BPG is committed to discovery and dissemination of knowledge
Case Control Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Psychiatry. Apr 19, 2025; 15(4): 102182
Published online Apr 19, 2025. doi: 10.5498/wjp.v15.i4.102182
Association and functional study of ATP6V1D and GPHN gene polymorphisms with depression in Chinese population
Peng Liang, Jing-Jie Chen, Rui Long, Yue Li, Zi-Ling Wang, Yun-Dan Liang, Department of Basic Medicine, Chengdu Medical College, Chengdu 610500, Sichuan Province, China
Xue Yang, Department of Geriatric Psychiatry, The First Psychiatric Hospital of Harbin, Harbin 150001, Heilongjiang Province, China
Ping-Liang Yang, Department of Anesthesiology, The First Affiliated Hospital of Chengdu Medical College, Chengdu 610500, Sichuan Province, China
ORCID number: Yun-Dan Liang (0000-0003-1102-895X).
Co-first authors: Peng Liang and Jing-Jie Chen.
Co-corresponding authors: Ping-Liang Yang and Yun-Dan Liang.
Author contributions: Liang P and Chen JJ performed the experiments, wrote and revise the manuscript, they contributed equally to this article, they are the co-first authors of this manuscript; Yang X, Long R, Li Y, Wang ZL helped with literature reviews, experiments and data analysis; Liang YD and Yang PL designed the study and corrected the manuscript, they contributed equally to this article, they are the co-corresponding authors of this manuscript; and all the authors read and approved the manuscript.
Supported by the Natural Science Foundation of Sichuan, China, No. 2022NSFSC0778; Research Project Foundation of Sichuan Applied Psychology Research Center, No. CSXL-24202; Foundation of Sichuan Clinical Research Center for Geriatrics, No. 24LHLNYX1-04 and No. 24LHLNYX1-06; and the Key Laboratory Foundation for Development and Regeneration of Sichuan Province, No. 24LHFYSZ1-25.
Institutional review board statement: This study was approved by the Medical Ethics Committee of Chengdu medical college, approval No. 201815.
Informed consent statement: All patients gave informed consent.
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
STROBE statement: The authors have read the STROBE Statement-checklist of items, and the manuscript was prepared and revised according to the STROBE Statement-checklist of items.
Data sharing statement: Technical appendix, statistical code, and dataset available from the corresponding author at liangyundan2004@126.com.
Corresponding author: Yun-Dan Liang, PhD, Associate Professor, Department of Basic Medicine, Chengdu Medical College, No. 783 Xindu Avenue, Chengdu 610500, Sichuan Province, China. liangyundan2004@126.com
Received: October 11, 2024
Revised: January 20, 2025
Accepted: February 18, 2025
Published online: April 19, 2025
Processing time: 165 Days and 6 Hours

Abstract
BACKGROUND

Depression is a disease with a significant global social burden. Single nucleotide polymorphisms (SNPs) are correlated with the development of depression. This study investigates the relationship between polymorphisms in the GPHN and ATP6V1D gene promoter regions and susceptibility to depression in the Chinese population.

AIM

To provide new insights into identifying SNPs for predicting depression in the Chinese population.

METHODS

We conducted a case-control study involving 555 individuals with depression and 509 healthy controls. GPHN rs8020095 and ATP6V1D rs3759755, rs10144417, rs2031564, and rs8016024 in the promoter region were genotyped using next-generation sequencing. Dual luciferase reporter genes were employed to assess the transcriptional activity of promoter regions for each SNP genotype, with transcription factors binding to each site predicted using the JASPAR database.

RESULTS

Compared to healthy controls, the ATP6V1D promoter rs10144417 AG genotype (P = 0.015), rs3759755 AC/CC genotype (P = 0.036), and GPHN gene rs8020095 GA and AA genotypes (GA: P = 0.028, GG: P = 0.025) were significantly associated with a lower prevalence of depression. Linked disequilibria were present in five SNPs, with the AGATA haplotype frequency in patients significantly lower than in healthy subjects (P = 0.023). Luciferase activity of the rs3759755-A recombinant plasmid was significantly higher than that of the rs3759755-C recombinant plasmid (P = 0.026), and the rs8020095-A recombinant plasmid activity was significantly higher than that of the rs8020095-G recombinant plasmid (P = 0.001). Transcription factors orthodenticle homeobox 2, orthodenticle homeobox 1, forkhead box L1, NK homeobox 3-1, and nuclear factor, interleukin 3 regulated demonstrated binding affinity with rs3759755A > C and rs8020095A > G.

CONCLUSION

This study demonstrates that SNPs (rs3759755 and rs10144417) in the promoter region of the ATP6V1D and SNP (rs8020095) of GPHN are indeed associated with susceptibility to depression.

Key Words: Single nucleotide polymorphism; Genetic susceptibility; Depression; ATP6V1D; GPHN

Core Tip: Single nucleotide polymorphisms in the promoter region of ATP6V1D and GPHN genes are associated with susceptibility to depression in the Chinese population. The genetic variants examined in this study may be linked to protective factors for depression. This study demonstrates that rs3759755, rs10144417 and rs8020095 show significant differences between patients with depression and control subjects in China. These findings offer new insights into identifying single nucleotide polymorphisms that could be used to predict depression in the Chinese population.



INTRODUCTION

Depression is a prevalent chronic medical condition that significantly impacts cognitive function, emotions, and physical health[1], characterized by symptoms such as low mood, low energy, sadness, insomnia, guilt or feelings of worthlessness, and an inability to enjoy life[2]. High rates of suicide and self-harm are severe consequences of depression, which affects approximately 30 million people globally, with 5%-17% of the population experiencing depression at least once in their lifetime[3]. The World Health Organization estimates that depression will become the leading cause of disability by 2030[4]. Importantly, depression has a low remission rate[5], with successful treatment in only about half of patients, and response rates decreasing with each subsequent therapy[6]. The pathogenesis of depression involves various factors, but no single pharmacological target has been identified[7]. Therefore, there is an urgent need to identify biomarkers to better understand the pathogenesis of depression and guide its diagnosis and treatment.

Single nucleotide diversity mainly refers to the DNA sequence differences at a single nucleotide level within the genome. Single nucleotide polymorphisms (SNPs) occur more frequently in the human genome than in other species and are the primary manifestation of genetic differences between individuals or populations. Some SNPs affect gene function, leading to changes in biological traits and even diseases[8]. For example, a study by Jahantigh et al[9] revealed a clear relationship between rs3212227A/C and rs6887695G/C polymorphisms in the IL-12B gene and the risk of preeclampsia in the Iranian population. Numerous studies have confirmed that SNPs occurring in non-coding regions of genes, especially promoter regions, are associated with the occurrence and development of many diseases, including depression[10-13]. For instance, genome-wide screening in Europeans revealed that rs73182688 on NLGN1 is significantly associated with suicidal behavior[10]. Additionally, rs79878474 on chr11p15 was identified as a significant SNP associated with anxiety and depression in children and adolescents[11]. Furthermore, risk factors for postpartum depressive symptoms in women with GRIN2B rs1805476 GG genotype and rs4522263 CC genotype have also been identified[12]. Moreover, the rs4291 T genotype located in the promoter region of the angiotensin-converting enzyme gene is associated with unipolar major depression[13]. These findings indicate that non-coding SNPs are associated with depression, providing an opportunity to explore novel etiologies of this condition.

The GPHN gene is located on chromosome 14 (chr14q23.3-q24.1: 66508147-67735355) and is universally expressed in the brain, kidney, liver, and other tissues[14]. This gene encodes a neuronal assembly protein, gephyrin, which anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton through high-affinity binding to receptor subunit domains and tubulin dimers[15]. Additionally, gephyrin is required for molybdenum cofactor biosynthesis in non-neuronal tissues[16]. Polymorphisms in this gene may be related to nervous system diseases[17] and can also lead to molybdenum cofactor deficiency[18]. Gephyrin has clear functional links to several synaptic proteins that have been linked to genetic risks for neurodevelopmental disorders, such as autism spectrum disorder (ASD), schizophrenia, and epilepsy. These include neuroligin (NLGN2, NLGN4), neurexins (NRXN1, NRXN2, NRXN3), and collybistin (ARHGEF9)[19]. A comprehensive analysis by Bacchelli et al[20] of rare copy number variations and exome variations in ASD concluded that the GPHN gene plays an important role in ASD susceptibility. Polymorphisms in the GPHN gene are also involved in the occurrence of sudden abnormal infantile symptoms or startle disorder. Dejanovic et al[21] found a de novo missense polymorphism in the GPHN gene in patients with epileptic encephalopathy. Furthermore, Balan et al[22] identified that the rs723432 polymorphism in the GPHN gene was significantly associated with schizophrenia in a comprehensive association analysis of 27 genes in the GABAergic system in Japanese patients. A genome-wide association study by Hek et al[23] showed that rs8020095, located in the GPHN gene, was associated with susceptibility to depression. Interestingly, a review of the gene expression sequence tag database (eQTL) found that rs8020095 could affect the expression of the ATP6V1D gene, although the specific mechanism has not yet been reported.

The ATP6V1D gene is situated within the GPHN gene (chr14q23.3: 67337872-67359804) and belongs to the ATPase subunit D, one of the 37 genes essential for cell division[24,25]. This gene primarily encodes the D subunit of vacuolar ATPase (V-ATPase), a multi-subunit enzyme. The main function of V-ATPase in eukaryotic cells is to mediate the acidification of organelles[25]. V-ATPase-dependent acidification is required for intracellular processes such as synaptic vesicle proton gradient generation, protein sorting, receptor-mediated endocytosis, and zymogen activation. The cytoplasmic V1 domain and the V0 domain across the cell membrane constitute V-ATPase. The V1 domain consists of three A, three B, two G, and one each of the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site, while the V0 domain consists of five different subunits: A, c, c’, c’’, and d. Many other isoforms of V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants[26]. The ATP6V1D gene, encoding the V1 domain D subunit protein of V-ATPase, is universally expressed in the brain, adrenal gland, and other tissues[14,27]. Substantial evidence has shown that functional changes in V-ATPase are closely related to human nervous system diseases. In the nervous system, V-ATPase provides an electrochemical potential that facilitates the secretion of vesicles to transport neurotransmitters[28]. Kim et al[29] proposed that V-ATPase of lysosomes in Alzheimer’s disease patients acts as a proteotoxic receptor, disrupting endolysosomal function by binding to pathogenic proteins, leading to neurodegeneration. ATP6AP2 mutations impair V-ATPase function and lysosome deacidification, causing neuronal lysosomal system failure and juvenile-onset Parkinson’s syndrome[30,31]. Splicing alterations and conditional knockout of the ATP6AP2 gene in mice and flies cause cognitive impairment and neurodegenerative diseases[32]. The association between V-ATPase and the onset of depression has been poorly explored. The human D-subunit is part of the central rotor of the V-ATPase, highlighting the importance of determining the location of proton pump components[25]. Therefore, investigating the association between genetic variation in the ATP6V1D promoter region and depression presents a novel direction for exploring the etiology of depression.

In summary, previous studies have shown that the GPHN and ATP6V1D genes are closely related to the occurrence and development of nervous system diseases. However, the possible association between rs8020095 in the intron region of the GPHN gene and rs3759755, rs10144417, rs2031564, and rs8016024 in the promoter region of the ATP6V1D gene with susceptibility to depression has not been reported. This study aims to investigate the association of the GPHN gene rs8020095 in the intron region and the ATP6V1D gene rs3759755, rs10144417, rs2031564, and rs8016024 in the promoter region with susceptibility to depression and their functional impact in the Chinese population using multiple molecular biological techniques.

MATERIALS AND METHODS
Ethics statement

All procedures in this study were conducted in accordance with the principles outlined in the Declaration of Helsinki. Written informed consent was obtained from each participant. Additionally, the Ethics Committee of Chengdu Medical College approved the biomedical ethics plan, approval No. 201815.

Subjects

We conducted a case-control study involving 555 patients with newly diagnosed depression and 509 healthy controls recruited from Sichuan Provincial People’s Hospital, Jining Mental Hospital, Yunnan Mental Health Center, and Harbin First Specialized Hospital from September 2018 to April 2022. All subjects were Han Chinese, and depression was diagnosed according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition or the Tenth Revision of the International Statistical Classification of Diseases and Related Health Problems. Patients and healthy controls with additional psychiatric disorders, lack of informed consent, or pregnancy were excluded. Information on family history, the presence or absence of psychiatric episodes, the degree of depression, and the presence or absence of suicidality was obtained from the patient's medical records, as described in detail in our previous study (Table 1)[33]. Frequency matching was performed between the control group and the cases using Quanto software 1.2.3 (University of Southern California, Los Angeles, CA, United States) to calculate the power of the sample size. When the RG value was set to 1.4, the heritability of the five SNPs was greater than 80% under the dominant model.

Table 1 Characteristics of the study population, n (%).
Variables
Controls (n = 509)
Case (n = 555)
P value
Age (years)50.8 ± 18.642.2 ± 17.7< 0.01
Gender
Male191 (37.5)161 (29.0)0.030
Female318 (62.5)394 (71.0)-
Age of onset (years), mean ± SD-37.3 ± 16.7-
Pulse rate, mean ± SD87.07 ± 13.479.4 ± 12.3< 0.01
Education
Elementary school82 (16.1)36 (6.5)-
Junior middle school131 (25.7)151 (27.2)-
High school154 (30.3)160 (28.8)-
Junior college and above142 (27.9)208 (37.5)-
Profession
Student76 (14.9)154 (27.7)-
Mental labor179 (35.2)194 (35.0)-
Manual labor130 (25.5)71 (12.8)-
Retired or unemployed124 (24.4)136 (24.5)-
Depressive episode
Severe0 (0)277 (49.9)-
Mild/moderate0 (0)278 (50.1)-
No509 (100)0 (0)-
Family history
Positive0 (0)97 (17.5)-
Negative509 (100)458 (82.5)-
Suicide attempt
Yes0 (0)314 (56.6)-
No509 (100)241 (43.4)-
First-episode
Yes0 (0)278 (50.1)-
No509 (100)277 (49.9)-
SNPs selection

Using the gene eQTL available at GTEx Portal and genome-wide association study data, we identified the GPHN gene SNP locus, rs8020095, which can affect ATP6V1D gene expression. SNPs located 2kb upstream of the transcription start site in the ATP6V1D promoter region were searched through the UCSC database (UCSC Genome Browser). Those with a minor allele frequency greater than 10% in the Asian population were selected, including rs3759755, rs10144417, rs2031564, and rs8016024 (Figure 1).

Figure 1
Figure 1 Schematic diagram of rs3759755, rs10144417, rs2031564, rs8020095 and rs8016024 loci, GPHN gene and ATP6V1D gene location. The two arrows in the figure represent transcription start sites for each of the two genes.
Genotyping

We collected 2-3 mL of whole blood from each participant in an EDTA anticoagulant tube and stored it at -20 °C. For DNA extraction, we used the Whole Blood Genomic DNA Rapid Extraction Kit (Shenggong Bioengineering, Shanghai, Co., LTD) to treat each peripheral blood sample separately. A primer pool containing five SNP sites was designed and synthesized (Table 2). The five target SNP sites were amplified using a two-step PCR, and an Illumina-compatible sequencing library was prepared. Sequencing was then performed using the HiSeq XTen sequencer (Illumina, San Diego, CA). Cutadapt (v1.2.1) and PRINSEQ-lite (v0.20.3) software were used to remove bases with a quality threshold below 20 from the 3’ end to the 5’ end of the sequence. The genotype results for the five SNPs were calculated using SAMtools software (version 0.1.18). Additionally, we randomly selected 5% of the samples for repeated genotyping for quality control and obtained a 100% agreement rate for each SNP.

Table 2 Primers sequences used in this study.
Description
Forward primer sequence (5’-3’)
Reverse primer sequence (5’-3’)
rs8020095CACAGATAGACAGTGAGGAATGCTACATGGATGAAGGTGTGTTTGTATGT
rs10144417CCAGAGCCGACTTCTTCAATCACAGGTCCTATGTCTTTCTCGCGCCTTGA
rs2031564GGCGGAAGAAAAGATGGAATTCTCATGTGTTCCAGAGGCATCGTTGTTCG
rs8016024
rs3759755ACAGGAAAGGTGGAACAGAAATACTTACCTACCATTTGTCATGCAAAATA
Plasmid construction and dual luciferase assay

To evaluate the promoter activity of different genotypes, plasmids of various genotypes (rs3759755A, rs3759755C, rs8020095A, rs8020095G, rs10144417A, rs10144417G) were constructed. Each mutation site was inserted into the luciferase vector pGL3-basic, and the promoter activity of the fragments was verified through cell transfection. Fine cells were seeded into 24-well plates 18 hours before transfection, which was performed when the cells reached 80% confluence. The pGL3 variant plasmid and PRL-TK plasmid (r = 10:1-20:1) were transfected using Opti-DMEM and Lipofectamine 2000 (Thermo Fisher, Waltham, MA). The medium was replaced 6 hours after transfection, and the cells were harvested and transferred to 96-well plates for a dual luciferase activity assay 48 hours later. Firefly and Renilla luciferase activity was measured using the dual luciferase reporter kit (Promega, Waltham, MA, United States) and a VICTOR Nivo Multi-Mode Plate Reader (PerkinEelmer, Waltham, MA, United States).

Recombinant plasmid DNA (500 ng) was transfected into HEK-293FT cells using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, United States) according to the manufacturer's instructions. Cells were harvested after 36 hours of culture and lysed using cell lysis buffer (Promega, Madison, WI, United States). The Renilla luciferase reporter gene (pRL-TK, 50 ng, Promega) plasmid was co-transfected along with the recombinant plasmid as an internal control. Luciferase activity was measured using a VICTOR Nivo Multi-Mode Plate Reader (PerkinEelmer, Waltham, MA, United States) after treatment with the dual luciferase reporter kit (Promega, Madison, WI, United States). Relative gene expression activity was reported as the ratio of firefly luciferase to Renilla luciferase, with the pGL3-basic vector used as a negative control. Three independent replicates were performed for each experiment.

Bioinformatics analysis

The JASPAR online software (JASPAR, accessed July 14, 2023) was used to predict possible transcription factor binding sites for the rs3759755A > C and rs8020095A > G polymorphism loci.

Statistical analysis

All statistical analyses were performed using SPSS 25.0 (IBM, SPSS Inc., Chicago, IL, United States) and GraphPad Prism 5.0 (GraphPad Software, Boston, MA, United States). The genotype frequencies of rs3759755, rs10144417, rs2031564, rs8020095, and rs8016024 were determined by observation and counting. Hardy-Weinberg equilibrium was tested in duplicate. The distribution of rs3759755, rs10144417, rs2031564, rs8020095, and rs8016024 genotypes in cases and controls was analyzed using the χ2 test. Odds ratios (OR) and 95% confidence intervals (CI) were used to evaluate the association between the polymorphisms and the risk of depression. Differences in relative fluorescence were assessed by independent sample t-tests, with P values < 0.05 considered statistically significant.

RESULTS

The genotype frequencies of the four polymorphisms in patients with depression are shown in Table 3. The distribution of genotypes in the control group did not deviate from Hardy-Weinberg equilibrium (rs3759755: P = 0.06; rs10144417: P = 0.08; rs2031564: P = 0.45; rs8020095: P = 0.08; rs8016024: P = 0.62). There was a significant difference in the distribution of the rs10144417 AG genotype between patients with depression and healthy controls (OR = 0.71; 95%CI: 0.53-0.94; P = 0.015). The GA and AA genotypes of rs8020095 were significantly different between depression patients and controls (GA: OR = 0.72, 95%CI: 0.53-0.97, P = 0.028; AA: OR = 0.70, 95%CI: 0.53-0.93, P = 0.025). In the dominant model, the frequency of rs10144417 (OR = 0.73, 95%CI: 0.56-0.95, P = 0.021), the frequency of rs3759755(OR = 0.75, 95%CI: 0.58-0.98, P = 0.036) and the frequency of rs8020095(OR = 0.70, 95%CI: 0.53-0.93, P = 0.013) was significantly different between depression patients and controls. There was no significant difference in rs2031564 and rs8016024 between the depression and control groups.

Table 3 Association of the rs3759755, rs10144417, rs2031564, rs8020095 and rs8016024 polymorphisms with depression risk, n (%).
Models
Polymorphisms
Controls (n = 509)
Patients (n = 555)
Adjusted OR (95%CI)1
P value
rs10144417
CodominantA/A151 (29.7)195 (35.1)1.00-
A/G270 (53.0)260 (46.9)0.71 (0.53-0.94)0.015
G/G88 (17.3)100 (18.0)0.81 (0.56-1.18)0.270
DominantA/A151 (29.7)195 (35.1)1.00-
A/G-G/G358 (70.3)360 (64.9)0.73 (0.56-0.95)0.021
RecessiveA/A-A/G421 (82.7)455 (82.0)1.00-
G/G109 (17.3)100 (18.0)1.01 (0.73-1.40)0.940
AlleleA572 (56.2)650 (58.6)1.00-
G446 (43.8)460 (41.4)0.87 (0.73-1.04)0.130
rs2031564
CodominantG/G126 (24.8)148 (26.7)1.00-
G/A263 (51.7)270 (48.6)0.82 (0.61-1.11)0.200
A/A120 (23.6)137 (24.7)1.15 (0.80-1.64)0.450
DominantG/G126 (24.8)148 (26.7)1.00-
G/A-G/G383 (75.2)407 (73.3)0.84 (0.63-1.12)0.230
AlleleA572 (56.0)650 (59.0)1.00-
G446 (44.0)460 (41.0)1.06 (0.89-1.27)0.510
rs3759755
CodominantA/A155 (30.5)196 (35.3)1.00-
A/C270 (53.0)259 (46.7)0.71 (0.54-0.95)0.081
C/C84 (16.5)100 (18.0)0.88 (0.60-1.27)0.490
DominantA/A155 (30.5)196 (35.3)1.00-
A/C-C/C354 (69.5)359 (64.7)0.75 (0.58-0.98)0.036
RecessiveA/A-A/C425 (83.5)455 (82.0)1.00-
C/C84 (16.5)100 (18.0)1.08 (0.78-1.50)0.650
AlleleA580 (57.0)651 (58.6)1.00-
C438 (43.0)459 (41.4)0.90 (0.75-1.07)0.240
rs8016024
CodominantT/T131 (25.7)158 (28.5)1.00-
T/C260 (51.1)264 (47.6)0.79 (0.58-1.06)0.110
C/C118 (23.2)133 (24.0)0.83 (0.58-1.19)0.310
DominantT/T131 (25.7)158 (28.5)1.00-
T/C-C/C378 (74.3)397 (71.5)0.80 (0.61-1.06)0.120
AlleleT522 (51.0)580 (52.0)1.00-
C496 (49.0)530 (48.0)0.91 (0.77-1.09)0.320
rs8020095
CodominantG/G125 (24.6)164 (29.5)1.00-
G/A274 (53.8)285 (51.4)0.72 (0.53-0.97)0.028
A/A110 (21.6)106 (19.1)0.66 (0.45-0.95)0.025
DominantG/G125 (24.6)164 (29.5)1.00-
G/A-A/A384 (75.4)391 (70.5)0.70 (0.53-0.93)0.013
RecessiveG/G-G/A399 (78.4)449 (80.9)1.00-
A/A110 (21.6)106 (19.1)0.82 (0.60-1.12)0.210
AlleleA494 (48.5)497 (44.8)1.00-
G524 (51.5)613 (55.2)1.23 (1.03-1.46)0.023

We then considered the relationship between several variables and polymorphisms. No significant association was found among rs3759755, rs10144417, rs2031564, rs8020095, and rs8016024 polymorphisms and depressive episodes (severe or mild/moderate), presence of a suicide attempt, first-episode, and family history (P > 0.05 for all variables considered) (Table 4). The rs10144417, rs2031564, rs3759755, rs8016024, and rs8020095 polymorphisms were analyzed by multifactor dimensionality reduction and cross-validation by interaction software. The interaction between rs10144417, rs2031564, rs3759755, rs8016024, and rs8020095 was not significant (P > 0.05) (Supplementary material).

Table 4 Stratified analyses of the rs3759755, rs10144417, rs2031564, rs8020095 and rs8016024 polymorphisms with depression risk, n (%).
Variables
Frequency
OR (95%CI)1
P value
rs8020095
Depressive episodeSevereMild--
G/G81 (29.1)83 (30.0)1.00 (Ref)-
G/A-A/A197 (70.9)194 (70.0)0.89 (0.61-1.29)0.54
Suicide attemptYesNo--
G/G81 (25.7)83 (34.6)1.00 (Ref)-
G/A-A/A234 (74.3)15 (65.4)0.73 (0.50-1.07)0.11
First-episode patientYesNo--
G/G80 (28.6)84 (30.7)1.00 (Ref)-
G/A-A/A200 (71.4)190 (69.3)1.00 (0.69-1.46)1.00
Family historyYesNo--
G/G28 (27.7)136 (30.0)1.00 (Ref)-
G/A-A/A73 (72.3)318 (70.0)0.95 (0.58-1.54)0.82
rs10144417
Depressive episodeSevereMild--
A/A97 (34.9)98 (35.4)1.00 (Ref)-
A/G-G/G181 (65.1)179 (64.6)0.94 (0.66-1.34)0.75
Suicide attemptYesNo--
A/A104 (33.0)91 (37.9)1.00 (Ref)-
A/G-G/G211 (67.0)149 (62.1)0.85 (0.59-1.23)0.39
First-episode patientYesNo--
A/A99 (35.4)96 (34.9)1.00 (Ref)-
A/G-G/G181 (64.6)179 (65.1)1.08 (0.75-1.54)0.67
Family historyYesNo--
A/A32 (31.7)163 (35.9)1.00 (Ref)-
A/G-G/G69 (68.3)291 (64.1)0.85 (0.54-1.36)0.50

The polymorphic loci of rs10144417, rs2031564, rs3759755, rs8016024, and rs8020095 were haplotype analyzed (D’> 0.8). Linkage disequilibrium was found at five sites (rs10144417, rs2031564, rs3759755, rs8016024, and rs8020095) (Figure 2), and the frequency of the AGATA haplotypes in patients was significantly lower than in healthy subjects (AGATA vs AGATG: OR = 0.569, 95%CI: 0.348-0.930, P = 0.023) (Table 5). No significant correlation was found for other haplotypes.

Figure 2
Figure 2 Linkage disequilibrium analysis of five single nucleotide polymorphisms loci.
Table 5 Haplotype analysis of the rs10144417, rs2031564, rs3759755, rs8016024 and rs8020095 with the depression, n (%).
Haplotype
Patients
Control
OR (95%CI)P value (dimensionless)
2n = 1110 (%)
2n = 1018 (%)
AGATG536 (48.3)468 (46.0)1.000-
GACCA437 (39.4)421 (41.4)0.906 (0.755-1.008)0.291
AAACG52 (4.7)33 (3.2)1.376 (0.874-2.165)0.166
AGATA28 (2.5)43 (4.2)0.569 (0.348-0.930)0.023

To further investigate the influence of SNPs on gene transcriptional regulation, dual-luciferase assays were used to detect the transcriptional activity of the promoter regions of different genotypes (rs3759755, rs10144417, and rs8020095). The transcriptional activity of the promoter region of the AA genotype plasmid in rs8020095 was significantly higher than that of the GG genotype plasmid (P = 0.026) (Figure 3A). In the study of the transcriptional activity of the rs3759755 promoter region, plasmids of the AA and CC genotypes showed higher activity (P = 0.001) (Figure 3B). There was no significant difference in promoter activity between the two genotypes of rs10144417 (P > 0.05).

Figure 3
Figure 3 Effect of polymorphisms on rs8020095 and rs3759755 promoter activity. A: The transcriptional activities of different haplotypes in the rs8020095 promoter region; B: Transcriptional activity of rs3759755 promoter with different haplotypes. aP < 0.05; bP < 0.01. Data are presented as mean ± SD.

The online software package JASPAR (JASPAR, accessed July 14, 2023) was used to predict potential transcription factor binding sites in promoter sequences for the rs3759755A > C and rs8020095A > G polymorphism loci. When rs3759755 was C, no transcription factor was predicted to bind to it. However, when this site was A, the transcription factors orthodenticle homeobox 1 and orthodenticle homeobox 2 were predicted to bind. For rs8020095A > G, when the site was G, the transcription factor forkhead box L1 was predicted to bind. When the site was A, forkhead box L1, NK homeobox 3-1, and nuclear factor, interleukin 3 regulated were predicted to bind. Both genes had potential mutations that resulted in increased transcription factor binding (Supplementary material).

DISCUSSION

This is the first study to explore the association between ATP6V1D promoter region gene polymorphisms and depression. The study provides evidence supporting this association and performs a confirmatory analysis of the relationship between GPHN rs8020095 and depression. Of the four SNPs considered in the ATP6V1D promoter region, two (rs3759755 and rs10144417) and one SNP in GPHN (rs8020095) were statistically associated with depression in a Chinese Han population. The ATP6V1D promoter region rs203156 and rs8016024 polymorphisms were not associated with depression. Linkage disequilibrium was observed among the five SNPs, with the frequency of the AGATA haplotype in patients significantly lower than in healthy individuals. Luciferase activity of the rs3759755-A recombinant plasmid was significantly higher than that of the rs3759755-C recombinant plasmid, and luciferase activity of the rs8020095-A recombinant plasmid was significantly higher than that of the rs8020095-G recombinant plasmid, indicating that these two polymorphisms may affect transcription factor binding.

Depression is estimated to affect 5% of adults worldwide and ranks second among the top 25 leading causes of disability for youth[34,35]. Between 1990 and 2019, the number of people affected by mental disorders worldwide increased from 80 million to 112.5 million, creating an extremely high societal burden[36]. Identifying and diagnosing depression as early as possible is critically important from a clinical perspective and can be lifesaving. As one of the most common types of genetic variation, SNPs have attracted much attention[37,38]. A genome-wide association analysis of depressive symptoms from 17 population-based European ancestry studies (n = 34549) identified rs8020095, an intron region of GPHN on chromosome 14, as having the lowest P value among the seven tested SNPs[23]. Furthermore, eQTL showed that rs8020095 affects the expression of the ATP6V1D gene. We verified this result and found that the distribution of rs8020095 GA and AA genotypes was significantly different between MDD patients and controls. The promoter activity of rs8020095-A was significantly higher than that of rs8020095-G, and there was strong linkage disequilibrium between rs8020095 and the other four SNPs in the promoter region of ATP6V1D. These data provide novel potential molecular markers for depression.

In genetics, a promoter is a DNA sequence that enables the transcription of a specific RNA transcript. The structure of the promoter affects its binding affinity with RNA polymerase, thus influencing transcription levels, gene expression, and differential gene function[39]. Numerous studies have shown that genetic variation in non-coding regions, in addition to coding regions, can also affect gene function[40]. SNPs in the promoter regions of mammalian genes are central to in vitro transcriptional regulation mechanisms[41,42]. For instance, rs12072037 modulates MFSD2A promoter activity to affect MFSD2A levels in normal lung and lung tumors[43], and the AIRE-655G/AIRE-230T haplotype can significantly alter AIRE transcription, thereby affecting susceptibility to autoimmune diseases[44]. The results of the current study show that the rs3759755CC genotype in the promoter region of the ATP6V1D gene has a lower frequency in patients with depression than in healthy controls. Additionally, the rs3759755A genotype has higher transcriptional activity than the C genotype and changes the binding affinity of transcription factors. These results suggest that rs3759755 may represent a protective factor for susceptibility to depression.

Transcriptional regulation affects cell function by altering gene expression[45]. Transcription factors are protein molecules that bind specifically to sequences upstream of the 5’ end of a gene, ensuring that the target gene is expressed at the correct time and location[46]. Binding of transcription factors to specific DNA sites can affect gene expression at the transcriptional level[47]. Therefore, transcription factors play important roles in gene expression and cell function in eukaryotes. To investigate the association between GPHN and ATP6V1D gene promoter polymorphisms and depression in a Chinese population, we examined predicted transcription factor binding sites and found that rs3759755A > C produced new transcription factors orthodenticle homeobox and GSC. Novel transcription factors NK homeobox and nuclear factor, interleukin were found in rs8020095A > G. This information motivated further exploration of the mechanism mediating the relationship between these polymorphisms and depression.

This study has certain limitations. First, we collected whole peripheral blood for DNA extraction, ignoring the influence of other complex components in the blood on our results. Second, because rs8020095 is not in the promoter region of the ATP6V1D gene, we chose the PGL3 plasmid vector, which resulted in low firefly luciferase expression while the reference plasmid expressed high Renilla luciferase. Third, the sample for this study comes from central and southern China, and regional differences along with a relatively small sample size may reduce the main effect size and the observational power of symptoms, necessitating an expanded sample for further research. Finally, while we predicted transcription factors, we did not follow up with mechanistic exploration. We aim to address these limitations in future work.

CONCLUSION

Previous studies on the ATP6V1D gene mainly focused on the mechanisms mediating the development of pancreatitis[48], nephritis[49], Alzheimer’s disease[50], and other diseases. Relatively few studies have been published on depression, especially regarding the non-coding region of the gene. This study demonstrated for the first time that SNPs in the promoter region of the ATP6V1D gene are indeed associated with susceptibility to depression. Our data provide new insights into identifying candidate genes for depression in the Chinese population.

ACKNOWLEDGEMENTS

We sincerely thank the patients, their families, the healthy volunteers, and the medical staff involved in specimen collection for their participation and support.

References
1.  Smith K. Mental health: a world of depression. Nature. 2014;515:181.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 949]  [Cited by in RCA: 820]  [Article Influence: 68.3]  [Reference Citation Analysis (0)]
2.  Malhi GS, Mann JJ. Depression. Lancet. 2018;392:2299-2312.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3532]  [Cited by in RCA: 3105]  [Article Influence: 388.1]  [Reference Citation Analysis (0)]
3.  Bains N, Abdijadid S, Miller JL.   Major Depressive Disorder (Nursing). 2023 Apr 10. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2025 Jan-.  [PubMed]  [DOI]
4.  World Health Organization‎  Global burden of mental disorders and the need for a comprehensive, coordinated response from health and social sectors at the country level: report by the Secretariat. Mar 16, 2021. [cited 11 November 2024]. Available from: https://iris.who.int/handle/10665/78898.  [PubMed]  [DOI]
5.  Roca M, García-Toro M, García-Campayo J, Vives M, Armengol S, García-García M, Asensio D, Gili M. Clinical differences between early and late remission in depressive patients. J Affect Disord. 2011;134:235-241.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 22]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
6.  Kverno KS, Mangano E. Treatment-Resistant Depression: Approaches to Treatment. J Psychosoc Nurs Ment Health Serv. 2021;59:7-11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 73]  [Article Influence: 14.6]  [Reference Citation Analysis (0)]
7.  Ménard C, Hodes GE, Russo SJ. Pathogenesis of depression: Insights from human and rodent studies. Neuroscience. 2016;321:138-162.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 509]  [Cited by in RCA: 444]  [Article Influence: 44.4]  [Reference Citation Analysis (0)]
8.  Shastry BS. SNPs: impact on gene function and phenotype. Methods Mol Biol. 2009;578:3-22.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 288]  [Cited by in RCA: 387]  [Article Influence: 22.8]  [Reference Citation Analysis (0)]
9.  Jahantigh D, Ghazaey Zidanloo S, Moossavi SZ, Forghani F. Interleukin 12B rs3212227 and rs6887695 single nucleotide polymorphisms are associated with the susceptibility to preeclampsia: Genetic, haplotype and bioinformatics analysis. Cytokine. 2023;164:156166.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
10.  Li QS, Shabalin AA, DiBlasi E, Gopal S, Canuso CM; FinnGen, International Suicide Genetics Consortium, Palotie A, Drevets WC, Docherty AR, Coon H. Genome-wide association study meta-analysis of suicide death and suicidal behavior. Mol Psychiatry. 2023;28:891-900.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 62]  [Cited by in RCA: 58]  [Article Influence: 19.3]  [Reference Citation Analysis (0)]
11.  Thapaliya B, Ray B, Farahdel B, Suresh P, Sapkota R, Holla B, Mahadevan J, Chen J, Vaidya N, Perrone-Bizzozero NI, Benegal V, Schumann G, Calhoun VD, Liu J. Cross-continental environmental and genome-wide association study on children and adolescent anxiety and depression. Front Psychiatry. 2024;15:1384298.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 9]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
12.  Ping A, Yang M, Xu S, Li Q, Feng Y, Gao K, Wang S, Duan K. Correlations between GRIN2B and GRIN3A gene polymorphisms and postpartum depressive symptoms in Chinese parturients undergoing cesarean section: A prospective cohort study. J Psychosom Res. 2023;168:111210.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
13.  Baghai TC, Binder EB, Schule C, Salyakina D, Eser D, Lucae S, Zwanzger P, Haberger C, Zill P, Ising M, Deiml T, Uhr M, Illig T, Wichmann HE, Modell S, Nothdurfter C, Holsboer F, Müller-Myhsok B, Möller HJ, Rupprecht R, Bondy B. Polymorphisms in the angiotensin-converting enzyme gene are associated with unipolar depression, ACE activity and hypercortisolism. Mol Psychiatry. 2006;11:1003-1015.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 110]  [Cited by in RCA: 102]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
14.  Fagerberg L, Hallström BM, Oksvold P, Kampf C, Djureinovic D, Odeberg J, Habuka M, Tahmasebpoor S, Danielsson A, Edlund K, Asplund A, Sjöstedt E, Lundberg E, Szigyarto CA, Skogs M, Takanen JO, Berling H, Tegel H, Mulder J, Nilsson P, Schwenk JM, Lindskog C, Danielsson F, Mardinoglu A, Sivertsson A, von Feilitzen K, Forsberg M, Zwahlen M, Olsson I, Navani S, Huss M, Nielsen J, Ponten F, Uhlén M. Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Mol Cell Proteomics. 2014;13:397-406.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3264]  [Cited by in RCA: 2933]  [Article Influence: 244.4]  [Reference Citation Analysis (2)]
15.  Prior P, Schmitt B, Grenningloh G, Pribilla I, Multhaup G, Beyreuther K, Maulet Y, Werner P, Langosch D, Kirsch J. Primary structure and alternative splice variants of gephyrin, a putative glycine receptor-tubulin linker protein. Neuron. 1992;8:1161-1170.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 239]  [Cited by in RCA: 248]  [Article Influence: 7.3]  [Reference Citation Analysis (0)]
16.  Nawrotzki R, Islinger M, Vogel I, Völkl A, Kirsch J. Expression and subcellular distribution of gephyrin in non-neuronal tissues and cells. Histochem Cell Biol. 2012;137:471-482.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 21]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
17.  Lionel AC, Vaags AK, Sato D, Gazzellone MJ, Mitchell EB, Chen HY, Costain G, Walker S, Egger G, Thiruvahindrapuram B, Merico D, Prasad A, Anagnostou E, Fombonne E, Zwaigenbaum L, Roberts W, Szatmari P, Fernandez BA, Georgieva L, Brzustowicz LM, Roetzer K, Kaschnitz W, Vincent JB, Windpassinger C, Marshall CR, Trifiletti RR, Kirmani S, Kirov G, Petek E, Hodge JC, Bassett AS, Scherer SW. Rare exonic deletions implicate the synaptic organizer Gephyrin (GPHN) in risk for autism, schizophrenia and seizures. Hum Mol Genet. 2013;22:2055-2066.  [PubMed]  [DOI]  [Full Text]
18.  Reiss J, Gross-Hardt S, Christensen E, Schmidt P, Mendel RR, Schwarz G. A mutation in the gene for the neurotransmitter receptor-clustering protein gephyrin causes a novel form of molybdenum cofactor deficiency. Am J Hum Genet. 2001;68:208-213.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 84]  [Cited by in RCA: 71]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
19.  Chen J, Yu S, Fu Y, Li X. Synaptic proteins and receptors defects in autism spectrum disorders. Front Cell Neurosci. 2014;8:276.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 82]  [Cited by in RCA: 125]  [Article Influence: 10.4]  [Reference Citation Analysis (2)]
20.  Bacchelli E, Cameli C, Viggiano M, Igliozzi R, Mancini A, Tancredi R, Battaglia A, Maestrini E. An integrated analysis of rare CNV and exome variation in Autism Spectrum Disorder using the Infinium PsychArray. Sci Rep. 2020;10:3198.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 21]  [Cited by in RCA: 53]  [Article Influence: 8.8]  [Reference Citation Analysis (0)]
21.  Dejanovic B, Djémié T, Grünewald N, Suls A, Kress V, Hetsch F, Craiu D, Zemel M, Gormley P, Lal D; EuroEPINOMICS Dravet working group, Myers CT, Mefford HC, Palotie A, Helbig I, Meier JC, De Jonghe P, Weckhuysen S, Schwarz G. Simultaneous impairment of neuronal and metabolic function of mutated gephyrin in a patient with epileptic encephalopathy. EMBO Mol Med. 2015;7:1580-1594.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 26]  [Cited by in RCA: 37]  [Article Influence: 3.7]  [Reference Citation Analysis (0)]
22.  Balan S, Yamada K, Iwayama Y, Hashimoto T, Toyota T, Shimamoto C, Maekawa M, Takagai S, Wakuda T, Kameno Y, Kurita D, Yamada K, Kikuchi M, Hashimoto T, Kanahara N, Yoshikawa T. Comprehensive association analysis of 27 genes from the GABAergic system in Japanese individuals affected with schizophrenia. Schizophr Res. 2017;185:33-40.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 11]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
23.  Hek K, Demirkan A, Lahti J, Terracciano A, Teumer A, Cornelis MC, Amin N, Bakshis E, Baumert J, Ding J, Liu Y, Marciante K, Meirelles O, Nalls MA, Sun YV, Vogelzangs N, Yu L, Bandinelli S, Benjamin EJ, Bennett DA, Boomsma D, Cannas A, Coker LH, de Geus E, De Jager PL, Diez-Roux AV, Purcell S, Hu FB, Rimma EB, Hunter DJ, Jensen MK, Curhan G, Rice K, Penman AD, Rotter JI, Sotoodehnia N, Emeny R, Eriksson JG, Evans DA, Ferrucci L, Fornage M, Gudnason V, Hofman A, Illig T, Kardia S, Kelly-Hayes M, Koenen K, Kraft P, Kuningas M, Massaro JM, Melzer D, Mulas A, Mulder CL, Murray A, Oostra BA, Palotie A, Penninx B, Petersmann A, Pilling LC, Psaty B, Rawal R, Reiman EM, Schulz A, Shulman JM, Singleton AB, Smith AV, Sutin AR, Uitterlinden AG, Völzke H, Widen E, Yaffe K, Zonderman AB, Cucca F, Harris T, Ladwig KH, Llewellyn DJ, Räikkönen K, Tanaka T, van Duijn CM, Grabe HJ, Launer LJ, Lunetta KL, Mosley TH Jr, Newman AB, Tiemeier H, Murabito J. A genome-wide association study of depressive symptoms. Biol Psychiatry. 2013;73:667-678.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 142]  [Cited by in RCA: 130]  [Article Influence: 10.0]  [Reference Citation Analysis (0)]
24.  Kittler R, Putz G, Pelletier L, Poser I, Heninger AK, Drechsel D, Fischer S, Konstantinova I, Habermann B, Grabner H, Yaspo ML, Himmelbauer H, Korn B, Neugebauer K, Pisabarro MT, Buchholz F. An endoribonuclease-prepared siRNA screen in human cells identifies genes essential for cell division. Nature. 2004;432:1036-1040.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 308]  [Cited by in RCA: 318]  [Article Influence: 15.1]  [Reference Citation Analysis (0)]
25.  Smith AN, Francis RW, Sorrell SL, Karet FE. The d subunit plays a central role in human vacuolar H(+)-ATPases. J Bioenerg Biomembr. 2008;40:371-380.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 9]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
26.  Vasanthakumar T, Rubinstein JL. Structure and Roles of V-type ATPases. Trends Biochem Sci. 2020;45:295-307.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 65]  [Cited by in RCA: 172]  [Article Influence: 28.7]  [Reference Citation Analysis (0)]
27.  Hu RM, Han ZG, Song HD, Peng YD, Huang QH, Ren SX, Gu YJ, Huang CH, Li YB, Jiang CL, Fu G, Zhang QH, Gu BW, Dai M, Mao YF, Gao GF, Rong R, Ye M, Zhou J, Xu SH, Gu J, Shi JX, Jin WR, Zhang CK, Wu TM, Huang GY, Chen Z, Chen MD, Chen JL. Gene expression profiling in the human hypothalamus-pituitary-adrenal axis and full-length cDNA cloning. Proc Natl Acad Sci U S A. 2000;97:9543-9548.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 72]  [Cited by in RCA: 89]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
28.  Vavassori S, Mayer A. A new life for an old pump: V-ATPase and neurotransmitter release. J Cell Biol. 2014;205:7-9.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 15]  [Cited by in RCA: 17]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
29.  Kim SH, Cho YS, Kim Y, Park J, Yoo SM, Gwak J, Kim Y, Gwon Y, Kam TI, Jung YK. Endolysosomal impairment by binding of amyloid beta or MAPT/Tau to V-ATPase and rescue via the HYAL-CD44 axis in Alzheimer disease. Autophagy. 2023;19:2318-2337.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 51]  [Article Influence: 17.0]  [Reference Citation Analysis (0)]
30.  Rujano MA, Cannata Serio M, Panasyuk G, Péanne R, Reunert J, Rymen D, Hauser V, Park JH, Freisinger P, Souche E, Guida MC, Maier EM, Wada Y, Jäger S, Krogan NJ, Kretz O, Nobre S, Garcia P, Quelhas D, Bird TD, Raskind WH, Schwake M, Duvet S, Foulquier F, Matthijs G, Marquardt T, Simons M. Mutations in the X-linked ATP6AP2 cause a glycosylation disorder with autophagic defects. J Exp Med. 2017;214:3707-3729.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 49]  [Cited by in RCA: 74]  [Article Influence: 8.2]  [Reference Citation Analysis (0)]
31.  Kinouchi K, Ichihara A, Itoh H. Functional characterization of (pro)renin receptor in association with V-ATPase. Front Biosci (Landmark Ed). 2011;16:3216-3223.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 19]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
32.  Dubos A, Castells-Nobau A, Meziane H, Oortveld MA, Houbaert X, Iacono G, Martin C, Mittelhaeuser C, Lalanne V, Kramer JM, Bhukel A, Quentin C, Slabbert J, Verstreken P, Sigrist SJ, Messaddeq N, Birling MC, Selloum M, Stunnenberg HG, Humeau Y, Schenck A, Herault Y. Conditional depletion of intellectual disability and Parkinsonism candidate gene ATP6AP2 in fly and mouse induces cognitive impairment and neurodegeneration. Hum Mol Genet. 2015;24:6736-6755.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 38]  [Cited by in RCA: 62]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
33.  Liang P, Sun Y, Li Y, Liang Y. Association Between Single Nucleotide Polymorphisms Within lncRNA NONHSAT102891 and Depression Susceptibility in a Chinese Population. Neuropsychiatr Dis Treat. 2023;19:293-302.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 3]  [Reference Citation Analysis (0)]
34.  Woody CA, Ferrari AJ, Siskind DJ, Whiteford HA, Harris MG. A systematic review and meta-regression of the prevalence and incidence of perinatal depression. J Affect Disord. 2017;219:86-92.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 610]  [Cited by in RCA: 1048]  [Article Influence: 116.4]  [Reference Citation Analysis (0)]
35.  GBD 2019 Risk Factors Collaborators. Global burden of 87 risk factors in 204 countries and territories, 1990-2019: a systematic analysis for the Global Burden of Disease Study 2019. Lancet. 2020;396:1223-1249.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7538]  [Cited by in RCA: 6279]  [Article Influence: 1046.5]  [Reference Citation Analysis (30)]
36.  GBD 2019 Mental Disorders Collaborators. Global, regional, and national burden of 12 mental disorders in 204 countries and territories, 1990-2019: a systematic analysis for the Global Burden of Disease Study 2019. Lancet Psychiatry. 2022;9:137-150.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5012]  [Cited by in RCA: 4143]  [Article Influence: 1035.8]  [Reference Citation Analysis (1)]
37.  Strom NI, Smit DJA, Silzer T, Iyegbe C, Burton CL, Pool R, Lemire M, Crowley JJ, Hottenga JJ, Ivanov VZ, Larsson H, Lichtenstein P, Magnusson P, Rück C, Schachar RJ, Wu HM, Meier SM, Crosbie J, Arnold PD, Mattheisen M, Boomsma DI, Mataix-Cols D, Cath D. Meta-analysis of genome-wide association studies of hoarding symptoms in 27,537 individuals. Transl Psychiatry. 2022;12:479.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 9]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
38.  Zhang T, Ji L, Luo J, Wang W, Tian X, Duan H, Xu C, Zhang D. A genetic correlation and bivariate genome-wide association study of grip strength and depression. PLoS One. 2022;17:e0278392.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 7]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
39.  Haberle V, Stark A. Eukaryotic core promoters and the functional basis of transcription initiation. Nat Rev Mol Cell Biol. 2018;19:621-637.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 462]  [Cited by in RCA: 522]  [Article Influence: 65.3]  [Reference Citation Analysis (0)]
40.  Spurna Z, Capkova P, Srovnal J, Duchoslavova J, Punova L, Aleksijevic D, Vrtel R. Clinical impact of variants in non-coding regions of SHOX - Current knowledge. Gene. 2022;818:146238.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 8]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
41.  Chen DP, Wen YH, Wang WT, Lin WT. Exploring the Bio-Functional Effect of Single Nucleotide Polymorphisms in the Promoter Region of the TNFSF4, CD28, and PDCD1 Genes. J Clin Med. 2023;12:2157.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 6]  [Reference Citation Analysis (0)]
42.  Zhang J, Zhou T. Promoter-mediated transcriptional dynamics. Biophys J. 2014;106:479-488.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 54]  [Cited by in RCA: 62]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
43.  Colombo F, Falvella FS, Galvan A, Frullanti E, Kunitoh H, Ushijima T, Dragani TA. A 5'-region polymorphism modulates promoter activity of the tumor suppressor gene MFSD2A. Mol Cancer. 2011;10:81.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 8]  [Cited by in RCA: 12]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
44.  Lovewell TR, McDonagh AJ, Messenger AG, Azzouz M, Tazi-Ahnini R. The AIRE -230Y Polymorphism Affects AIRE Transcriptional Activity: Potential Influence on AIRE Function in the Thymus. PLoS One. 2015;10:e0127476.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11]  [Cited by in RCA: 15]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
45.  Panigrahi AK, Lonard DM, O'Malley BW. Enhancer-promoter entanglement explains their transcriptional interdependence. Proc Natl Acad Sci U S A. 2023;120:e2216436120.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 6]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
46.  Lambert SA, Jolma A, Campitelli LF, Das PK, Yin Y, Albu M, Chen X, Taipale J, Hughes TR, Weirauch MT. The Human Transcription Factors. Cell. 2018;172:650-665.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2946]  [Cited by in RCA: 2314]  [Article Influence: 289.3]  [Reference Citation Analysis (6)]
47.  Hernandez-Garcia CM, Finer JJ. Identification and validation of promoters and cis-acting regulatory elements. Plant Sci. 2014;217-218:109-119.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 334]  [Cited by in RCA: 404]  [Article Influence: 33.7]  [Reference Citation Analysis (0)]
48.  Wang S, Ni HM, Chao X, Wang H, Bridges B, Kumer S, Schmitt T, Mareninova O, Gukovskaya A, De Lisle RC, Ballabio A, Pacher P, Ding WX. Impaired TFEB-mediated lysosomal biogenesis promotes the development of pancreatitis in mice and is associated with human pancreatitis. Autophagy. 2019;15:1954-1969.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 96]  [Cited by in RCA: 103]  [Article Influence: 14.7]  [Reference Citation Analysis (1)]
49.  Li X, Li H, Yang C, Liu L, Deng S, Li M. Comprehensive Analysis of ATP6V1s Family Members in Renal Clear Cell Carcinoma With Prognostic Values. Front Oncol. 2020;10:567970.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 14]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
50.  Duan K, Ma Y, Tan J, Miao Y, Zhang Q. Identification of genetic molecular markers and immune infiltration characteristics of Alzheimer's disease through weighted gene co-expression network analysis. Front Neurol. 2022;13:947781.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 11]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Psychiatry

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade A

Novelty: Grade B

Creativity or Innovation: Grade A

Scientific Significance: Grade A

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Malik S S-Editor: Bai Y L-Editor: A P-Editor: Yu HG

Write to the Help Desk