A truncated hepatitis E virus ORF2 protein expressed in tobacco plastids is immunogenic in mice

Table 1 Primers for PCR analysis of transplastomic plants

Name	Sequence (5’-3’)	Position
Hel-19	atgtcaccacaaacagag	57 595-57 6121
Hel-24	atccaaaacgtccactgc	59 005-59 0021
Hel-294	agcccgtcatacttgaagctagac	6 563-6 5872, 5 191-5 2153
Hel-297	ataccaatgtcaaccaagccagcc	2 008-2 0323
Hel-348	gatgatcatagaagcccctttacc	199-2222, 38 524-38 5471
Hel-354	tgcaagcacgatttggggagag	1 806-1 8273
Hel-355	cagatcaatgtcgatcgtggctg	6 856-6 8782, 4 900-4 9223
Hel-399	tggcaaaacaagatgttgcggag	38 341-38 3631
Hel-401	gttctttaaattccgtgggtggtg	36 683-36 7061
Hel-403	agaaccaatttcgggattgggcac	40 312-40 3351
Hel-720	gtagaatgctagatgccc	4 300-4 3173
Hel-721	agctttggcgagctagttg	7 388-7 4062

¹Positions are indicated in accordance with the numbering of the tobacco plastome sequence (accession no. Z00044);

²Positions are indicated in accordance with the numbering of the pRB94 vector (accession no. AJ312392);

³Positions are indicated in accordance with the numbering of pVSR326 vector (accession no. AF527485).

Table 2 Accumulation of pE2 leaves and seeds of WT and transplastomic plants (mean±SD)

Plant	Tissue	pE2
		(ng/µg TSP)	(µg/g fresh weight)
WT	Leaves	nd	nd
	Seeds	nd	nd
E2-1	Leaves	1.090 ± 0.182	13.273 ± 2.217
	Seeds	0.015 ± 0.004	0.261 ± 0.060
E2-2	Leaves	0.630 ± 0.133	5.912 ± 1.251
	Seeds	0.018 ± 0.005	0.460 ± 0.093

ND: Non-detectable.

Table 3 Antigenicity of plastid-derived pE2 in mice

Group	A450
	Expt A	Expt B
PBS	0.117	0.137
WT TSP	0.138	0.134
E2-1 TSP	0.387	0.779
E. coli TSP	1.367	2.62