Correlations of the expression of AKAP95, Cx43, CPSF5/6, SCFFBXL2 and SCFFBXO31 in lung cancer tissues

Abstract

BACKGROUND

Previous studies suggest that AKAP95 and Cx43 regulate D- and E-type cyclins, but the pathways underlying cyclin degradation remain unclear. The E3 ligases SCF^FBXO31 and SCF^FBXL2 mediate the degradation of cyclin D1 and cyclin D2/3, respectively, whereas CPSF5 and CPSF6 regulate post-transcriptional gene expression.

AIM

To investigate the relationships among AKAP95, Cx43, SCF^FBXO31, SCF^FBXL2, CPSF5, and CPSF6 in lung cancer.

METHODS

Protein expression was evaluated by immunohistochemistry in 40 lung cancer tissue samples, and correlations among the six proteins were analyzed. RNA sequencing was used to assess transcript levels in AKAP95-overexpressing A549 cells. Western blotting and densitometric analysis were performed to examine SCF^FBXO31 and SCF^FBXL2 expression in A549 cells with AKAP95 or Cx43 overexpression or knockdown.

RESULTS

In lung cancer tissues, AKAP95 expression was negatively correlated with SCF^FBXO31 and positively correlated with CPSF5, whereas Cx43 expression was positively correlated with SCF^FBXO31. No significant correlations were observed between AKAP95 and SCF^FBXL2 or CPSF6, or between Cx43 and SCF^FBXL2, CPSF5, or CPSF6. In AKAP95-overexpressing A549 cells, the mRNA levels of Cx43, SCF^FBXL2, and SCF^FBXO31 increased, whereas those of CPSF5 and CPSF6 decreased. At the protein level, SCF^FBXL2 was reduced in AKAP95-overexpressing cells, while SCF^FBXO31 was reduced by AKAP95 overexpression or Cx43 knockdown and increased by Cx43 overexpression or AKAP95 knockdown.

CONCLUSION

Clinical tissue and cellular findings support roles for AKAP95 and Cx43 in regulating cyclin D expression through SCF^FBXO31 and SCF^FBXL2.

Key Words: Lung cancer; A-kinase anchoring protein 95; Degradation of cyclins; SCF^FBXL2 and SCF^FBXO31; CPSF5/6

Core Tip: This study links mechanistic findings to clinical evidence in lung cancer. Immunohistochemical analysis of 40 tumor specimens showed that AKAP95 was negatively correlated with the SCF^FBXO31, whereas Cx43 was positively correlated with SCF^FBXO31. Complementary cell experiments supported opposing effects of AKAP95 and Cx43 on SCF^FBXO31 expression. Together, these findings provide clinical support for a proposed pathway through which the AKAP95-Cx43 axis regulates cyclin D1 degradation and cell-cycle progression.

INTRODUCTION

Lung cancer remains a major global health burden, accounting for approximately 18% of all cancer-related deaths and representing the leading cause of cancer mortality worldwide[1,2]. Owing to its frequent diagnosis at an advanced stage and the limited availability of therapies that effectively address its molecular heterogeneity, lung cancer has long been associated with a particularly poor prognosis. Therefore, elucidating the molecular mechanisms underlying lung cancer and identifying potential molecular targets for therapeutic intervention are of critical importance.

AKAP95 is a nuclear-localized protein that functions as an anchoring protein for protein kinase A (PKA). Through its interactions with various molecular partners, AKAP95 plays essential roles in chromatin condensation, cell-cycle regulation, and other biological processes in multiple cancer types[3-8]. Cx43, best known as a key component of gap junctions, is also recognized as a tumor suppressor. It regulates cell proliferation and differentiation through gap junction-mediated intercellular communication[9-11].

Previous studies have demonstrated that AKAP95 and Cx43 function as a pair of molecular switches during the G1 phase of the cancer cell cycle in cancer cells, controlling the G1/S transition by regulating the expression of D- and E-type cyclins[12,13]. Our previous research suggested that AKAP95 increases the expression of D- and E-type cyclins by inhibiting their degradation, thereby promoting retinoblastoma protein (Rb) phosphorylation and the activation of E2F transcription factors[13]. In contrast, Cx43 facilitates the degradation of E-type cyclins and counteracts the protective effect of AKAP95 on these cyclins by competitively binding to them, thereby inhibiting the G1/S transition[13]. However, the precise pathway responsible for cyclin degradation remains unclear.

The ubiquitin-mediated pathway is a well-established mechanism of endogenous protein degradation. This process is sequentially catalyzed by a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme (E2), and a ubiquitin ligase (E3)[14,15]. In general, substrate-recognition specificity in this system is determined by E3 ligases. SCF^FBXO31 and SCF^FBXL2 have been identified as specific E3 ligases that target cyclin D1 and cyclins D2 and D3 for degradation, respectively[16-20].

Phosphorylation frequently precedes substrate ubiquitination. Thr286 has been identified as a critical phosphorylation site for the ubiquitin-mediated degradation of cyclin D1, and our previous data demonstrated increased Thr286 phosphorylation of cyclin D1 following Cx43 overexpression[13,21,22]. Although few studies have examined the phosphorylation sites required for cyclin E1 degradation, our recent findings suggest that Ser73, Thr77, and Thr395 may represent potential candidate sites[23]. These findings further elucidate the molecular mechanisms underlying the ubiquitin-mediated degradation of cyclin D1 and cyclin E1.

In this study, we aimed to analyze the correlations among the expression levels of AKAP95, Cx43, SCF^FBXL2, SCF^FBXO31 and CPSF5/6 in lung cancer tissues. Our goal was to provide clinical evidence supporting the recently established mechanisms and to determine whether the findings obtained from clinical lung cancer tissues are consistent with those from cell-based experiments.

MATERIALS AND METHODS

Sample sources

A total of 40 lung cancer tissue samples were included in this study. All samples were surgical specimens obtained from patients with lung cancer who underwent surgery and provided informed consent for the subsequent experimental use of their pathological tissues. The samples were collected at Shengjing Hospital of China Medical University between 2007 and 2009. Preliminary pathological classification of all resected tissues was conducted by Shengjing Hospital. Due to multiple uses of the same batch of samples, Ethics Committee of Xiamen University School of Public Health re- examined and approved the study (No. SPHIRB-202001).

Reagents and antibodies

The PV-9000 two-step immunohistochemistry (IHC) kit and 3,3′-diaminobenzidine (DAB) chromogenic solution were purchased from Fuzhou Maxim Biotechnology Development Co., Ltd. Hematoxylin was purchased from Solarbio Co., Ltd. Rabbit primary antibodies against AKAP95, Cx43, SCF^FBXO31 were purchased from Affinity Co., Ltd., and the rabbit primary antibody against SCF^FBXL2 was purchased from Santa Cruz Biotechnology.

Immunohistochemical assay

Lung cancer tissues were processed using conventional histological methods. The specimens were fixed in 10% neutral-buffered formalin, embedded in paraffin, and sectioned at a thickness of 4 μm. IHC staining was performed according to the standard protocol supplied with the PV-9000 kit, as follows.

Deparaffinization and hydration: Tissue sections were deparaffinized in xylene and rehydrated through a graded ethanol series.

Antigen retrieval: The sections were immersed in citric acid-sodium citrate buffer and subjected to heat-induced antigen retrieval.

Blocking: Endogenous peroxidase activity was blocked using the reagent supplied with the kit.

Primary antibody incubation: The sections were incubated overnight for 8 hours at 4 °C with the corresponding primary antibodies at a dilution of 1:100, according to the manufacturers’ instructions.

Secondary antibody incubation: After washing, the sections were incubated with the reaction enhancer and horseradish peroxidase-conjugated secondary antibody according to the kit protocol.

DAB staining: DAB chromogenic solution was applied to visualize protein expression.

Hematoxylin counterstaining: The nuclei were counterstained with hematoxylin for 5-10 minutes, with the staining intensity monitored microscopically.

Dehydration: The sections were dehydrated through a graded ethanol series, cleared in xylene, and mounted with neutral resin.

Positive criteria

Brownish-yellow staining in tumor cells under a light microscope was considered indicative of positive protein expression. For each tissue section, 10 randomly selected microscopic fields were examined, with 200 tumor cells counted in each field. The percentage of positively stained cells and the staining intensity were evaluated. The percentage of positive cells was graded as follows: Negative (-): No brownish-yellow staining; weakly positive (±): < 25% positive cells; positive (+): 25%-50% positive cells; moderately positive (++): 50%-75% positive cells; strongly positive (+++): ≥ 75% positive cells. For statistical analysis, the results were further classified as negative (-) or positive (±, +, ++, or +++). Each section was independently evaluated by three investigators, and the mean result was used for statistical analysis.

Statistical analysis

Statistical analyses were performed using IBM SPSS software. The χ² test was used to compare rates, and Spearman’s rank correlation analysis was used to assess correlations between variables. A two-sided P < 0.05 was considered statistically significant.

RNA-seq

Total RNA was extracted from cells using Trizol (Beyotime Biotechnology, #R0016). RNA concentration and purity were determined using ultraviolet spectrophotometry. RNA sequencing was performed by Novogene Bioinformatics Institute (Beijing, China). The following gene identifiers were used: Gene, ensembl gene identifier, AKAP8(AKAP95), ENSG00000105127, GJA1(Cx43), ENSG00000152661, FBXL2, ENSG00000153558, FBXO31, ENSG00000103264, CPSF5, ENSG00000167005, CPSF6, ENSG00000111605.

Plasmids

The following plasmids and knockdown constructs were used in this study.

KAP95-overexpressing plasmid: PcDNA3.1-AKAP95 (NCBI reference sequence NM_005858.3).

Cx43-overexpressing plasmid: PcDNA3.1-Cx43 (NCBI reference sequence NM_000165.5).

AKAP95-knockdown plasmid: AKAP8-si (sequence: 5’-CCAGCUACAGCUACGACUAdTd-3’).

Cx43-knockdown plasmid: Cx43-sh (sense: 5’-CACCGGTTGCTGCGAACCTACATCATTCAAGAGATGATGTAGGTTCGCAGCAACCTTTTTTG -3’; antisence: 5’-GATCCAAAAAAGGTTGCTGCGAACCTACATCATCTCTTGAATGATGTAGGTTCGCAGCAACC-3’).

Cell culture and protein extraction

The A549 lung cancer cell line was obtained from the State Key Laboratory of Molecular Vaccinology and Molecular Diagnostics (Xiamen, China). Cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum at 37 °C in a humidified incubator containing 5% CO₂ and maintained at 90% humidity. Transient transfection was performed using UltraFection 3.0. Total protein was extracted from synchronized cells using radioimmunoprecipitation assay buffer (RIPA; Beyotime Biotechnology, catalog No. P0013).

Western blot analysis

Protein samples (50 μg) were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis at a constant voltage of 120 V and subsequently transferred onto polyvinylidene fluoride membranes at a constant current of 300 mA. After blocking with skimmed milk for 1 hour, the membranes were incubated overnight for 8 hours at 4 °C with the corresponding primary antibodies at a dilution of 1:3000, according to the manufacturers’ instructions. The membranes were then incubated with the appropriate secondary IgG antibodies at a dilution of 1:1000 for 1 hour at 37 °C.

Protein bands were visualized using a Bio-Rad ChemiDOC XRS+ Imaging System and quantified using Image Lab software. The intensity of each target protein band was normalized to that of the corresponding GAPDH band. For each independent experiment, the normalized value of each treatment sample was divided by that of its matched control sample, and the control value was set to 1. Western blot experiments were independently repeated three times.

RESULTS

Patient characteristics

Between 2007 and 2009, a total of 76 lung cancer tissue samples were initially collected from patients undergoing surgery. Of these, 40 samples remained suitable for sectioning and further analysis and were therefore included in the present study.

The patients ranged in age from 38 to 79 years, with a mean age of 57.9 years. Pathological diagnoses were confirmed by Shengjing Hospital and included 17 cases of squamous cell carcinoma (42.5%), 12 cases of adenocarcinoma (30.0%), 4 cases of bronchioloalveolar carcinoma (10.0%), and 7 cases of small cell carcinoma (17.5%). Regarding tumor differentiation, 11 tumors were well differentiated (27.5%), 21 were moderately differentiated (52.5%), and eight were poorly differentiated (20.0%).

Expression of AKAP95, Cx43, SCF^FBXL2, SCF^FBXO31 and CPSF5/6, in lung cancer tissues

Among the 40 lung cancer tissue samples analyzed, the positive expression rates-including weakly positive (±), positive (+), moderately positive (++), and strongly positive (+++) staining-for AKAP95, Cx43, SCF^FBXL2, SCF^FBXO31, CPSF5, and CPSF6 were 100% (40/40), 97.5% (39/40), 100% (40/40), 72.5% (29/40), 100% (40/40), and 100% (40/40), respectively (Table 1).

Table 1 Expression of proteins in lung cancer tissues (n = 40), n (%).

Protein	Positive case	Negative case
AKAP95	40 (100)	0 (0)
Cx43	39 (97.5)	1 (2.5)
SCFFBXL2	40 (100)	0 (0)
SCFFBXO31	29 (72.5)	11 (27.5)
CPSF5	40 (100)	0 (0)
CPSF6	40 (100)	0 (0)

AKAP95 and Cx43 were detected in both the cytoplasm and nucleus, whereas SCF^FBXL2 and SCF^FBXO31 were predominantly expressed in the cytoplasm. Notably, the positive expression rate of SCF^FBXL2 was significantly higher than that of SCF^FBXO31. CPSF5 and CPSF6 were primarily detected in the nucleus (Figure 1).

Figure 1 Expression of AKAP95, Cx43, SCF^FBXL2, SCF^FBXO31 CPSF5, and CPSF6 in lung cancer tissue cases. A and B: Low and high expression of AKAP95, respectively, in both the cytoplasm and nucleus; C and D: Low and high expression of Cx43, respectively, in both the cytoplasm and nucleus; E and F: Low and high expression of SCF^FBXL2, respectively, predominantly in the cytoplasm; G and H: Low and high expression of SCF^FBXO31, respectively, predominantly in the cytoplasm; I and J: Moderate and high expression of CPSF5, respectively, primarily in the nucleus; K and L: Low and high expression of CPSF6, respectively, primarily in the nucleus. Scale bars: 30 μm.

No significant correlations were observed between the expressions of AKAP95, Cx43, SCF^FBXL2, SCF^FBXO31, CPSF5, and CPSF6 and histological subtype, tumor differentiation, or lymph-node metastasis in the lung cancer samples (Table 2). These results were consistent with our previous findings[14].

Table 2 Correlation analysis between tissue phenotype, differentiation, lymph node metastasis and protein expressions.

Positive expression (n)	Phenotype (squamous cell carcinoma/adenocarcinoma/bronchioloalveolar carcinoma/small cell carcinoma)		Differentiation (low/medium/high)		Lymph node metastasis (yes/no)
	Cases	P value	Cases	P value	Cases	P value
AKAP95 (40)	17/12/4/7	NA	8/21/11	NA	21/19	NA
Cx43 (39)	16/12/4/7	0.361	8/20/11	0.915	20/19	0.348
SCFFBXL2 (40)	17/12/4/7	NA	8/21/11	NA	21/19	NA
SCFFBXO31 (29)	12/9/3/5	0.932	5/16/8	0.679	15/14	0.877
CPSF5 (40)	17/12/4/7	NA	8/21/11	NA	21/19	NA
CPSF6 (40)	17/12/4/7	NA	8/21/11	NA	21/19	NA

NA: Not available.

Correlation analysis of AKAP95, Cx43, SCF^FBXL2, SCF^FBXO31, CPSF5 and CPSF6

Table 3 summarizes the correlations among AKAP95, Cx43, SCF^FBXL2 and SCF^FBXO31. IHC analysis revealed moderate correlations between AKAP95 and SCF^FBXO31 and between Cx43 and SCF^FBXO31 expression (P < 0.05). Notably, AKAP95 expression was negatively correlated with SCF^FBXO31 expression, whereas Cx43 expression was positively correlated with SCF^FBXO31 expression. Despite the high positive expression rates of AKAP95, Cx43, and SCF^FBXL2, no significant correlations were detected between AKAP95 and SCF^FBXL2 or between Cx43 and SCF^FBXL2 (P > 0.05).

Table 3 Correlation analysis between AKAP95, Cx43, SCF^FBXL2 and SCF^FBXO31.

Correlated protein	Cases of expression level (n = 40)					Coefficients	P value
	-	±	+	++	+++
AKAP95-SCF
AKAP95	0	5	14	19	2	/	/
SCFFBXL2	0	3	14	17	6	-0.040	0.806
SCFFBXO31	11	21	8	0	0	-0.346	0.029
Cx43-SCF
Cx43	1	5	16	16	2	/	/
SCFFBXL2	0	3	14	17	6	-0.047	0.773
SCFFBXO31	11	21	8	0	0	0.334	0.035

Table 4 summarizes the correlations of AKAP95 and Cx43 expression with CPSF5 and CPSF6 expression. AKAP95 expression was positively correlated with CPSF5 expression (P < 0.05) but was not correlated with CPSF6 expression (P > 0.05). Neither CPSF5 nor CPSF6 expression was significantly correlated with Cx43 expression (P > 0.05).

Table 4 Correlation analysis between AKAP95, Cx43, CPSF5, and CPSF6.

Correlated protein	Cases of expression level (n = 40)					Coefficients	P value
	-	±	+	++	+++
AKAP95-CPSF
AKAP95	0	5	14	19	2	/	/
CPSF5	0	2	8	26	4	0.340	0.032
CPSF6	0	0	7	22	11	0.057	0.726
Cx43-CPSF
Cx43	1	5	16	16	2	/	/
CPSF5	0	2	8	26	4	0.113	0.487
CPSF6	0	0	7	22	11	0.114	0.485

AKAP95 and Cx43 affect the expression of D- and E-type cyclins, and SCF^FBXO31 at the mRNA and protein levels

Our previous studies demonstrated that AKAP95 and Cx43 regulate D- and E-type cyclins not only by modulating their degradation at the protein level but also by influencing the transcription of CCND and CCNE genes[23]. Building on these findings, the present study investigated whether SCF^FBXO31 and other molecules involved in cyclin degradation are also regulated at the transcriptional level. To address this question, we analyzed mRNA expression profiles in AKAP95-overexpressing A549 cells.

Cleavage and polyadenylation specificity factors (CPSF5 and CPSF6) are components of the Cleavage factor I mammalian complex. During gene transcription, CPSF5 and CPSF6 regulate alternative polyadenylation (APA), thereby affecting the length of the 3′ untranslated regions (3’ UTRs) of precursor mRNAs and modulating post-transcriptional gene expression[24,25]. Decreased CPSF5 and CPSF6 expression shorten 3’ UTRs, thereby affecting APA-regulated genes and altering their expression. CPSF6 has also been implicated in the development of various cancers[24].

Our preliminary RNA-seq results showed that the mRNA expression levels of Cx43, SCF^FBXL2, and SCF^FBXO31 were significantly increased in AKAP95-overexpressing A549 cells, whereas those of CPSF5 and CPSF6 were decreased (Figure 2A). Further validation of these findings by reverse transcription–quantitative PCR and additional functional experiments will be required.

Figure 2 Expressions of SCF^FBXL2 and SCF^FBXO31 in AKAP95/Cx43 in A549 cells following AKAP95 or Cx43 overexpression or knockdown. A: RNA-sequencing results from AKAP95-overexpressing cells showing increased mRNA expression levels of Cx43, SCF^FBXL2, and SCF^FBXO31; B: Decreased transcription levels of CPSF5 and CPSF6; C: Protein expression of AKAP95 and Cx43 in control, overexpression, and knockdown cells. Expressions of SCF^FBXL2 and SCF^FBXO31 following AKAP95 or Cx43 overexpression or knockdown in A549 cells. SCF^FBXL2 expression decreased only in AKAP95-overexpressing cells. SCF^FBXO31 expression was increased following Cx43 overexpression or AKAP95 knockdown and was decreased following AKAP95 overexpression or Cx43 knockdown. Band intensities were quantified by densitometry and normalized to GAPDH, with the corresponding matched control value set to 1 for each independent experiment. Data are presented as the mean ± SD of three independent experiments. ^aP < 0.05, indicates a statistically significant difference relative to the corresponding control.

We further examined protein expression in A549 cells following AKAP95 or Cx43 overexpression or knockdown by western blotting. AKAP95 inhibited SCF^FBXO31 expression, whereas Cx43 promoted its expression (Figure 2B and C). These findings are consistent with those of our previous study, which demonstrated that Cx43 promotes cyclin D1 degradation, whereas AKAP95 prevents its degradation. In addition, SCF^FBXL2 protein expression was reduced only in AKAP95-overexpressing cells (Figure 2C). These results suggest that AKAP95 regulates cyclin D2 and cyclin D3 degradation through the ubiquitin-mediated pathway at the protein level, whereas Cx43 may not participate in this process. Consistent with our other functional experiments involving cyclins D2 and D3, AKAP95 overexpression also increased the expression levels of both cyclins[23].

DISCUSSION

Previous cell- and animal-based studies have demonstrated that AKAP95 exerts pro-tumorigenic effects by suppressing the phosphorylation and ubiquitination of cyclin D1 and cyclin E1, thereby inhibiting their degradation and increasing their expression levels[13,23]. Our functional study indicated that AKAP95 stabilizes D- and E-type cyclins by directly binding to them and preventing their degradation through the ubiquitin-dependent pathway[23]. Specifically, AKAP95 appears to exert these effects by modulating the intracellular expression of cyclin-specific SCF complexes and influencing the phosphorylation of key amino acid residues required for cyclin D1 and cyclin E1 ubiquitination[23]. However, owing to the inherent heterogeneity of tumor cells, whether these cell-based findings are applicable to clinical tumor tissues remains uncertain. In the present study, we investigated the expression of SCF^FBXL2 and SCF^FBXO31 in clinical lung cancer tissues. The moderate correlation observed between SCF^FBXO31 expression and the expression of both AKAP95 and Cx43 were consistent with our functional experimental findings and provided clinical evidence supporting the proposed regulatory relationships.

Interestingly, SCF^FBXO31 mRNA expression was increased in AKAP95-overexpressing lung cancer cells, whereas its protein expression was decreased. This discrepancy between the mRNA and protein levels is noteworthy. One possible explanation is that AKAP95 may exert inhibitory effects on SCF^FBXO31 at both the transcriptional and protein levels, whereas Cx43 may exert opposing regulatory effects. The modest increase in SCF^FBXO31 mRNA expression may therefore result from the simultaneous upregulation of Cx43, whose positive effect on SCF^FBXO31 transcription may exceed the negative regulatory effect of AKAP95. These findings suggest that AKAP95 and Cx43 may regulate cyclin D1 ubiquitination and degradation by modulating SCF^FBXO31 expression in lung cancer cells.

Similarly, SCF^FBXL2 mRNA expression was increased in AKAP95-overexpressing cells. However, western blot analysis showed that Cx43 did not affect SCF^FBXL2 protein expression, consistent with the absence of a significant correlation between Cx43 and SCF^FBXL2 expression in the IHC analysis. These findings suggest that the mechanism regulating SCF^FBXL2 differs from that regulating SCF^FBXO31. The specific pathways underlying SCF^FBXL2 regulation remain unclear and warrant further investigation.

It is important to emphasize that, although both our functional experiments and the clinical lung cancer tissue data presented here suggest that AKAP95 regulates SCF^FBXO31 and SCF^FBXL2, direct evidence explaining the mechanisms underlying these regulatory relationships is currently lacking. In particular, it remains unclear whether AKAP95 interacts directly with these SCF components or regulates them through indirect molecular intermediates. Nevertheless, the present findings support the existence of a regulatory relationship among these proteins and provide a basis for future studies aimed at elucidating the underlying mechanisms.

Previous findings suggest that AKAP95 and Cx43 may influence the mRNA expression of CCND, CCNE, and FBXO31 in lung cancer cells. In the present study, we examined the correlations of AKAP95 and Cx43 expression with CPSF5 and CPSF6 expression in lung cancer tissues to explore whether these APA-related factors might participate in this regulatory process. Notably, CPSF5 expression was positively correlated with AKAP95 expression, whereas CPSF6 expression was not significantly correlated with either AKAP95 or Cx43 expression. These results suggest that AKAP95 and Cx43 may not regulate CCND and CCNE expression through a CPSF6-mediated post-transcriptional mechanism. In contrast, the positive correlation between AKAP95 and CPSF5 suggests that CPSF5 may participate in AKAP95-associated regulation of cyclin transcript processing or expression. Although CPSF5 and CPSF6 have not been established as specific binding partners or regulators of CCND, CCNE, or FBXO31, their potential involvement in AKAP95-mediated regulation of cyclin expression cannot be excluded. Further cell-based and mechanistic studies are required to clarify their precise roles.

Several limitations of this study should be acknowledged. First, the sample size was relatively small (n = 40) because of the difficulty in obtaining suitable clinical specimens, which may have limited the representativeness and generalizability of the findings. Although the primary objective was to provide clinical evidence supporting molecular mechanisms identified in functional experiments, the limited sample size increased the risk of bias. Second, the tissue samples were not randomly selected because of constraints associated with sample collection and experimental design, thereby introducing a potential risk of selection bias. Third, unmeasured confounding factors may have affected the results. Although AKAP95 and Cx43 are widely expressed across multiple cancer types and histological subtypes, other unidentified components of the AKAP95 signaling pathway may have introduced bias. Additionally, because of the limited availability of cell lines, the preliminary in vitro experiments were performed only in A549 cells. Given the molecular heterogeneity of lung cancer, future studies should include additional lung cancer cell lines representing different histological and molecular subtypes to enable cross-validation and improve the generalizability of the cellular findings. Finally, the study design limited the strength of causal inference. Although our results provide preliminary evidence linking AKAP95 and Cx43 to SCF^FBXO31-mediated cyclin D1 degradation, a definitive causal relationship cannot be established without further experimental validation.

Future studies should focus on clarifying the mechanisms of the AKAP95 axis to better characterize the signaling pathways involved and reduce the effects of potential confounding factors. Larger, prospectively designed clinical studies and rigorously controlled experimental studies are also required to improve the reliability of causal inferences. Moreover, more comprehensive longitudinal clinical data, including patient outcomes and therapeutic responses, should be systematically collected and incorporated into future analyses to better establish the relationships between molecular expression patterns within the AKAP95 axis and clinical manifestations.

Overall, the present study demonstrates that SCF^FBXO31 expression is correlated with both AKAP95 and Cx43 in lung cancer tissues. SCF^FBXO31 may play an important role in regulating cyclin D1 expression and, consequently, cell-cycle progression, and may function as a downstream effector of AKAP95 and Cx43. These findings provide new insights into the molecular mechanisms underlying cell-cycle regulation in lung cancer and establish a foundation for future investigations of potential therapeutic targets within this pathway.

CONCLUSION

Overall, the present study demonstrates that SCF^FBXO31 expression is correlated with both AKAP95 and Cx43 in lung cancer tissues. SCF^FBXO31 may play an important role in regulating cyclin D1 expression and, consequently, cell-cycle progression, and may function as a downstream effector of AKAP95 and Cx43. These findings provide new insights into the molecular mechanisms underlying cell-cycle regulation in lung cancer and establish a foundation for future investigations of potential therapeutic targets within this pathway.

ACKNOWLEDGEMENTS

We thank Dr. Kai Wang for technical supports. We are also grateful for the kindly assistance of Mr. Chao-Qing Wu.