006;24:1254-1264.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 541]  [Cited by in RCA: 505]  [Article Influence: 25.3]  [Reference Citation Analysis (2)]
39.  Pelekanos RA, Ting MJ, Sardesai VS, Ryan JM, Lim YC, Chan JK, Fisk NM. Intracellular trafficking and endocytosis of CXCR4 in fetal mesenchymal stem/stromal cells. BMC Cell Biol. 2014;15:15.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 37]  [Cited by in RCA: 45]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
40.  Duan X, Wan JMF, Yu ACH. The molecular impact of sonoporation: A transcriptomic analysis of gene regulation profile. Ultrason Sonochem. 2024;111:107077.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
41.  Wysoczynski M, Reca R, Ratajczak J, Kucia M, Shirvaikar N, Honczarenko M, Mills M, Wanzeck J, Janowska-Wieczorek A, Ratajczak MZ. Incorporation of CXCR4 into membrane lipid rafts primes homing-related responses of hematopoietic stem/progenitor cells to an SDF-1 gradient. Blood. 2005;105:40-48.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 211]  [Cited by in RCA: 204]  [Article Influence: 9.7]  [Reference Citation Analysis (0)]
42.  Ratajczak MZ, Kim CH, Abdel-Latif A, Schneider G, Kucia M, Morris AJ, Laughlin MJ, Ratajczak J. A novel perspective on stem cell homing and mobilization: review on bioactive lipids as potent chemoattractants and cationic peptides as underappreciated modulators of responsiveness to SDF-1 gradients. Leukemia. 2012;26:63-72.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 87]  [Cited by in RCA: 80]  [Article Influence: 5.7]  [Reference Citation Analysis (0)]
43.  Angelucci C, D'Alessio A, Iacopino F, Proietti G, Di Leone A, Masetti R, Sica G. Pivotal role of human stearoyl-CoA desaturases (SCD1 and 5) in breast cancer progression: oleic acid-based effect of SCD1 on cell migration and a novel pro-cell survival role for SCD5. Oncotarget. 2018;9:24364-24380.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 36]  [Cited by in RCA: 65]  [Article Influence: 8.1]  [Reference Citation Analysis (0)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Cell and tissue engineering

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade C, Grade C, Grade C

Novelty: Grade B, Grade B, Grade C

Creativity or innovation: Grade B, Grade C, Grade C

Scientific significance: Grade B, Grade C, Grade C

P-Reviewer: Jameel F, PhD, Senior Researcher, Pakistan; Yuan Z, Assistant Professor, PhD, China S-Editor: Wang JJ L-Editor: A P-Editor: Zhao YQ

Write to the Help Desk