BPG is committed to discovery and dissemination of knowledge
Basic Research Open Access
©The Author(s) 2003. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Dec 15, 2003; 9(12): 2715-2719
Published online Dec 15, 2003. doi: 10.3748/wjg.v9.i12.2715
Distribution and expression of non-muscle myosin light chain kinase in rabbit livers
Hua-Qing Zhu, Yuan Wang, Ruo-Lei Hu, Qing Zhou, Laboratory of Molecular Biology and Department of Biochemistry, Anhui Medical University, Hefei 230032, Anhui Province, China
Hua-Qing Zhu, Yuan Wang, Ruo-Lei Hu, Qing Zhou, Shu-Yu Gui, Anhui Province Key Laboratory of Genomic Research, Hefei 230032, Anhui Province, China
Bin Ren, Department of Pathology, BIDMC and Harvard Medical School, 99 Brookline, MA 02215 , Boston, U S A
Shu-Yu Gui, Department of Respiratory Disease, the First Affiliated Hospital of Anhui Medical University, Hefei 230032, Anhui Province, China
Zhi-Kui Jiang, 105 Hospital of PLA, Hefei 230031, Anhui Province, China
Author contributions: All authors contributed equally to the work.
Supported by National Natural Science Foundation of China, No. 39870324, Grant for Excellent Young Teachers of Ministry of education of China, No.39870324, National Science Foundation of AnHui Province, No.9904312
Correspondence to: Professor Yuan Wang, Laboratory of Molecular Biology and Department of Biochemistry, Anhui Medical University, Hefei 230032, Anhui Provience, China. wangyuan@mail.hf.ah.cn
Telephone: +86-551-5161140
Received: May 10, 2003
Revised: May 23, 2003
Accepted: June 2, 2003
Published online: December 15, 2003

Abstract

AIM: To study the distribution and expression of non-muscle myosin light chain kinase (nmMLCK) in rabbit livers.

METHODS: Human nmMLCK N-terminal cDNA was amplified by polymerase chain reaction (PCR) and was inserted into pBKcmv to construct expression vectors. The recombinant plasmid was transformed into XL1-blue. Expression protein was induced by IPTG and then purified by SDS-PAGE and electroelution, which was used to prepare the polycolonal antibody to detect the distribution and expression of nmMLCK in rabbit livers with immunofluorescene techniques.

RESULTS: The polyclonal antibody was prepared, by which nmMLCK expression was detected and distributed mainly in peripheral hepatocytes.

CONCLUSION: nmMLCK can express in hepatocytes peripherally, and may play certain roles in the regulation of hepatic functions.




INTRODUCTION

Protein kinase plays an important regulatory role in response to both intracellular and extracellular signals[1]. Specific protein kinase is thought to control various cellular functions including glycogen metabolism, muscle contraction and growth, etc. Myosin light chain kinase (MLCK) is a Ca2+/calmodulin activated enzyme in the kinase family which catalyses the phosphorylation of the 20-ku myosin light chain (MLC-20)[2]. In skeletal muscle, the phosphorylation of MLC-20 correlates with potentiated twitch tension after repetitive stimulation. In smooth muscle cells, this phosphorylation leads to an increase in actomyosin ATPase activity and contraction which appears to be required for initiation of contraction. Phosphorylation of MLC-20 by smooth muscle MLCK is a key event initiating smooth muscle contraction. Although the roles of MLCK in non-muscle cells have not been well defined, a variety of morphological changes such as cellular motility and organelle movement occur concurrently with the increased cytoplasmic Ca2+ levels, light chain phosphorylation and activation of MLCK. Intracellular localization studies performed in mammalian fibroblast cells have colocalized MLCK to the spindle apparatus and midbody of mitotic cells. These observations have led to the suggestion that the phosphorylation of MLC-20 by MLCK in non-muscle cells might have a role in cell division and cell motility[3]. There are at least two different stress fiber systems in fibroblasts including central stress fiber system and periphery stress fiber system and the latter system depends on MLCK[4]. And at least two distinct classes of MLCK (short and long) phosphorylate the MLC-20 of myosin in thick filaments but bind with high affinity to actin in thin filaments[5]. But which form of MLCK exists in hepatocytes How is MLCK involved in cellular functions in hepatocytes In order to investigate the roles of MLCK in the maintenance of liver functions and its association with some liver diseases in the future study, we prepared polyclonal antibody through expressed MLCK protein in E. Coli system, and the antibody was used to detect the distribution and expression of MLCK in hepatocytes with immunofluorescence microscopy. Our research provides the basis for further investigation MLCK functions of in the liver and its relation with the pathology of some hepatic diseases such as hepatocellular carcinoma and hyperlipoproteinmia.

MATERIALS AND METHODS
Reagents and instruments

Plasmid pBKcmv and E. coli XL1- blue were from STRATAGENE (La Jolla, CA, USA). The human-non-muscle-MLCK cDNA was a gift from Dr. Stull at University of Texas Southwestern Medical Center, USA. Concept rapid PCR purification system kit was purchased from Life Techology, GibcoBRL. pGEM-T vector system I was purchased from Promega (Madison WI, USA). Restriction endoenzyme, T4DNA ligase, dNTPs, amplitaqe DNA polymerase, mounting media were obtained from Sigma Chemical Company. PCR primers were synthesized by BioAsia Biotechnology Co., Ltd (Shanghai, China). Other reagents were made in China and were of analytical purity. DYY-III type-2 electrophoresis and transfer system were made by Beijing Instrument Factory. UV-754 spectrophometer was made by The Third Factory of Analytical Instrument of Shanghai. Nikon eclipse E800 microscope was from Japan.

PCR of hnmMLCK DNA

The primers were designed according to human MLCK cDNA, prime 1: 5’TGGAATTCCATGGGGGACGTGAA3’ containing EcoRI restriction site and prime 2: 5’CCACTGCTGAAGAAGCTTAAAATC3’containing HindIII restriction site. The PCR parameters were pre-denaturation at 94 °C for 5 min before amplification was done for 35 cycles at 94 °C for 1 min, annealing at 55 °C for 1 min and extension at 72 °C for 1 min, and final extension for 10 min at 72 °C after the last cycle. The PCR products were examined by 20 g.L-1 agarose gel electrophoresis with TAE buffer at 80V for 40 min, visualized with ethidium bromide, and photographed under UV light.

Ligation, transformation and sequence of hnmMLCK DNA[6]

The PCR products were purified by concept rapid PCR purification system kit and inserted into the T-vector, the resulting ligation products were transferred into XL1-blue E.coli competent cells. The positive clone was picked up and the plasmids were prepared. The plasmid and pBKcmv vector were digested with EcoRI and Hind III and ligated before transferred into XL1-blue E coli competent cells. Individual recombinant white clones were picked up and recombinant DNA was prepared before digested with restrictive endonuclease. The recombinant plasmid sequence was detected with ABI377 auto analytical instrument.

Expression and purification of hnmMLCK in E. coli[7]

The positive recombinant plasmids were transformed into XL-1blue E. coli, the single clone was picked up and cultured overnight at 37 °C with shaking at 250 rpm. The media were diluted (1:100) with Luria-bertani liquid medium and iso-ploprl-h-D-thiogalactoside (IPTG) was added into the medium to induce protein expression when OD600 = 0.6-0.8, and cultured for 4 h. The bacteria were harvested by centrifugation at 5000 rpm for 10 min and the expressed protein was analyzed by SDS-PAGE. The expressed band was cut from SDS-PAGE gel and electroeluted in transfer buffer for isolation and purification.

Anti-myosin light chain kinase polyclonal antibody preparation

Polyclonal antibody to human MLCK was prepared according to the previously described method[8].

Immunofluorescence detection of MLCK in rabbit livers

The New Zealand rabbit liver tissues were embedded with O.C.T and frozen sections were prepared. The slices were incubated in 100% acetone for 10 min at -20 °C and dried in air, then blocked in 5% non-fat milk in PBS (pH7.4) overnight. The blocking solution was removed and anti-MLCK polyclonal antibody was added, and then incubated in a wet box for 2-3 h. The reactions were incubated with FITC-labeled secondary antibody for 1 h. Finally, the reactions were covered with mounting media before observation with a Nicon fluorescent microscope[9,10].

RESULTS
Amplification of human MLCK cDNA

The PCR products were detected by 20 g·L-1 agrose gel. The results showed that there was a 450 bp band in the gel (Figure 1), corresponding to the fragment of human MLCK cDNA N-terminate.

Figure 1
Figure 1 Amplification of hnmMLCK cDNA by PCR . 1. prod-ucts of PCR amplification, 2. the 100 bp ladder.
Enzymatic and sequence analysis of recombinant plasimid and cloned DNA

The recombinant plasmid was digested with EcoRI and HindIII and then run in 20 g·L-1 agrose gel, which showed that the PCR products were inserted into the pBKcmv vector (Figure 2). The DNA sequences of pBK-hnmMLCK were detected by ABI377 auto analytical instrument (Figure 3), and compared with Genbank (Figure 4).

Figure 2
Figure 2 Analysis of human MLCK recombinant plasmids with restriction endonucleases mapping. 1. pBKcmv/EcoRI-HindIII, 2. PCR products/EcoRI-HindIII, 3. the 100 bp DNA ladder, 4. pBK-hnmMLCK/EcoRI-HindIII, 5. pBK-hnmMLCK.
Figure 3
Figure 3 DNA sequences of pBK-hnmMLCK were detected by ABI377 auto analytical instrument.
Figure 4
Figure 4 Comparison between sequencing results of hnmMLCK DNA and those published by Genbank.
Protein expression and purification

The expressed protein hnmMLCK in E. coli was induced with IPTG and bacteria were centrifuged at 5000 rpm for 10 min. The pellet was resuspended with PBS, and an equal volume of 2 × protein loading buffer was added, boiled at 100 °C for 5 min and analyzed by SDS-PAGE. The percentage of the expressed protein was about 21% by scanning analysis (Figure 5).

Figure 5
Figure 5 Analysis of pBK-hnmMLCK with SDS-PADE. 1. pBKcmv in XL1-blue, 2. pBK-hnmMLCK in XL1-blue before induced, 3. pBK-hnmMLCK in XL1-blue after induced, 4. pu-rified expression protein, 5. protein markers.
Antiserum detection by immune double-diffusion

The ratio of antigen to antibody was at least 1:16 (Figure 6), suggesting that the polyclonal antibody could be used for immunoflouresence analysis.

Figure 6
Figure 6 Antiserum titer detected by immuno-double-diffusion.
Distribution of MLCK in rabbit livers

MLCK was mainly distributed peripherally in hepatocytes (Figure 7), and was hardly detected cytoplasms by immunofluorescence.

Figure 7
Figure 7 MLCK distribution in hepatocytes of New Zealand rabbits. A: H and E staining, B: MLCK distribution.
DISCUSSION

MLCK is the key regulator of cell motility and smooth muscle contraction in higher vertebrates[11-13]. MLCK expression shows a complex pattern. In undifferentiated myoblasts, 220-ku long or non-muscle form of MLCK is expressed during differentiation of skeletal muscle. During myoblast differentiation, the expression of 220-ku MLCK declines and expression of this long-term is replaced by 103-ku smooth muscle MLCK and a skeletal muscle-specific MLCK. The two isoforms are products of a single gene[14], and both short and long MLCKs are expressed in embryonic and adult non-muscle as well as smooth muscle cells[15,16]. Recently, some study showed the existence of a 208-ku protein, named embryonic MLCK because its expression could be detected in early embryonic tissue stem cells and in proliferating culture cells[17]. MLCK has several well characterized domains, and they are comprised of an amino-terminal "tail" of unknown function and a central catalytic core that is homologous to the catalytic core of other protein kinases, carboxy-terminal to the catalytic core and calmodulin binding domains, which are involved in the activation of the kinase in responses to increased Ca2+[18]. In this study we constructed the expression vector which could express N-terminal MLCK, and used this protein to prepare polyclonal antibody. The results showed that the antibody could react with hepatic cells and MLCK was distributed in the peripheral region of hepatic cells. In rabbit portal vein myocytes, MLCK could mediate noradrenaline-evoked non-selective cation current[19]. In the liver, agents that elevated intercellular free Ca2+ concentration could increase tight junctional permeability and stimulate bile canalicular contraction. Myosin phosphorylation is might be responsible for the tight junctional permeability caused by elevation of intercellular Ca2+ in hepatocytes. Moreover, the integrity of the phosphorylation systems of myosin is essential for normal bile flow. In addition, hepatic sinusoidal Ito cells play a regulatory role on hepatic blood flow through their contraction, while the integrity of MLCK is essential for Ito cell contractions and normal sinusoidal blood flow. However, the role of myosin phosphorylation by MLCK in non-muscle tissues has not been well characterized but correlated with important activities such as cell division, receptor capping[20,21], etc. It has been found that MLCK was closely associated with non-muscle cells[16,19,20]. Phosphorylation of myosin light chain by MLCK in non-muscle cells and tissues demonstrated an important physiological function[22]. For example, myosin light chain phosphorylation has been implicated in secretory vesicle movement, cellular locomotion and changes in cellular morphology[23]. MLCK activation was a critical step in cytoskeletal changes causing pseudopod formation during polymorphonuclear leukocyte phagocytosis[24]. MLCK was also associated with the gap formations and endothelial hyperpermeability of coronary venular endothelial cell monolayers[25]. The preliminary studies showed that the light chain was obviously phosphorylated when CaM was added into the reaction buffer at a suitable concentration of Ca2+. The activity of MLCK in rabbit livers increased markedly when CaM was added, and the activity changed with a substrate concentration or the concentration of light chain kinase[26]. MLCK immunoreactivity was found to be colocalized with the insulin granules, suggesting that it increased insulin granules in the ready-releasable pool by acting on different steps in the secretary cascade[27]. In this study, the expressed vector was successfully constructed and MLCK was expressed in E coli system, which lays a good basis for the manufacture and clinical application of the enzyme. The anti-MLCK polyclonal antibody was prepared and used to detect the distribution of MLCK in the cells of rabbit liver. MLCK may play an important role in maintaining the normal functions of tissues. But in the liver, which form of MLCK was expressed, long or short If there are both forms, which form expresses more What are their roles in the liver What roles will it play in liver regeneration, injury or hepatic carcinoma And what is the mechanim of MLCK activity in the liver All these remain to be investigated and elucidated in future studies.

References
1.  Kishi H, Mikawa T, Seto M, Sasaki Y, Kanayasu-Toyoda T, Yamaguchi T, Imamura M, Ito M, Karaki H, Bao J. Stable transfectants of smooth muscle cell line lacking the expression of myosin light chain kinase and their characterization with respect to the actomyosin system. J Biol Chem. 2000;275:1414-1420.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 32]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
2.  Deng JT, Van Lierop JE, Sutherland C, Walsh MP. Ca2+-independent smooth muscle contraction. a novel function for integrin-linked kinase. J Biol Chem. 2001;276:16365-16373.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 211]  [Cited by in RCA: 204]  [Article Influence: 8.2]  [Reference Citation Analysis (0)]
3.  Goeckeler ZM, Masaracchia RA, Zeng Q, Chew TL, Gallagher P, Wysolmerski RB. Phosphorylation of myosin light chain kinase by p21-activated kinase PAK2. J Biol Chem. 2000;275:18366-18374.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 124]  [Cited by in RCA: 115]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
4.  Katoh K, Kano Y, Amano M, Kaibuchi K, Fujiwara K. Stress fiber organization regulated by MLCK and Rho-kinase in cultured human fibroblasts. Am J Physiol Cell Physiol. 2001;280:C1669-C1679.  [PubMed]  [DOI]
5.  Smith L, Parizi-Robinson M, Zhu MS, Zhi G, Fukui R, Kamm KE, Stull JT. Properties of long myosin light chain kinase binding to F-actin in vitro and in vivo. J Biol Chem. 2002;277:35597-35604.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 41]  [Cited by in RCA: 38]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
6.  Xu CS, Li YC, Lin JT, Zhang HY, Zhang YH. Cloning and analysing the up-regulated expression of transthyretin-related gene (LR1) in rat liver regeneration following short interval successive partial hepatectomy. World J Gastroenterol. 2003;9:148-151.  [PubMed]  [DOI]
7.  Hu RL, Zhu HQ, Zhou Q, Gui SY, Wang Y. Construction of pBK-human non-muscle MLCK N-terminal and its expression in E. coli XL1-blue. Anhui Yike Daxue Xuebao. 2002;37:11-13.  [PubMed]  [DOI]
8.  Nunnally MH, Stull JT. Mammalian skeletal muscle myosin light chain kinases. A comparison by antiserum cross-reactivity. J Biol Chem. 1984;259:1776-1780.  [PubMed]  [DOI]
9.  Huang ZS, Wang ZW, Liu MP, Zhong SQ, Li QM, Rong XL. Protective effects of polydatin against CCl(4)-induced injury to primarily cultured rat hepatocytes. World J Gastroenterol. 1999;5:41-44.  [PubMed]  [DOI]
10.  Chen YM, Qian ZM, Zhang J, Chang YZ, Duan XL. Distribution of constitutive nitric oxide synthase in the jejunum of adult rat. World J Gastroenterol. 2002;8:537-539.  [PubMed]  [DOI]
11.  Jin Y, Atkinson SJ, Marrs JA, Gallagher PJ. Myosin ii light chain phosphorylation regulates membrane localization and apoptotic signaling of tumor necrosis factor receptor-1. J Biol Chem. 2001;276:30342-30349.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 43]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
12.  Schmidt JT, Morgan P, Dowell N, Leu B. Myosin light chain phosphorylation and growth cone motility. J Neurobiol. 2002;52:175-188.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 37]  [Cited by in RCA: 32]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
13.  Dudek SM, Birukov KG, Zhan X, Garcia JG. Novel interaction of cortactin with endothelial cell myosin light chain kinase. Biochem Biophys Res Commun. 2002;298:511-519.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 90]  [Cited by in RCA: 85]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
14.  Birukov KG, Schavocky JP, Shirinsky VP, Chibalina MV, Van Eldik LJ, Watterson DM. Organization of the genetic locus for chicken myosin light chain kinase is complex: multiple proteins are encoded and exhibit differential expression and localization. J Cell Biochem. 1998;70:402-413.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
15.  Blue EK, Goeckeler ZM, Jin Y, Hou L, Dixon SA, Herring BP, Wysolmerski RB, Gallagher PJ. 220- and 130-kDa MLCKs have distinct tissue distributions and intracellular localization patterns. Am J Physiol Cell Physiol. 2002;282:C451-C460.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 69]  [Cited by in RCA: 65]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
16.  Davis JS, Hassanzadeh S, Winitsky S, Lin H, Satorius C, Vemuri R, Aletras AH, Wen H, Epstein ND. The overall pattern of cardiac contraction depends on a spatial gradient of myosin regulatory light chain phosphorylation. Cell. 2001;107:631-641.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 232]  [Cited by in RCA: 214]  [Article Influence: 8.6]  [Reference Citation Analysis (0)]
17.  Murata-Hori M, Suizu F, Iwasaki T, Kikuchi A, Hosoya H. ZIP kinase identified as a novel myosin regulatory light chain kinase in HeLa cells. FEBS Lett. 1999;451:81-84.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 123]  [Cited by in RCA: 119]  [Article Influence: 4.4]  [Reference Citation Analysis (2)]
18.  Gallagher PJ, Herring BP. The carboxyl terminus of the smooth muscle myosin light chain kinase is expressed as an independent protein, telokin. J Biol Chem. 1991;266:23945-23952.  [PubMed]  [DOI]
19.  Aromolaran AS, Albert AP, Large WA. Evidence for myosin light chain kinase mediating noradrenaline-evoked cation current in rabbit portal vein myocytes. J Physiol. 2000;524 Pt 3:853-863.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 42]  [Cited by in RCA: 41]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
20.  Watanabe H, Tran QK, Takeuchi K, Fukao M, Liu MY, Kanno M, Hayashi T, Iguchi A, Seto M, Ohashi K. Myosin light-chain kinase regulates endothelial calcium entry and endothelium-dependent vasodilation. FASEB J. 2001;15:282-284.  [PubMed]  [DOI]
21.  Tran QK, Watanabe H, Le HY, Pan L, Seto M, Takeuchi K, Ohashi K. Myosin light chain kinase regulates capacitative ca(2+) entry in human monocytes/macrophages. Arterioscler Thromb Vasc Biol. 2001;21:509-515.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 34]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
22.  Wadgaonkar R, Nurmukhambetova S, Zaiman AL, Garcia JG. Mutation analysis of the non-muscle myosin light chain kinase (MLCK) deletion constructs on CV1 fibroblast contractile activity and proliferation. J Cell Biochem. 2003;88:623-634.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 19]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
23.  Iida Y, Senda T, Matsukawa Y, Onoda K, Miyazaki JI, Sakaguchi H, Nimura Y, Hidaka H, Niki I. Myosin light-chain phosphorylation controls insulin secretion at a proximal step in the secretory cascade. Am J Physiol. 1997;273:E782-E789.  [PubMed]  [DOI]
24.  Mansfield PJ, Shayman JA, Boxer LA. Regulation of polymorphonuclear leukocyte phagocytosis by myosin light chain kinase after activation of mitogen-activated protein kinase. Blood. 2000;95:2407-2412.  [PubMed]  [DOI]
25.  Tinsley JH, De Lanerolle P, Wilson E, Ma W, Yuan SY. Myosin light chain kinase transference induces myosin light chain activation and endothelial hyperpermeability. Am J Physiol Cell Physiol. 2000;279:C1285-C1289.  [PubMed]  [DOI]
26.  Ren B, Zhu HQ, Luo ZF, Zhou Q, Wang Y, Wang YZ. Preliminary research on myosin light chain kinase in rabbit liver. World J Gastroenterol. 2001;7:868-871.  [PubMed]  [DOI]
27.  Yu W, Niwa T, Fukasawa T, Hidaka H, Senda T, Sasaki Y, Niki I. Synergism of protein kinase A, protein kinase C, and myosin light-chain kinase in the secretory cascade of the pancreatic beta-cell. Diabetes. 2000;49:945-952.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 50]  [Cited by in RCA: 43]  [Article Influence: 1.7]  [Reference Citation Analysis (1)]
Footnotes

Edited by Zhang JZ and Wang XL

Write to the Help Desk