BPG is committed to discovery and dissemination of knowledge
Brief Reports Open Access
©The Author(s) 2001. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Feb 15, 2001; 7(1): 128-130
Published online Feb 15, 2001. doi: 10.3748/wjg.v7.i1.128
Adhesion molecule and proinflammatory cytokine gene expression in hepatic sinusoidal endothelial cells following cecal ligation and puncture
Rong Qian Wu, Ying Xin Xu, Xu Hua Song, Li Jun Chen, Xian Jun Meng, Institute of Surgical Research , General Hospital of PLA, Beijing 100853, China
Rong Qian Wu, graduated from General Hospital of PLA as a M.D. in 1999, now attending surgeon of general surgery, major field of research in sepsis and MODS, having 15 papers published.
Author contributions: All authors contributed equally to the work.
Supported by the National Natural Science Foundation of China, No.39870796
Correspondence to: Dr. Rong Qian Wu, Institute of surgical Research, General Hospital of PLA, Beijing 100853, China
Received: September 4, 2000
Revised: September 22, 2000
Accepted: September 29, 2000
Published online: February 15, 2001

Abstract
Key Words: cell adhesion molecules; sepsis; endothelium; cytokines; gene expression; polymerase chain reaction; RNA, messenger; liver/injuries; cecal diseases



INTRODUCTION

Multiple organ dysfunction syndrome (MODS) is thought to be a frequent consequence of sepsis[1-3]. Despite substantial advances in our knowledge and understanding of the basic pathophysiologic mechanisms[4-7], in critically ill patients infections and sepsis are still associated with a high mortality[8,9]. There is evidence that the development of tissue damage in sepsis and shock is closely associated with the release of an ever increasing number of mediators and accumulation of neutrophils at the sites of infection or injury[10,11].

The endothelium is an intimal layer of simple squamous cells which provides a continuous, fluent surface for circulating blood. It is not the passive, metabolically inert barrier that it was once thought to be, and it is now known to be a metabolically and physiologically dynamic tissue with multiple functions. On the basis of recent discoveries in the field of endothelial cell biology (such as endothelium-derived mediators and the expression of adhesion molecules), end othelial cells are now thought to be not only target cells of injury, but also actively involved in inflammatory reactions and subsequent organ damage[12,13].

Polymicrobial sepsis induced by cecal ligation and puncture (CLP) is a model of sepsis which reproduces many of the inflammatory and pathological sequelae that are observed clinically. Following CLP, animals develop bacteremia,hypothermia,hypotension,anddamagetomultiple organ systems[14]. The present study was designed to observe the gene expression of adhesion molecules and proinflammatory cytokines in hepatic sinusoidal endothelial cells with a CLP model, in order to investigate the role of endothelial cells in tissue damage during sepsis.

MATERIALS AND METHODS
Animal model and CLP

NIH mice were obtained from the animal center of the General Hospital of PLA. The mice were randomly divided into 2 groups: CLP group and sham group. Sepsis was induced in the CLP group by CLP. The mice were anesthetized, and the cecum was ligated below the ileocecal junction: intestinal continuity was maintained. The cecum was punctured twice with a 20-gauge needle and a small amount of cecal contents was expressed through the punctures. The incision was closed and 1 mL of normal saline was administered subcutaneously. Sham-operated mice underwent the same surgical procedure, but without CLP. The mice were sacrificed at 3 or 12 h after the procedure.

Isolation and purification of hepatic sinusoidal endothelial cells

Hepatic sinusoidal endothelial cells were isolated by collagenase perfusion of the liver, isopyknic sedimentation in a two-step percoll gradient, and selective adherence[15]. The purified sinusoidal endothelial cells were identified by staining with anti-von willebrand factor (vWF, factor VII I-related antigen). Flow cytometric analysis showed a purity greater than 85% in hepatic sinusoidal endothelial cells.

Analysis of adhesion molecules and proinflammatory cytokines mRNA by reverse transcription-PCR

Total RNA was extracted from endothelial cells. We used a phenol-chloroform extraction method reported by Chomczynski. The RNA was then quantitated spectrophotometrically. Total RNA from experimental samples was used to synthesize cDNA using AMV reverse transcriptase. β-actin and β2-MG were used as internal control primers. The primers for the adhesion molecules and controls were as follows: β-actin (478 bp), 5’AGGGAAATCGTGCGTGACATCAAA3’, 5’ACTCATCGTACTCCTGCTTGCTGA3’; β2-MG (300 bp), 5’GGCTCGCTCGGTGACCCTAGTCTTT3’, 5’TCTGCAGGCGTATGTATCAGTCTCA3’; VCAM-1 (442 bp), 5’CCTCACTTGCAGCACTACGGGCT3’, 5’TTTTCCAATATCCTCAATGACGGG3’; ICAM-1 (326 bp), 5’TGCGTTTTGGAGCTAGCGGACCA3’, 5’CGAGGACCATACAGCACGTGCAG3’; E-selectin (435 bp), 5’CCTGAACTGCTCCCACCCGTTCG3’, 5’GTGAAGTTACAGGATGACTTAAACGCA3’; TNF-α (349 bp), 5’TTCTGTCCCTTTCACTCACTGG3’, 5’TTGGTGGTTTGCTACGACGTGG3’ IL-1β (441bp), 5’ATTAGACAGCTGCACTACAGGCTC3’, 5’AGATTCCATGGTGAAGTCAATTAT3’ IL-6 (156 bp), 5’TGGAGTCACAGAAGGAGTGGCTAAG3’, 5’TCTGACCACAGTGAGGAATGTCCAC3’. Polymerase chain reactions were performed in a 25 μL reaction volume. A hot start was applied for 5min at 95 °C. The amplification cycle (denaturation step at 94 °C for 30 s, an annealing step at 55 °C for 30 s and an extension step at 72 °C for 90 s) was repeated 30 times and followed by a final extension for 10 min at 72 °C. Amplified products were separated by electrophoresis in ethidium bromide-stained 1.5% agarose gel and visualized with UV illumination. The bands representing reaction product on the film were scanned by densitometry. A normalization quotient (Q) was calculated between the integrated optical density values (IOD) for the adhesion molecules and the β-actin or β2-MG bands (Q = IOD, adhesion molecules band/internal control band). The level of adhesion molecules mRNA were expressed as the quotient of the integrated optical density values for the adhesion molecules and the β-actin or β2-MG bands.

Statistical analysis

All data were reported as means ± SD. Data were analyzed by t test for comparisons between the two groups. A P value of less than 0.05 was deemed significant.

RESULTS
Adhesion molecules mRNA expression in hepatic sinusoidal endothelial cells

E-selectin mRNA levels markedly increased at 3 h after CLP in hepatic sinusoidal endothelial cells, and returned to baseline at 12 h after CLP. Increases in ICAM-1 mRNA level was found at 3 h after CLP, and this level became higher at 12 h after CLP. VCAM-1 mRNA expression in hepatic sinusoidal endothelial cells increased significantly 3 h after CLP but declined at 12 h after CLP (Table 1).

Table 1 Adhesion molecules mRNA expression in hepatic sinusoidal endothelial cells (x ± s).
E-selectin
ICAM-1
VCAM-1
3 h12 h3 h12 h3 h12 h
Sham0.22 ± 0.040.23 ± 0.040.26 ± 0.030.30 ± 0.050.37 ± 0.040.30 ± 0.05
CLP0.85 ± 0.06b0.24 ± 0.030.67 ± 0.04b1.02 ± 0.10b1.04 ± 0.14b0.86 ± 0.05b
Proinflammatory cytokines mRNA expression in hepatic sinusoidal endothelial cells

A significant increase in TNF, IL-1 and IL-6 gene expression was observed at 3 and 12 hours after CLP. The level of TNFα and IL-1β at 3 hours was higher than 12 hours, and the level of IL-6 gene expression at 12 hours was higher than 3 hours (Table 2).

Table 2 Proinflammatory cytokines mRNA expression in hepatic sinusoidal endothelial cells (x ± s).
TNFα
IL-1β
IL-6
3 h12 h3 h12 h3 h12 h
Sham0.23 ± 0.040.22 ± 0.040.30 ± 0.040.39 ± 0.060.47 ± 0.050.49 ± 0.05
CLP0.71 ± 0.03b0.54 ± 0.07b1.02 ± 0.12b0.78 ± 0.08b0.90 ± 0.05b1.11 ± 0.14b
DISCUSSION

The liver, with its rich supply of blood and sinusoid, is directly exposed to bacteria and endotoxins drained from the GI tract[16-19]. Previously, researchers in our institute have reported that the liver is the most susceptible and vulnerable organ during sepsis and multiple organ failure[20].

Vascular endothelial cells form an interface between tissues and inflammatory cells. This unique location allows localization of the inflammatory reaction to the site of injury while protecting adjacent healthy tissue. Endothelial cells mediate the local inflammatory response through modulation of vascular tone, vascular permeability and stimulation of leukocyte extravasation[21,22]. The role of neutrophil extravasation and accumulation has been emphasized in recent years[23,24]. This is mediated by the induced expression of multiple cell adhesion molecules on the surface of neutrophils and endothelial cells[25,26]. These include the selectins which are a group of surface glycoproteins essential to leukocyte margination and rolling along the vascular endothelium. Specifically, endothelial E- and P-selectin and L-selectin are expressed on neutrophils[27]. Another group of cell adhesion molecules involved in endothelial cell-leukocyte interaction is the immunoglobulinsupergenefamily. Thisgroupcomprises intercellular adhesion molecules-1 and 2 (ICAM-1, ICAM-2), vascular cell adhesion molecules-1 (VCAM-1)[28]. The most well studied of these molecules is ICAM-1, which play a critical role in events subsequent to initial leukocyte margination. In this study, we found that the up-regulation of the expressions of adhesion molecules in liver sinusoidal endothelial cells is a crucial step for the migration of leukocytes to and accumulation at the site of inflammation. Although neutrophils are important for killing microorganisms, activation of recruited neutrophils coupled with excessive release of oxygen metabolites and proinflammatory mediators may induce tissue injury which can lead to organ dysfunction[29,30].

Cytokines are polypeptides or glycoproteins of low molecular weight. Most cytokines are not stored as preformed molecules, hence their production requires new gene transcription and translation. Unlike mediators derived from the classical endocrine system, cytokines are produced. The production of cytokines at various tissue sites depends, in part, on the proximity of the site to the injurious stimulus. In this study we assessed the gene expression of proinflammatory cytokines in hepatic sinusoid endothelial cells. Recent discoveries in the field of endothelial cell biology have shown its capability of production cytokines[31-33], but the role of endothelial cell-derived cytokines in sepsis induced tissue injury was largely ignored. Proinflammatory cytokines TNF and IL-1 are known to play predominant roles in the normal inflammatory response. Exaggerated endogenous production is likely responsible for the complications associated with sepsis such as tissue injury and ultimate organ failure[34-36]. We observed a significant increase in TNF and IL-1 gene expression shortly after the induction of sepsis. This indicates that endothelium is an important source of cytokines during sepsis, and may play a role in sepsis induced organ dysfunction. The consensus of the concept of systemic inflammatory responses has brought about a likely promising approach in the treatment of SIRS/MODS[37]-anti-inflammatory instead of anti-infection[38,39]. Various approaches aimed at interrupting the cascade of host inflammatory responses have been tested. These include interventions targeted at the inflammation effector cells as monoclonal antibodies or receptor antagonist to pro-inflammatory cytokines. However, many of these seemingly effective measures in experimental study failed when moved from the laboratory bench to clinical ward[40-44].

References
1.  Livingston DH, Mosenthal AC, Deitch EA. Sepsis and multiple organ dysfunction syndrome: a clinical-mechanistic overview. New Horiz. 1995;3:257-266.  [PubMed]  [DOI]
2.  Goris RJ. MODS/SIRS: result of an overwhelming inflammatory response? World J Surg. 1996;20:418-421.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 45]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
3.  Gullo A, Berlot G. Current topics. Sepsis. Intensive Care Med. 1999;25:869-871.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 2]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
4.  Bone RC. Toward a theory regarding the pathogenesis of the systemic inflammatory response syndrome: what we do and do not know about cytokine regulation. Crit Care Med. 1996;24:163-172.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 443]  [Cited by in RCA: 368]  [Article Influence: 12.3]  [Reference Citation Analysis (0)]
5.  Deitch EA. Multiple organ failure. Pathophysiology and potential future therapy. Ann Surg. 1992;216:117-134.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 963]  [Cited by in RCA: 860]  [Article Influence: 25.3]  [Reference Citation Analysis (6)]
6.  Nieuwenhuijzen GA, Deitch EA, Goris RJ. Infection, the gut and the development of the multiple organ dysfunction syndrome. Eur J Surg. 1996;162:259-273.  [PubMed]  [DOI]
7.  Gullo A, Berlot G. Ingredients of organ dysfunction or failure. World J Surg. 1996;20:430-436.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 31]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
8.  Sands KE, Bates DW, Lanken PN, Graman PS, Hibberd PL, Kahn KL, Parsonnet J, Panzer R, Orav EJ, Snydman DR. Epidemiology of sepsis syndrome in 8 academic medical centers. JAMA. 1997;278:234-240.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 506]  [Cited by in RCA: 352]  [Article Influence: 12.1]  [Reference Citation Analysis (1)]
9.  Teplick R, Rubin R. Therapy of sepsis: why have we made such little progress? Crit Care Med. 1999;27:1682-1683.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 16]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
10.  Davies MG, Hagen PO. Systemic inflammatory response syndrome. Br J Surg. 1997;84:920-935.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 322]  [Cited by in RCA: 326]  [Article Influence: 11.2]  [Reference Citation Analysis (0)]
11.  Gutierrez-Ramos JC, Bluethmann H. Molecules and mechanisms operating in septic shock: lessons from knockout mice. Immunol Today. 1997;18:329-334.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 80]  [Cited by in RCA: 84]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
12.  Wang X, Andersson R. The role of endothelial cells in the systemic inflammatory response syndrome and multiple system organ failure. Eur J Surg. 1995;161:703-713.  [PubMed]  [DOI]
13.  McGill SN, Ahmed NA, Christou NV. Endothelial cells: role in infection and inflammation. World J Surg. 1998;22:171-178.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 66]  [Cited by in RCA: 69]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
14.  Salkowski CA, Detore G, Franks A, Falk MC, Vogel SN. Pulmonary and hepatic gene expression following cecal ligation and puncture: monophosphoryl lipid A prophylaxis attenuates sepsis-induced cytokine and chemokine expression and neutrophil infiltration. Infect Immun. 1998;66:3569-3578.  [PubMed]  [DOI]
15.  Braet F, De Zanger R, Sasaoki T, Baekeland M, Janssens P, Smedsrød B, Wisse E. Assessment of a method of isolation, purification, and cultivation of rat liver sinusoidal endothelial cells. Lab Invest. 1994;70:944-952.  [PubMed]  [DOI]
16.  Han DW. The clinical sine of subsequent liver injury induced by gut derived endotoxemia. Shijie Huaren Xiaohua Zazhi. 1999;7:1055-1058.  [PubMed]  [DOI]
17.  Swank GM, Deitch EA. Role of the gut in multiple organ failure: bacterial translocation and permeability changes. World J Surg. 1996;20:411-417.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 443]  [Cited by in RCA: 417]  [Article Influence: 13.9]  [Reference Citation Analysis (3)]
18.  Qin RY, Zou SQ, Wu ZD, Qiu FZ. Influence of splanchnic vascular infusion on the content of endotoxins in plasma and the translocation of intestinal bacteria in rats with acute hemorrhage necrosis pancreatitis. World J Gastroenterol. 2000;6:577-580.  [PubMed]  [DOI]
19.  Zhang SC, Dai Q, Wang JY, He BM, Zhou K. Gut-derived endotoxemia: one of the factors leading to production of cytokines in liver diseases. World J Gastroenterol. 2000;6:16.  [PubMed]  [DOI]
20.  Meng XJ, Wang P, Zhang P. [Role of the liver in the pathogenesis of multiple organ failure]. Zhonghua Waike Zazhi. 1988;26:13-15, 59.  [PubMed]  [DOI]
21.  Liu XJ, Liu F, Xiao WJ, Huang MH, Huang SM, Wang YP. Effects of sinusoidal endothelial cell conditioned medium on the expression of con-nective tissue growth factor in rat hepatic stellate cells. World J Gastroenterol. 2000;6:42.  [PubMed]  [DOI]
22.  Braet F, Zanger RD, Spector I, Wisse E. Structure and dynamics of hepatic endothelial fenestrae. World J Gastroenterol. 2000;6:1.  [PubMed]  [DOI]
23.  Van Oosten M, Van De Bilt E, De Vries HE, Van Berkel TJC, Kuiper J. Vascular adhesion molecule-1 and intercellular adhesion molecule-1 expres-sion on rat liver cells after lipopolysaccharide administration in vivo. Hepatology. 1995;22:1538-1546.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 71]  [Cited by in RCA: 69]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
24.  Tanaka Y, Adams DH, Shaw S. Proteoglycans on endothelial cells present adhesion-inducing cytokines to leukocytes. Immunol Today. 1993;14:111-115.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 302]  [Cited by in RCA: 283]  [Article Influence: 8.6]  [Reference Citation Analysis (0)]
25.  Furie B, Furie BC. Leukocyte crosstalk at the vascular wall. Thromb Haemost. 1997;78:306-309.  [PubMed]  [DOI]
26.  Adams DH, Nash GB. Disturbance of leucocyte circulation and adhesion to the endothelium as factors in circulatory pathology. Br J Anaesth. 1996;77:17-31.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 23]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
27.  Mackay CR, Imhof BA. Cell adhesion in the immune system. Immunol Today. 1993;14:99-102.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 182]  [Cited by in RCA: 163]  [Article Influence: 4.9]  [Reference Citation Analysis (0)]
28.  Wang J, Springer TA. Structural specializations of immunoglobulin superfamily members for adhesion to integrins and viruses. Immunol Rev. 1998;163:197-215.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 132]  [Cited by in RCA: 127]  [Article Influence: 4.5]  [Reference Citation Analysis (1)]
29.  Wu P, Li X, Zhou T, Zhang MJ, Chen JL, Wang WM, Chen N, Dong DC. Role of P-selectin and anti-P-selectin monoclonal antibody in apoptosis during hepatic/renal ischemia reperfusion injury. World J Gastroenterol. 2000;6:244-247.  [PubMed]  [DOI]
30.  Marzi I, Maier M, Herzog C, Bauer M. Influence of pentoxifylline and albifylline on liver microcirculation and leukocyte adhesion after hemorrhagic shock in the rat. J Trauma. 1996;40:90-96.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 25]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
31.  Mantovani A, Bussolino F, Dejana E. Cytokine regulation of endothelial cell function. FASEB J. 1992;6:2591-2599.  [PubMed]  [DOI]
32.  Mantovani A, Bussolino F, Introna M. Cytokine regulation of endothelial cell function: from molecular level to the bedside. Immunol Today. 1997;18:231-240.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 290]  [Cited by in RCA: 244]  [Article Influence: 8.4]  [Reference Citation Analysis (0)]
33.  Mantovani A, Garlanda C, Introna M, Vecchi A. Regulation of endothelial cell function by pro- and anti-inflammatory cytokines. Transplant Proc. 1998;30:4239-4243.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 29]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
34.  Zhang GQ, Yu H, Zhou XQ, Liao D, Xie Q, Wang B. TNF-α induced apoptosis and necrosis of mice hepatocytes. Shijie Huaren Xiaohua Zazhi. 2000;8:303-306.  [PubMed]  [DOI]
35.  Schlag G, Redl H. Mediators of injury and inflammation. World J Surg. 1996;20:406-410.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 109]  [Cited by in RCA: 90]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
36.  Jansen MJ, Hendriks T, Vogels MT, van der Meer JW, Goris RJ. Inflammatory cytokines in an experimental model for the multiple organ dysfunction syndrome. Crit Care Med. 1996;24:1196-1202.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 45]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
37.  Bone RC. Immunologic dissonance: a continuing evolution in our understanding of the systemic inflammatory response syndrome (SIRS) and the multiple organ dysfunction syndrome (MODS). Ann Intern Med. 1996;125:680-687.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 490]  [Cited by in RCA: 450]  [Article Influence: 15.0]  [Reference Citation Analysis (1)]
38.  Smail N, Messiah A, Edouard A, Descorps-Declere A, Duranteau J, Vigue B, Mimoz O, Samii K. Role of systemicinflammatory response syndrome and infection in the occurrence of early multiple organ dysfunction syndrome following severe trauma. Intensive Care Med. 1995;21:813-816.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 55]  [Cited by in RCA: 51]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
39.  Faist E, Kim C. Therapeutic immunomodulatory approaches for the control of systemic inflammatory response syndrome and the prevention of sepsis. New Horiz. 1998;6:S97-102.  [PubMed]  [DOI]
40.  Bernard GR. Research in sepsis and acute respiratory distress syndrome: are we changing course? Crit Care Med. 1999;27:434-436.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 17]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
41.  Bone RC. Why sepsis trials fail. JAMA. 1996;276:565-566.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 125]  [Cited by in RCA: 89]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
42.  Piper RD, Cook DJ, Bone RC, Sibbald WJ. Introducing Critical Appraisal to studies of animal models investigating novel therapies in sepsis. Crit Care Med. 1996;24:2059-2070.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 95]  [Cited by in RCA: 87]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
43.  Abraham E. Why immunomodulatory therapies have not worked in sepsis. Intensive Care Med. 1999;25:556-566.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 197]  [Cited by in RCA: 170]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
44.  Nasraway SA. Sepsis research: we must change course. Crit Care Med. 1999;27:427-430.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 44]  [Cited by in RCA: 36]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
Footnotes

Edited by Jason Carr

Write to the Help Desk