BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Gastroenterol. Aug 21, 2026; 32(31): 119570
Published online Aug 21, 2026. doi: 10.3748/wjg.119570
Depleting apolipoprotein C3 alleviates acute pancreatitis in hamsters but not in mice
Gong-Lie Chen, Kai-Kai Lu, Ping-Ping Lai, Yi-Tong Xu, Yu-Fei Han, Wei Huang, Yu-Hui Wang, Xun-De Xian, Institute of Cardiovascular Sciences, School of Basic Medical Sciences, Peking University Health Science Center, State Key Laboratory of Vascular Homeostasis and Remodeling, Peking University, Beijing 100191, China
Wen-Xi Zhang, Department of Pathophysiology, Second Military Medical University, Shanghai 200433, China
Zi-Hao Zhou, Department of Laboratory Medicine, Peking University Third Hospital, Beijing 100191, China
Yue Zhang, Department of Health Management, The First Affiliated Hospital, Jiangxi Medical College Nanchang University, Nanchang 330006, Jiangxi Province, China
ORCID number: Xun-De Xian (0000-0003-3059-1254).
Co-first authors: Gong-Lie Chen and Kai-Kai Lu.
Co-corresponding authors: Yue Zhang and Xun-De Xian.
Author contributions: Huang W conceived the research. Chen GL and Lu KK conducted the experiments, performed the data analysis, and wrote the manuscript with figures, and contributed equally as co-first authors. Zhang WX, Lai PP, Xu YT, Han YF, and Zhou ZH assisted in sample collection. Wang YH, Zhang Y, and Xian XD reviewed and supervised the study. Zhang Y, and Xian XD contributed equally as co-corresponding authors. All authors have reviewed the final manuscript and confirm its approval for publication.
AI contribution statement: Only Grammarly was used during the preparation of this manuscript and answering-reviewers. The main text was originally written by the authors. AI tools were only used for language polishing and writing assistance. No portion of the main text was directly generated by AI. AI tools were used for language polishing and writing assistance, but not for translation and data analysis. The study design and interpretation of results were performed solely by the authors. All images were created by the authors using non-AI-based software or acquired from experimental results.
Supported by the Jiangxi Provincial Natural Science Foundation, China, No. 20212BAB216022; the National Natural Science Foundation of China, No. 82270479 and No. 82501040; and China Postdoctoral Science Foundation, No. 2025M771442.
Institutional animal care and use committee statement: All experimental procedures were conducted in accordance with the guidelines approved by the Institutional Animal Care and Use Committee of Peking University (No. LA2015-012).
Conflict-of-interest statement: The authors declare that they have no conflicts of interest.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: No additional data are available.
Corresponding author: Xun-De Xian, PhD, Professor, Institute of Cardiovascular Sciences, School of Basic Medical Sciences, Peking University Health Science Center, State Key Laboratory of Vascular Homeostasis and Remodeling, Peking University, No. 38 Xueyuan Road, Huayuanlu Subdistrict, Haidian District, Beijing 100191, China. xianxunde@bjmu.edu.cn
Received: February 2, 2026
Revised: April 8, 2026
Accepted: May 18, 2026
Published online: August 21, 2026
Processing time: 185 Days and 15.7 Hours

Abstract
BACKGROUND

Acute pancreatitis (AP) is an inflammatory disease with a complex pathogenesis. A subset of cases is closely associated with hypertriglyceridemia (HTG). Apolipoprotein C3 (ApoC3) is a key regulator of lipid metabolism in circulation, and previous studies primarily focus on its roles in metabolic diseases such as atherosclerosis and metabolic dysfunction-associated steatotic liver disease. However, its impact on HTG-associated AP has not been fully clarified.

AIM

To investigate ApoC3’s role in AP under different lipotoxic conditions and to assess whether targeting ApoC3 alleviates pancreatic injury.

METHODS

ApoC3 knockout (ApoC3-/-) hamsters and mice were generated, and three AP models were established: Caerulein-induced AP, ethanol plus palmitoleic acid [ethanol (EtOH) + palmitoleic acid (POA)]-induced AP, and a high-fat diet (HFD) combined with caerulein (HFD + caerulein)-induced AP. Multiple parameters were evaluated, including plasma lipid levels, pancreatic enzyme activity, histological damage scores, expression of inflammatory markers, and immune cell infiltration.

RESULTS

In the caerulein-induced AP model, loss of ApoC3 did not confer significant protection in mice. However, in hamsters, ApoC3 deficiency significantly reduced plasma triglyceride and nonesterified fatty acid levels, attenuated the elevated levels of pancreatic enzymes and tissue injury, downregulated the mRNA expression of pro-inflammatory and pro-apoptotic genes such as Tnf-α, interleukin-6, interleukin-18, Nlrp3, and Bax, and reduced infiltration of myeloperoxidase-positive neutrophils and cluster of differentiation 68-positive macrophages. Moreover, these beneficial effects were also observed in ApoC3-/- hamsters with AP induced by EtOH + POA or HFD + caerulein, suggesting that ApoC3 plays a pathogenic role under various lipotoxic conditions.

CONCLUSION

ApoC3 promotes HTG-associated AP. Its deficiency protects against AP by improving lipid profiles, reducing inflammation and apoptosis, and alleviating pancreatic injury, supporting therapeutic targeting.

Key Words: Acute pancreatitis; Apolipoprotein C3; Hypertriglyceridemia; Hamster model; Inflammation

Core Tip: Hypertriglyceridemia (HTG) has been shown to cause acute pancreatitis (AP), but the mechanisms remain unclear. This study identified apolipoprotein C3 (ApoC3) as a key player in AP pathogenesis. In three hamster AP models, ApoC3 deficiency significantly reduced pancreatic injury by improving lipid metabolism, suppressing inflammatory cytokine production, and limiting immune cell infiltration. In contrast, ApoC3 deficiency showed no protective effect in mice, underscoring the importance of appropriate model selection. Our findings establish ApoC3 as a critical molecular bridge between dyslipidemia and pancreatic inflammation, highlighting its potential as a novel therapeutic target for HTG-related AP.



INTRODUCTION

Acute pancreatitis (AP) is a common clinical abdominal emergency triggered by various factors[1,2]. Its pathological progression involves premature activation of pancreatic acinar cells, release of pro-inflammatory cytokines, focal necrosis, and systemic inflammatory response syndrome[3]. While mild AP is usually self-limiting, severe cases can rapidly progress to multiple organ dysfunction syndrome, which has a high mortality rate[4]. Therefore, elucidating the underlying mechanisms of AP and identifying effective therapeutic targets are of critical clinical importance.

In recent years, metabolic dysregulation, particularly hypertriglyceridemia (HTG), has been widely recognized as a major risk factor for AP[5]. Epidemiological studies have shown that HTG has become the third leading cause of AP, following gallstones and alcohol consumption, with an increasing incidence globally[6]. More importantly, HTG levels are positively correlated with the severity of AP[7]. However, specific treatment options for HTG-related AP remain lacking, and its molecular pathogenesis requires further clarification.

Apolipoprotein C3 (ApoC3) is a small protein synthesized and secreted primarily by the liver and small intestine. It is mainly present in very low-density lipoproteins (VLDLs) and high-density lipoproteins (HDLs), playing a critical role in triglyceride (TG) metabolism[8]. ApoC3 increases plasma TG levels by inhibiting lipoprotein lipase (LPL) activity and hindering the hepatic clearance of TG-rich lipoproteins (TRLs)[9]. Previous studies have confirmed that elevated ApoC3 levels are closely associated with metabolic disorders such as atherosclerosis and nonalcoholic fatty liver disease[10,11]. Moreover, ApoC3 may participate in chronic inflammatory processes by activating toll-like receptors (TLRs) and the NLR family pyrin domain containing 3 (NLRP3) inflammasome pathway[12,13].

Although the role of ApoC3 in metabolic diseases has been extensively studied, its function in AP remains poorly understood. It is still unclear whether ApoC3 plays a critical regulatory role in the pathogenesis of HTG-related AP or whether its deficiency can alleviate pancreatic inflammation and injury.

The present study evaluated the role of ApoC3 deficiency in a murine model of caerulein-induced AP, which revealed no significant improvement, suggesting that mice may not be suitable for modeling pancreatic injury under lipotoxic conditions. Therefore, we employed a hamster model, whose lipid metabolic profile is more comparable to that of humans. Using ApoC3 knockout (ApoC3-/-) hamsters, we established three distinct AP models: Caerulein-induced AP, ethanol plus palmitoleic acid (EtOH + POA)-induced AP, and a high-fat diet (HFD) combined with caerulein (HFD + caerulein)-induced AP. We systematically assessed the role of ApoC3 in AP from multiple dimensions, including plasma lipid levels, pancreatic enzyme activity, histopathological alterations, and inflammation-related molecular pathways. Our findings will provide a theoretical basis for the development of ApoC3-targeted interventions and offer new insights and directions for the treatment of HTG-associated AP.

MATERIALS AND METHODS
Animals

The wild-type (WT) Syrian golden hamsters and mice were purchased from Vital River Laboratory Animal Technology Co. (Beijing, China). ApoC3-/-hamsters were generated from the WT background using CRISPR/Cas9 technology in our laboratory as described previously[14]. Similarly, the ApoC3-/- mice were also established in-house using the same method. All animals were housed in an appropriate environment with room temperature maintained at 22-24 °C and humidity at 45%-55%, a 12-hour light/12-hour dark cycle, and free access to food and water. Hamsters were fed either a chow diet (CD; 20% protein and 4% fat; Beijing Keao Xieli Feed Co., Ltd.) or a HFD containing 20% fat and 0.5% cholesterol. All experimental procedures were conducted in accordance with the guidelines approved by the Institutional Animal Care and Use Committee of Peking University (LA2015-012).

Induction of AP models

To generate the caerulein-induced AP model, mice and hamsters were randomly assigned to groups and then administered 10 hourly intraperitoneal injections of 50 μg/kg caerulein (Pep03263, Nanjing Peptide Industry Biotech Co., Ltd., China). The control group received equal volumes of saline used to dissolve the caerulein. Mice and hamsters were sacrificed at 24 hours after the first injection for histological analysis of the pancreatic tissues.

To establish the fatty acid ethyl ester-induced AP model, hamsters received two intraperitoneal injections of EtOH (1.35 g/kg) combined with POA (200 mg/kg; 373-49-9, Sigma-Aldrich, United States), with a 1-hour interval between injections. A protective injection of 500 μL of saline was performed immediately prior to the administration of EtOH and POA to mitigate localized peritoneal organ damage from EtOH. Control hamsters received only saline injections. Hamsters were sacrificed at 24 hours following the initial injection for subsequent analysis.

Plasma collection and biochemical assays

Anticoagulated blood samples were collected via the retro-orbital venous sinus at designated times, followed by centrifugation at 4 °C to harvest the plasma supernatant. The plasma TG concentrations were measured by employing an enzymatic method, with commercially available kits (000000220, Biosino Biotechnology and Science Inc., China). The free fatty acid levels were also quantified with a commercially enzymatic kit (633-52001, Wako, Japan), according to the manufacturer’s instructions. For measurement of the amylase and lipase activities, plasma samples were subjected to ultracentrifugation at 25000 rpm for another 30 minutes to remove lipemia interference. In addition, plasma samples were diluted with saline to a suitable concentration within the instrument’s detection range. The amylase and lipase activities were then assayed separately using dedicated reagent slides on a Catalyst One Chemistry Analyzer (IDEXX Laboratories, Inc., Westbrook, ME, United States).

Pancreatic tissue collection and histological processing

The pancreas was harvested from each animal after it was sacrificed and fixed in 4% paraformaldehyde for 24 hours at 4 °C. Following dehydration, the pancreatic tissues were embedded in paraffin. Serial sections (5-μm thickness) were cut and mounted on glass slides. The prepared sections were then stained with hematoxylin and eosin (HE) using standard protocols. For histopathological scoring of AP, HE-stained pancreatic sections were evaluated in a blinded manner by two investigators. Multiple established histopathological features, such as oedema, inflammatory cell infiltration, acinar cell necrosis, and total histology scores, were evaluated according to previously established criteria[15].

Immunofluorescence

Neutrophil and macrophage infiltration in pancreatic tissues was assessed by immunofluorescence using antibodies against myeloperoxidase (MPO; ab9535, Abcam, United Kingdom) and cluster of differentiation 68 (CD68; BM3639, Boster, China), respectively. Briefly, paraffin sections were deparaffinized and endogenous peroxidase activity was quenched with 0.3% H2O2. Antigen retrieval was performed in EDTA buffer for 10 minutes at 95 °C. After blocking, sections were incubated overnight at 4 °C with primary antibodies (anti-MPO, 1:200; anti-CD68, 1:200), followed by the corresponding secondary antibodies and diamidino phenylindole (DAPI) reagent (D9542, Sigma, United States) for 1 hour at room temperature in the dark. Images were captured using a confocal fluorescence scanning microscope.

RNA extraction and quantitative real-time polymerase chain reaction

For total RNA extraction, frozen pancreatic tissues were first pulverized in liquid nitrogen and then processed using the Trizol reagent (ET111-01-V2, TransGen Biotech, China). Subsequently, cDNA was synthesized from the RNA by reverse transcription with a First-Strand cDNA Synthesis Kit (AT301-03, TransGen Biotech, China). Quantitative real-time polymerase chain reaction (PCR) was performed with SYBR Green qPCR mix (Q712-02, Vazyme Biotech, China) with the Mx3000 Multiple Quantitative PCR System (Agilent Technologies, United States). β-Actin was used as an internal control to normalize the relative gene expression of mRNA. The primer sequences used are listed in Table 1.

Table 1 Primer sequences for quantitative real-time polymerase chain reaction.
Gene
Forward primer
Reverse primer
Il6CAACCCTGGCTGTATGGACAGTGCTCTGAATGACTCTGGCT
Tnf-αTCCTGGCCTCCTTTTTGCTTCCCGTAGGGCGATTACAGTC
BaxGGCCTTTTTGCTACAGGGTTTCTCATCTCCGATTCGCCTGAG
Nlrp3CTAAAACCACATCCTTCCTGCCTGAAAAGCTCCTCCAGAGAGC
Il-18ACTCCCTGGTGAATGACCCTAGGCTCATCCGTGTGCTATG
β-ActinGGCGGACTGTTACTGAGCTGACTTTGGGGGATGCTTGCTC
Statistical analysis

GraphPad Prism 10.1.2 was used for statistical analysis. Data were expressed as the mean ± SEM. For comparisons between two independent samples, the Shapiro-Wilk test was first applied to assess normality. When data followed a normal distribution, a two-tailed t-test was selected, with the Student’s t-test used for equal variances and the Welch’s t-test used for unequal variances. For non-normally distributed data, the nonparametric Mann-Whitney U test was employed. To examine the effects of two independent variables and their interaction, two-way analysis of variance was performed. When a main effect or interaction reached statistical significance (P < 0.05), post hoc multiple comparisons were conducted using Tukey’s honest significant difference test for between-subject factors and Bonferroni correction for repeated-measures designs. A P value < 0.05 was considered statistically significant.

RESULTS
ApoC3 deficiency does not significantly ameliorate caerulein-induced AP in mice

To evaluate whether ApoC3 deficiency confers protection against AP, a caerulein-induced AP model was established in mice. Male WT and ApoC3-/- mice, aged 8-9 weeks, were intraperitoneally injected with caerulein (50 μg/kg) every hour for a total of 10 injections. The mice were sacrificed at 24 hours after the first injection, and blood and pancreatic tissues were collected for biochemical and histological analyses (Figure 1A). In terms of lipid metabolism, the plasma TG levels were slightly higher in the WT group than in the ApoC3-/- group. However, the overall change in TG levels was minor in both groups and did not reach a hypertriglyceridemic state (Figure 1B), suggesting that ApoC3 deficiency has limited effects on lipid metabolism in this model. Regarding serum enzymatic indicators of pancreatic injury, both the WT and ApoC3-/- mice exhibited significantly elevated plasma amylase activity at 12 hours post-injection, indicating successful model induction. However, there was no statistically significant difference between the two genotypes in response to caerulein treatment (Figure 1C). A similar trend was observed in lipase activity: The WT mice showed a marked increase, while the ApoC3-/- mice exhibited a slightly attenuated response, although the difference was not statistically significant (Figure 1D). These findings suggest that ApoC3 deficiency does not significantly mitigate caerulein-induced enzymatic injury. Histological examination via HE staining revealed marked acinar cell oedema, structural disruption, and inflammatory cell infiltration in both groups, with no apparent differences between the WT and ApoC3-/-mice (Figure 1E). Quantitative histological scoring, including oedema, inflammation, necrosis, and total pathology score, also showed no significant differences between genotypes (Figure 1F-I), further supporting the conclusion that ApoC3 deficiency does not ameliorate pancreatic tissue injury in this model. In summary, ApoC3 gene knockout does not improve the pathological features of caerulein-induced AP in mice.

Figure 1
Figure 1 Depletion of apolipoprotein C3 does not ameliorate caerulein-induced acute pancreatitis in mice. A: Experimental timeline: 8- to 9-week-old male mice received intraperitoneal injections of caerulein (50 μg/kg) once per hour for a total of 10 injections. Pancreatic tissues and blood samples were collected 24 hours after the first injection; B-D: Comparison of plasma triglyceride levels (B), amylase activity (C), and lipase activity (D) between wild type (WT) and apolipoprotein C3 knockout (ApoC3-/-) mice, n = 4; E: Representative hematoxylin and eosin staining of pancreatic tissues from WT and ApoC3-/- mice, with enlarged images shown below; F-I: Quantitative histological scoring of pancreatic tissue: Oedema (F), inflammation (G), necrosis (H), and total histology score (I) in WT and ApoC3-/- mice, n = 4. Data are presented as the mean ± SEM. aP < 0.05, bP < 0.001. ApoC3: Apolipoprotein C3; AP: Acute pancreatitis; NS: Not significant; W: Week; WT: Wild type; ApoC3-/-: Apolipoprotein C3 knockout; HE: Hematoxylin and eosin.
Inactivation of ApoC3 significantly alleviates caerulein-induced AP in hamsters

Given the lack of observable protective effects in the murine model of caerulein-induced AP, we extended our investigation to a hamster model. Hamsters are considered to have lipid metabolism that is more similar to humans compared to mice, with respect to the lipid composition and lipoprotein profiles, making them potentially more suitable for studying lipotoxicity-related mechanisms in AP (Figure 2).

Figure 2
Figure 2 Inactivation of apolipoprotein C3 alleviates caerulein-induced acute pancreatitis in hamsters. A: Time-course curves of plasma amylase and lipase activities in wild type (WT) hamsters; B: Experimental timeline: 8- to 9-week-old male hamsters were intraperitoneally injected with caerulein (50 μg/kg) every hour for a total of 10 times, and samples were collected 24 hours after the first injection; C-F: Plasma biochemical parameters among different treatment groups, including triglycerides (C), NEFA (D), amylase activity (E), and lipase activity (F), n = 3-4; G: Representative hematoxylin and eosin staining of pancreatic tissue; enlarged views of selected areas are shown below; H-K: Quantitative histological scoring of pancreatic tissue: Oedema (H), inflammation (I), necrosis (J), and total pathology score (K), n = 3-4; L-P: Relative mRNA expression levels of inflammation- and apoptosis-related genes in the pancreas: Tnf-α (L), Il-6 (M), Nlrp3 (N), Bax (O), and Il-18 (P), n = 3-4; Q and R: Representative immunofluorescence staining of MPO (green) with DAPI (blue) for nuclear counterstaining (Q), and quantitative analysis of relative MPO-positive areas (R) in pancreatic tissue of WT and apolipoprotein C3 knockout (ApoC3-/-) hamsters. White arrowheads indicate MPO-positive staining; scale bar: 75 μm; S and T: Immunofluorescence staining of CD68 (green) with DAPI (blue) (S), and quantification of relative CD68-positive areas (T) in pancreatic tissue of WT and ApoC3-/- hamsters. White arrowheads indicate CD68-positive staining; scale bar: 75 μm. For each group, three animals were examined. Two fields of view per animal were quantified, and each field was considered an independent observation (n = 6 per group) for statistical comparisons. Data are presented as the mean ± SEM. aP < 0.05, bP < 0.01, cP < 0.001, and dP < 0.0001. ApoC3: Apolipoprotein C3; ApoC3-/-: Apolipoprotein C3 knockout; AP: Acute pancreatitis; HE: Hematoxylin and eosin; NEFA: Non-esterified fatty acids; Tnf-α: Tumor necrosis factor-α; Il-6: Interleukin-6; Nlrp3: NLR family pyrin domain containing 3; Bax: BCL2-associated X protein; Il-18: Interleukin-18; DAPI: 4’,6-diamidino-2-phenylindole; MPO: Myeloperoxidase; CD68: Cluster of differentiation 68.

In WT hamsters, the plasma amylase and lipase activities increased rapidly within 9-18 hours after caerulein injection, indicating substantial pancreatic injury, with peak levels observed at 9 hours (Figure 2A). Therefore, 9 hours was chosen as the representative time point for subsequent enzymatic analyses. To construct the model, 8- to 9-week-old male hamsters received hourly intraperitoneal injections of caerulein (50 μg/kg) for a total of 10 doses, and samples were collected 24 hours later (Figure 2B). Plasma analyses showed that the TG levels were significantly elevated in the WT group but were markedly lower in the ApoC3-/- group (Figure 2C), indicating a basal lipid-lowering effect of ApoC3 deficiency. Additionally, the NEFA levels were significantly increased in the WT animals, while the ApoC3-/- hamsters effectively suppressed NEFA accumulation (Figure 2D). In terms of the serum enzyme levels, both the amylase and lipase activities were significantly elevated in the WT group, whereas the increases were notably milder in the ApoC3-/- hamsters (Figure 2E and F). These changes in blood lipids and pancreatic enzymes collectively indicate that ApoC3 deficiency helps to mitigate caerulein-induced lipotoxicity and acinar cell injury. Furthermore, histological analysis was consistent with these findings. HE staining revealed that pancreatic tissues from the WT animals exhibited a disrupted acinar architecture, severe oedema, and pronounced inflammatory cell infiltration, whereas tissues from the ApoC3-/- hamsters displayed relatively intact structures with substantially reduced inflammation (Figure 2G). Quantitative histological scoring demonstrated significantly lower scores in the ApoC3-/-animals for oedema (Figure 2H), inflammation (Figure 2I), necrosis (Figure 2J), and total pathology (Figure 2K), indicating a marked improvement in overall tissue injury.

At the molecular level, the mRNA expression of pro-inflammatory and pro-apoptotic markers was significantly downregulated in the ApoC3-/- pancreatic tissue. The expression levels of interleukin-6 (Il-6) (Figure 2M), Bax (Figure 2O), and interleukin-18 (Il-18) (Figure 2P) were significantly decreased, while Tnf-α (Figure 2L) and Nlrp3 (Figure 2N) were also reduced. These results suggest that ApoC3 deficiency attenuates pancreatic inflammation and injury by suppressing inflammatory cytokine production and apoptotic signaling pathways. Immunofluorescence staining further supported this conclusion. The WT pancreatic tissues exhibited marked infiltration of MPO-positive neutrophils (Figure 2Q and R) and CD68-positive macrophages (Figure 2S and T), whereas the ApoC3-/- tissues showed significantly fewer of these inflammatory cells. These findings indicate that ApoC3 deficiency may reduce immune cell recruitment and thereby limit inflammatory infiltration.

In summary, ApoC3 deficiency confers a clear protective effect in the hamster model of caerulein-induced AP, as evidenced by improvements in lipid metabolism, reduced pancreatic enzyme levels, preservation of tissue architecture, suppression of pro-inflammatory cytokines, and reduced immune cell infiltration. In contrast to the lack of an effect observed in mice, hamsters appear to be more responsive to ApoC3 deletion, suggesting that they may represent a more suitable model for studying lipotoxicity-associated AP.

ApoC3 deficiency alleviates EtOH + POA-induced AP in hamsters

To further investigate the role of ApoC3 under different pathogenic mechanisms, we established an AP model in hamsters using a combination of EtOH and POA to evaluate whether ApoC3 deficiency exerts protective effects under lipotoxic conditions. Male WT and ApoC3-/- hamsters, aged 8-9 weeks, were intraperitoneally injected with EtOH (1.35 g/kg) and POA (150 mg/kg), and blood samples were collected at 0, 6, 9, 12, and 24 hours post-injection. The animals were sacrificed at the 24-hour time point for tissue collection (Figure 3A). This model mimics pancreatic injury caused by the combined assault of exogenous fatty acids and ethanol. At the 24-hour time point, the plasma TG levels were significantly higher in the WT hamsters treated with EtOH + POA compared to those on a normal diet. In contrast, the ApoC3-/- hamsters subjected to the same treatment exhibited markedly lower TG levels (Figure 3B). Given that elevated TG is a critical pathogenic factor in lipotoxic pancreatitis, ApoC3 deficiency may confer protection by improving lipid metabolism and attenuating lipid-induced toxicity to the pancreas. In addition, serum amylase activity in the WT group increased rapidly between 6 hours and 12 hours following EtOH + POA administration, peaking at 9-12 hours. In contrast, the elevation was markedly attenuated in the ApoC3-/- group (Figure 3C). Since amylase is a key enzymatic marker of acinar cell injury, these findings indicate that ApoC3 deficiency reduces pancreatic enzyme release and alleviates acinar damage. Histological analysis revealed that pancreatic tissues from the WT animals exhibited severe oedema, disrupted acinar architecture, increased necrotic regions, and abundant inflammatory cell infiltration. In contrast, the ApoC3-/-hamsters displayed a relatively intact tissue structure with significantly less oedema and inflammation (Figure 3D). Histological scoring quantitatively suggested these differences: The ApoC3-/- animals showed significantly lower scores for oedema, inflammation, necrosis, and total pathology compared to their WT counterparts (Figure 3E).

Figure 3
Figure 3 Apolipoprotein C3 deficiency alleviates ethanol + palmitoleic acid-induced acute pancreatitis in hamsters. A: Schematic of the experimental protocol: 8- to 9-week-old male hamsters were intraperitoneally injected with ethanol (EtOH) (1.35 g/kg) and palmitoleic acid (POA) (150 mg/kg) to induce pancreatitis. Blood samples were collected at 0, 6, 9, 12, and 24 hours, and the animals were sacrificed at 24 hours; B: Plasma triglyceride levels were measured across treatment groups, n = 3-5; C: Plasma amylase activity was assessed at multiple time points in wild type and apolipoprotein C3 knockout hamsters with or without EtOH + POA, n = 3-5; D: Representative hematoxylin and eosin-stained pancreatic tissue sections, with enlarged views shown below; E: Quantitative histological scoring of pancreatic tissue, evaluating oedema, inflammation, necrosis, and total pathology score, n = 3-5. Data are presented as the mean ± SEM. aP < 0.05, bP < 0.01 and cP < 0.001. ApoC3: Apolipoprotein C3; ApoC3-/-: Apolipoprotein C3 knockout; AP: Acute pancreatitis; EtOH: Ethanol; POA: Palmitoleic acid; HE: Hematoxylin and eosin.

In summary, in the EtOH + POA-induced AP model, ApoC3 deficiency confers protection through multiple mechanisms, including reductions in blood lipid levels, pancreatic enzymatic injury, and histopathological damage. These results further support the critical role of ApoC3 in the pathogenesis of lipotoxic pancreatitis and demonstrate that its deficiency effectively attenuates acinar cell injury caused by the combined effects of fatty acids and ethanol.

Loss of ApoC3 significantly attenuates caerulein-induced AP in hamsters under HFD conditions

To further investigate the potential protective role of ApoC3 deficiency in the context of AP under high-fat conditions, we established a HFD combined with caerulein-induced AP model in hamsters (Figure 4). Male hamsters at 8 weeks of age were fed a HFD for two months. At 16 weeks, they received hourly intraperitoneal injections of caerulein (50 μg/kg) for a total of 10 times, and samples were collected 24 hours later (Figure 4A). This model mimics the clinical scenario of a high-fat background plus an acute insult that often triggers AP.

Figure 4
Figure 4 Loss of apolipoprotein C3 alleviates caerulein-induced acute pancreatitis under high-fat diet conditions in hamsters. A: Schematic of the experimental protocol: 8-week-old male hamsters were fed a high-fat diet (HFD) for 2 months. At 16 weeks of age, they received hourly intraperitoneal injections of caerulein (50 μg/kg) for a total of 10 times and were sacrificed 24 hours after the first injection; B and C: Plasma triglyceride (B) and NEFA (C) levels were measured under CD and HFD conditions in the indicated treatment groups, n = 4-6; D and E: Plasma amylase (D) and lipase (E) activities were assessed across treatment groups; F: Representative hematoxylin and eosin-stained pancreatic tissue sections from WT and apolipoprotein C3 knockout (ApoC3-/-) hamsters; enlarged views are shown below, n = 4-6; G-J: Histological scoring of pancreatic tissue from WT and ApoC3-/- hamsters, including oedema (G), inflammation (H), necrosis (I), and total pathology score (J), n = 4-6; K-O: Relative mRNA expression levels of inflammation- and apoptosis-related genes in pancreatic tissue from WT and ApoC3-/- hamsters, including Tnf-α (K), Il-6 (L), Nlrp3 (M), Bax (N), and Il-18 (O) , n = 4; P and Q: Representative immunofluorescence staining of MPO (green) with DAPI (blue) nuclear counterstaining (P), and quantification of the relative MPO-positive area in pancreatic tissue of WT and ApoC3-/- hamsters (Q). White arrowheads indicate MPO-positive staining; scale bar: 75 μm; R and S: Representative immunofluorescence staining of CD68 (green) with DAPI (blue) (R), and quantification of the relative CD68-positive area in the same groups (S). White arrowheads indicate CD68-positive staining; scale bar: 100 μm. For each group, three animals were used; two fields of view per animal were quantified as independent observations (n = 6 per group). Data are presented as the mean ± SEM. aP < 0.05, bP < 0.01, cP < 0.001, and dP < 0.0001. ApoC3: Apolipoprotein C3; ApoC3-/-: Apolipoprotein C3 knockout; AP: Acute pancreatitis; CD: Chow diet; HFD: High-fat diet; TG: Triglyceride; NEFA: Non-esterified fatty acid; WT: Wild type; Tnf-α: Tumor necrosis factor-α; Il-6: Interleukin-6; Nlrp3: NLR family pyrin domain containing 3; Bax: BCL2-associated X protein; Il-18: Interleukin-18; DAPI: 4’,6-diamidino-2-phenylindole; MPO: Myeloperoxidase; CD68: Cluster of differentiation 68.

In this model, the plasma TG levels were significantly elevated in the WT hamsters following HFD feeding, whereas the TG levels were markedly lower in the ApoC3-/- animals (Figure 4B). These results suggest that ApoC3 deficiency effectively reduces lipid accumulation and may exert a lipid-modulating protective effect, potentially decreasing the risk of lipotoxic injury to the pancreas under high-fat conditions. Both the serum amylase and lipase activities were significantly elevated in the WT group, while their increases were notably attenuated in the ApoC3-/- group (Figure 4D and E), indicating that ApoC3 deficiency mitigates enzyme release and alleviates acinar cell injury. Furthermore, the levels of NEFA were significantly higher in the WT group compared to the ApoC3-/- group (Figure 4C), suggesting that ApoC3 deficiency also suppresses fatty acid accumulation, thereby reducing both enzymatic and lipid-mediated pancreatic damage. Histological analysis with HE staining revealed severe structural disruption, marked oedema, and extensive inflammatory cell infiltration in the pancreas of WT hamsters, while the ApoC3-/- animals displayed a relatively preserved tissue architecture with notably reduced oedema and inflammation (Figure 4F). Quantitative histological scoring further supported these findings: The ApoC3-/- hamsters showed significantly lower scores for oedema, inflammation, necrosis, and overall pathology compared to their WT counterparts (Figure 4G-J), indicating substantial attenuation of pancreatic tissue damage at the histological level.

At the molecular level, the mRNA expression of key pro-inflammatory cytokines, including Tnf-α (Figure 4K) and Il-6 (Figure 4L), was markedly reduced in the ApoC3-/- pancreatic tissue. In addition, the expression of the inflammasome component Nlrp3 (Figure 4M), the apoptosis-related gene Bax (Figure 4N), and the pro-inflammatory cytokine Il-18 (Figure 4O) was also significantly downregulated. These findings suggest that ApoC3 deficiency may alleviate pancreatic damage by suppressing inflammatory cytokine production and inhibiting apoptotic signaling pathways. Immunofluorescence staining further supported these conclusions. In the WT animals, there was pronounced infiltration of MPO-positive neutrophils (Figure 4P and Q) and CD68-positive macrophages (Figure 4R and S) in the pancreatic tissue, while these inflammatory cell populations were significantly reduced in the ApoC3-/- group. This indicates that ApoC3 deficiency may limit local inflammatory responses by reducing immune cell recruitment.

In conclusion, under a HFD background, ApoC3 deficiency alleviates caerulein-induced AP through multiple mechanisms. These include improved lipid homeostasis, reduced pancreatic enzyme release, preservation of tissue structure (as evidenced by reduced oedema, inflammation, and necrosis), downregulation of inflammatory and apoptotic gene expression, and decreased immune cell infiltration. Collectively, these results highlight ApoC3 as a critical regulator of AP progression in lipotoxic contexts and support its potential as a therapeutic target for intervention.

DISCUSSION

This study systematically evaluated the pathogenic role of ApoC3 in the development of AP, and suggested that ApoC3 not only participates in lipid metabolism regulation under lipotoxic conditions, but also may aggravate pancreatic injury through promoting local inflammation and apoptosis. By establishing three distinct AP models in ApoC3-/- hamsters, we comprehensively assessed its function across multiple levels, including blood lipid profiles, pancreatic enzyme activities, histological changes, inflammatory cytokine expression, and immune cell infiltration, and suggested the consistent protective effect of ApoC3 deficiency under various lipotoxic challenges.

In the caerulein-induced AP model in mice, ApoC3 deficiency did not show any significant protective effects, suggesting that conventional mouse models may have certain limitations in recapitulating the pathophysiology of lipotoxic pancreatitis. Previous studies have shown that mice differ markedly from humans in lipoprotein structure, cholesterol transport, and lipase activity[16]. Notably, the plasma lipid profiles in mice are predominantly composed of HDL, which accounts for more than 70% of total cholesterol. This lipid metabolic pattern is distinctly different from that of humans, whose lipid profile is dominated by LDL[17]. Moreover, mice do not express cholesteryl ester transfer protein (CETP), resulting in cholesterol being primarily enriched in HDL. In contrast, hamsters do express CETP, which facilitates the transfer of cholesterol among VLDL, LDL, and HDL, making their cholesterol metabolism more comparable to that of humans[18]. In addition, the mechanistic interpretation of the differences between hamsters and mice in this study is primarily based on previously reported characteristics of lipid metabolism (e.g., differences in CETP expression and LPL activity). However, we did not directly measure LPL/lipolytic activity or lipoprotein particle composition in the two species. Therefore, these mechanistic explanations remain somewhat speculative and require further experimental validation.

These human-like features of lipid metabolism in hamsters may render them more sensitive to ApoC3 regulation and more prone to lipoprotein-mediated lipotoxic stress when ApoC3 expression is dysregulated. Although both mice and hamsters exhibited approximately a 50% reduction in plasma TG levels under ApoC3-deficient conditions, only hamsters demonstrated significant pancreatic protection. This discrepancy may be attributed to several factors. First, mice possess higher LPL activity and a stronger capacity for TRL clearance[16]. Therefore, even in the absence of ApoC3, pancreatic tissue in mice remains relatively unexposed to lipotoxic stress. In contrast, hamsters have a lower LPL activity, and ApoC3 deficiency more effectively relieves its inhibitory effect on lipolytic enzymes, thereby reducing the accumulation of TRLs and mitigating lipotoxic injury. Additionally, hamsters exhibit cholesterol absorption patterns and postprandial lipid dynamics that are similar to those of humans[18]. Their processes of dietary fat absorption, transport, and redistribution closely resemble human physiology, making them one of the most suitable small rodent models for mimicking human lipid metabolism. Thus, hamsters are particularly well-suited for studying HTG, lipotoxicity, and lipid-mediated inflammatory responses.

In this study, ApoC3-/- hamsters consistently exhibited protective effects across multiple lipotoxic AP models (caerulein, EtOH + POA, and HFD + caerulein), further emphasizing the profound impact of animal model selection on both experimental outcomes and translational potential. More importantly, the hamster model, by combining a HFD with acute stimulation, may better approximate the typical clinical course of AP triggered by acute stress (e.g., alcohol consumption or infection) in individuals with pre-existing hyperlipidemia. Our findings suggest the potential pathogenic role of ApoC3 in lipotoxic AP and provide a theoretical basis for its potential as a therapeutic target.

To date, research on ApoC3 in AP remains limited and has mainly focused on its metabolic functions. While previous studies have shown that loss-of-function mutations in the APOC3 gene lead to decreased plasma TG levels and reduced cardiovascular risk[19,20], our study expands its functional relevance to acute organ injury. Importantly, we validated the protective effect of ApoC3 deletion in multiple AP models, including caerulein stimulation, EtOH + POA, and the clinically relevant HFD + caerulein model, thus ensuring the robustness and broad applicability of our findings. Recent clinical evidence further underscores the role of ApoC3 in pancreatitis pathophysiology. A 2025 New England Journal of Medicine editorial[21] summarized that therapies targeting hepatic ApoC3 production (such as volanesorsen and plozasiran) not only reduced plasma TG levels but also were associated with a reduced incidence of AP (approximately 80% risk reduction) in patients with familial chylomicronemia syndrome, a specific and severe form of HTG. These findings suggest potential benefits beyond TG lowering, indicating a possible link between ApoC3 and pancreatic inflammation. However, whether these observations can be generalized to broader HTG-associated pancreatitis populations remains to be further investigated[21].

Traditionally, ApoC3 is recognized as a lipid-regulating factor associated with HTG[22]. Its known mechanisms involve inhibition of LPL activity and interference with the hepatic clearance of TRLs, resulting in sustained elevation of circulating TG[23]. However, our study revealed that even under comparable TG levels, the ApoC3-/- animals exhibited significantly milder pancreatic damage than the WT controls. This finding indicates that the pathogenic role of ApoC3 in AP may be at least partially independent of its lipid-regulatory function and may involve direct effects on inflammatory and cell death pathways. Mechanistically, we further validated the immunoregulatory role of ApoC3. It has been reported that ApoC3 can bind to TLR2/4 and activate the NLRP3 inflammasome pathway, thereby promoting immune cell recruitment and inflammatory cytokine production[12,24]. In the context of AP, our findings suggest that ApoC3 deficiency significantly suppressed the expression of Tnf-α, Il-6, Il-18, and Nlrp3 in pancreatic tissue as well as reduced the pro-apoptotic marker Bax. Moreover, immunofluorescence analysis revealed a marked reduction in MPO-positive neutrophils and CD68-positive macrophages within the pancreas of ApoC3-/- animals, suggesting that ApoC3 promotes tissue injury through a continuous “lipid metabolism-TLR-NLRP3-inflammation-apoptosis” cascade.

Importantly, the effects of ApoC3 in HTG-associated AP appear to involve both lipid-dependent and lipid-independent mechanisms. On the one hand, ApoC3 is well known to exacerbate HTG by inhibiting LPL activity and impairing the clearance of TRLs, thereby promoting lipotoxic stress in pancreatic tissue[25]. On the other hand, our findings, together with previous reports, suggest that ApoC3 may also directly modulate inflammatory responses independent of systemic lipid levels[26]. Notably, despite comparable reductions in plasma TG levels, the ApoC3-deficient animals exhibited differential degrees of pancreatic protection, indicating that lipid lowering alone cannot fully explain the observed effects. Mechanistically, ApoC3 has been shown to activate TLR2/4 signaling and the NLRP3 inflammasome, thereby enhancing cytokine production and immune cell recruitment[24,27]. These observations support a dual role of ApoC3 as both a regulator of lipid metabolism and a direct mediator of inflammatory signaling, highlighting the importance of distinguishing these two pathways when interpreting its contribution to HTG-associated AP.

Despite the mechanistic and translational strengths of our study, several limitations remain. First, the present work focused on genetic deletion models and did not address whether pharmacological inhibition of ApoC3 would produce comparable effects, which limits its immediate clinical applicability. Second, we did not investigate systemic manifestations of AP or injury to distal organs (e.g., lung, liver, or kidney), which may be addressed in future studies through organoid models or multi-organ interaction systems.

In summary, this study suggests that ApoC3 is a critical pathogenic driver of lipotoxic AP, with multifaceted roles in lipid metabolism, immune regulation, and tissue injury. ApoC3 not only acts as a key modulator of TG metabolism but also may serve as a molecular link bridging dyslipidemia and inflammatory pancreatic damage. These findings offer new insights into the pathogenesis of HTG-associated AP and support the potential of ApoC3-targeted therapeutic strategies. Future research should further explore the roles of ApoC3 in immune cell recruitment, metabolic-inflammatory crosstalk, and systemic inflammatory response syndrome, with the goal of advancing its potential clinical translational relevance in pancreatitis management.

CONCLUSION

This study found that ApoC3 did not significantly affect caerulein-induced AP in mice. However, in hamster models, ApoC3 deficiency markedly alleviated pancreatic injury under multiple lipotoxic conditions. The protective effects of ApoC3 deficiency were achieved through improvements in lipid metabolism, suppression of inflammatory responses, and inhibition of apoptosis. These findings suggest that ApoC3 is a key pathogenic factor in lipotoxic AP and represents a promising target for therapeutic intervention.

ACKNOWLEDGEMENTS

The authors gratefully acknowledge the expert technical support provided by Qiang Shen (Institute of Cardiovascular Sciences, Peking University).

References
1.  Trikudanathan G, Yazici C, Evans Phillips A, Forsmark CE. Diagnosis and Management of Acute Pancreatitis. Gastroenterology. 2024;167:673-688.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 160]  [Cited by in RCA: 151]  [Article Influence: 75.5]  [Reference Citation Analysis (1)]
2.  Gallo C, Dispinzieri G, Zucchini N, Invernizzi P, Massironi S. Autoimmune pancreatitis: Cornerstones and future perspectives. World J Gastroenterol. 2024;30:817-832.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 45]  [Cited by in RCA: 32]  [Article Influence: 16.0]  [Reference Citation Analysis (0)]
3.  Lugea A, Waldron RT, Mareninova OA, Shalbueva N, Deng N, Su HY, Thomas DD, Jones EK, Messenger SW, Yang J, Hu C, Gukovsky I, Liu Z, Groblewski GE, Gukovskaya AS, Gorelick FS, Pandol SJ. Human Pancreatic Acinar Cells: Proteomic Characterization, Physiologic Responses, and Organellar Disorders in ex Vivo Pancreatitis. Am J Pathol. 2017;187:2726-2743.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 89]  [Cited by in RCA: 77]  [Article Influence: 8.6]  [Reference Citation Analysis (2)]
4.  Wang Q, Peng Y, Jiang J, Liang Y, Chen Y, Chen L, Lin Y. Association between serum uric acid to serum creatinine ratio and in-hospital mortality in patients with severe acute pancreatitis: a retrospective study. BMC Gastroenterol. 2025;25:838.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
5.  Kiss L, Fűr G, Pisipati S, Rajalingamgari P, Ewald N, Singh V, Rakonczay Z Jr. Mechanisms linking hypertriglyceridemia to acute pancreatitis. Acta Physiol (Oxf). 2023;237:e13916.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 91]  [Reference Citation Analysis (4)]
6.  Yadav D, Lowenfels AB. The epidemiology of pancreatitis and pancreatic cancer. Gastroenterology. 2013;144:1252-1261.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1564]  [Cited by in RCA: 1416]  [Article Influence: 108.9]  [Reference Citation Analysis (8)]
7.  Song XF, Liu Y, Fei QM, Xu CL, Ji FP. Potential influence of gut microbiota on the process of hypertriglyceridemia-aggravated acute pancreatitis. World J Gastroenterol. 2026;32:114479.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
8.  Qu S, Perdomo G, Su D, D'Souza FM, Shachter NS, Dong HH. Effects of apoA-V on HDL and VLDL metabolism in APOC3 transgenic mice. J Lipid Res. 2007;48:1476-1487.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 48]  [Cited by in RCA: 45]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
9.  Basu D, Bornfeldt KE. Hypertriglyceridemia and Atherosclerosis: Using Human Research to Guide Mechanistic Studies in Animal Models. Front Endocrinol (Lausanne). 2020;11:504.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 22]  [Cited by in RCA: 33]  [Article Influence: 5.5]  [Reference Citation Analysis (0)]
10.  Tardif JC, Karwatowska-Prokopczuk E, Amour ES, Ballantyne CM, Shapiro MD, Moriarty PM, Baum SJ, Hurh E, Bartlett VJ, Kingsbury J, Figueroa AL, Alexander VJ, Tami J, Witztum JL, Geary RS, O'Dea LSL, Tsimikas S, Gaudet D. Apolipoprotein C-III reduction in subjects with moderate hypertriglyceridaemia and at high cardiovascular risk. Eur Heart J. 2022;43:1401-1412.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 21]  [Cited by in RCA: 171]  [Article Influence: 42.8]  [Reference Citation Analysis (1)]
11.  Chen BF, Chien Y, Tsai PH, Perng PC, Yang YP, Hsueh KC, Liu CH, Wang YH. A PRISMA-compliant meta-analysis of apolipoprotein C3 polymorphisms and nonalcoholic fatty liver disease. J Chin Med Assoc. 2021;84:923-929.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 6]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
12.  Qi Y, Chen C, Li X, Liu Y, Qi H, Xue Y, Yang F. Silencing ApoC3 alleviates LPS-induced acute lung injury by inhibiting TLR signaling pathway. Immunol Res. 2023;71:687-697.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
13.  Pu Z, Wang W, Xie H, Wang W. Apolipoprotein C3 (ApoC3) facilitates NLRP3 mediated pyroptosis of macrophages through mitochondrial damage by accelerating of the interaction between SCIMP and SYK pathway in acute lung injury. Int Immunopharmacol. 2024;128:111537.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 41]  [Reference Citation Analysis (0)]
14.  Guo M, Xu Y, Dong Z, Zhou Z, Cong N, Gao M, Huang W, Wang Y, Liu G, Xian X. Inactivation of ApoC3 by CRISPR/Cas9 Protects Against Atherosclerosis in Hamsters. Circ Res. 2020;127:1456-1458.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 39]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
15.  Wang Y, Kayoumu A, Lu G, Xu P, Qiu X, Chen L, Qi R, Huang S, Li W, Wang Y, Liu G. Experimental Models in Syrian Golden Hamster Replicate Human Acute Pancreatitis. Sci Rep. 2016;6:28014.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 16]  [Cited by in RCA: 22]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
16.  Kimura N, Kikumori A, Kawase D, Okano M, Fukamachi K, Ishida T, Nakajima K, Shiomi M. Species differences in lipoprotein lipase and hepatic lipase activities: comparative studies of animal models of lifestyle-related diseases. Exp Anim. 2019;68:267-275.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 11]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
17.  Minniti ME, Pedrelli M, Vedin LL, Delbès AS, Denis RGP, Öörni K, Sala C, Pirazzini C, Thiagarajan D, Nurmi HJ, Grompe M, Mills K, Garagnani P, Ellis ECS, Strom SC, Luquet SH, Wilson EM, Bial J, Steffensen KR, Parini P. Insights From Liver-Humanized Mice on Cholesterol Lipoprotein Metabolism and LXR-Agonist Pharmacodynamics in Humans. Hepatology. 2020;72:656-670.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 15]  [Cited by in RCA: 31]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
18.  Berriozabalgoitia A, Ruiz de Gordoa JC, Amores G, Virto M. Dietary fatty acid metabolism: New insights into the similarities of lipid metabolism in humans and hamsters. Food Chem (Oxf). 2022;4:100060.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 6]  [Reference Citation Analysis (0)]
19.  Norata GD, Tsimikas S, Pirillo A, Catapano AL. Apolipoprotein C-III: From Pathophysiology to Pharmacology. Trends Pharmacol Sci. 2015;36:675-687.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 121]  [Cited by in RCA: 154]  [Article Influence: 14.0]  [Reference Citation Analysis (0)]
20.  Packard CJ, Pirillo A, Tsimikas S, Ference BA, Catapano AL. Exploring apolipoprotein C-III: pathophysiological and pharmacological relevance. Cardiovasc Res. 2024;119:2843-2857.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 48]  [Article Influence: 24.0]  [Reference Citation Analysis (0)]
21.  Stitziel NO. Reducing the Risk of Pancreatitis by Inhibiting APOC3. N Engl J Med. 2025;392:197-199.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 2]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
22.  Hooper AJ, Bell DA, Burnett JR. Olezarsen, a liver-directed APOC3 ASO therapy for hypertriglyceridemia. Expert Opin Pharmacother. 2024;25:1861-1866.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 10]  [Reference Citation Analysis (0)]
23.  Gugliucci A. Triglyceride-Rich Lipoprotein Metabolism: Key Regulators of Their Flux. J Clin Med. 2023;12:4399.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 37]  [Reference Citation Analysis (0)]
24.  Zewinger S, Reiser J, Jankowski V, Alansary D, Hahm E, Triem S, Klug M, Schunk SJ, Schmit D, Kramann R, Körbel C, Ampofo E, Laschke MW, Selejan SR, Paschen A, Herter T, Schuster S, Silbernagel G, Sester M, Sester U, Aßmann G, Bals R, Kostner G, Jahnen-Dechent W, Menger MD, Rohrer L, März W, Böhm M, Jankowski J, Kopf M, Latz E, Niemeyer BA, Fliser D, Laufs U, Speer T. Apolipoprotein C3 induces inflammation and organ damage by alternative inflammasome activation. Nat Immunol. 2020;21:30-41.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 117]  [Cited by in RCA: 233]  [Article Influence: 38.8]  [Reference Citation Analysis (2)]
25.  Larsson M, Allan CM, Jung RS, Heizer PJ, Beigneux AP, Young SG, Fong LG. Apolipoprotein C-III inhibits triglyceride hydrolysis by GPIHBP1-bound LPL. J Lipid Res. 2017;58:1893-1902.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 32]  [Cited by in RCA: 49]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
26.  Llop D, Rehues P, Paredes S, Guardiola M, Girona J, Rosales R, Esteban Y, Masana L, Ibarretxe D, Vallvé JC, Ribalta J. Triglyceride-independent associations between circulating levels of apolipoprotein C-III and biomarkers of inflammation. Cardiovasc Diabetol. 2025;24:9.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 2]  [Reference Citation Analysis (0)]
27.  Hsu CC, Shao B, Kanter JE, He Y, Vaisar T, Witztum JL, Snell-Bergeon J, McInnes G, Bruse S, Gottesman O, Mullick AE, Bornfeldt KE. Apolipoprotein C3 induces inflammasome activation only in its delipidated form. Nat Immunol. 2023;24:408-411.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 8]  [Cited by in RCA: 24]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade B, Grade B

Novelty: Grade A, Grade C

Creativity or innovation: Grade A, Grade B

Scientific significance: Grade B, Grade C

P-Reviewer: Wu R, Doctorate Student, China; Zheng P, MD, China S-Editor: Li L L-Editor: A P-Editor: Wang CH

Write to the Help Desk