Revised: May 10, 2026
Accepted: May 19, 2026
Published online: June 28, 2026
Processing time: 71 Days and 22.5 Hours
While next-generation dual-energy computed tomography (DECT) has demon
To assess the value of DECT with the material decomposition (MMD) algorithm in quantifying CrF in patients with CD, and to explore the impact of CrF on intestinal inflammation, fibrosis, adipogenesis, and expression of mucosal barrier-related genes.
Patients with active or quiescent CD and healthy controls were included for cli
DECT provided high-quality images and allowed quantification of CrF. CrF volume was significantly higher in active CD patients than in healthy controls (104.67 ± 26.51 vs 17.24 ± 5.16, P < 0.05). In quiescent CD, CrF volume decreased compared with active CD (32.69 ± 11.42 vs 104.67 ± 26.51, P < 0.05) but remained above control levels (
DECT with the MMD algorithm can effectively quantify intestinal CrF in CD. The quantified CrF correlates well with clinical, endoscopic, histopathological, and molecular indicators of disease activity and intestinal barrier dysfunction. This approach may serve as a useful noninvasive tool for assessing CD.
Core Tip: This study evaluated the utility of dual-source computed tomography with the material decomposition algorithm in quantifying intestinal creeping fat (CrF) in Crohn’s disease (CD). Patients with active and quiescent CD underwent clinical, endoscopic, and imaging assessments. Our results demonstrate that the volume of CrF strongly correlates with clinical, endoscopic, and histological scores for both inflammation and fibrosis. Moreover, we also found that higher CrF volume is associated with increased expression of the adipogenic factor peroxisome proliferator-activated receptor gamma 2 and reduced levels of the barrier protein occludin, providing a valuable non-invasive tool for assessing disease activity and treatment response.
- Citation: Dong LW, Chen HJ, Chen CC, Lan C. Value of dual energy computed tomography with material decomposition algorithm in assessing intestinal creeping fat in Crohn’s disease. World J Radiol 2026; 18(6): 122056
- URL: https://www.wjgnet.com/1949-8470/full/v18/i6/122056.htm
- DOI: https://dx.doi.org/10.4329/wjr.122056
Crohn’s disease (CD) is a chronic inflammatory bowel disease characterized by segmental or focal inflammatory changes in the intestinal mucosa[1]. It is complex, difficult to diagnose, and has a protracted and recurrent course, severely affecting patients’ physical and mental health as well as their quality of life, thereby increasing the burden of medical expenses[2]. The intestinal barrier is a highly selective functional barrier system present in the intestine[3], composed of non-specific and specific immune barriers of the intestinal mucosa[4]. The intestinal mucosal barrier plays a crucial role in protecting the body from damage caused by food antigens, microorganisms, and their harmful metabolic products, as well as in maintaining the stability of the internal environment[5]. Tight junctions (TJs) are located at the apex of cell-cell junction complexes and are essential for maintaining cell polarity and controlling paracellular transport. The primary biological functions of occludin are barrier maintenance and regulation. In CD patients, the expression of cell junction proteins and their mRNA in the active inflammatory mucosal tissue is significantly downregulated[6].
Creeping fat (CrF) refers to the pathological process where fat tissue migrates from distant inflammatory and injured sites to the lesion site, filling and encapsulating the affected area[7]. Certain signaling molecules produced by inflammation mediate CrF, serving to control the extent of inflammation, mitigate inflammatory damage, and prevent tissue leakage[8]. On the other hand, CrF contains a large number of anti-inflammatory factors and pro-fibrotic factors, which can promote fibrosis[9]. Animal experiments have demonstrated that CD intestines exhibit significant CrF[10]. Pero
Computed tomography (CT) can effectively visualize adipose tissue[13,14]. Dual-energy CT (DECT) is currently the most advanced CT scanning system[15]. DECT is currently used for quantifying skeletal muscle fat[16], measuring hepatic iron and fat deposition[17], and evaluating adipose tissue in organs such as the kidneys and lungs[18]. However, there are no reported applications of DECT for intestinal CrF. Thus, this study aimed to investigate the value of DECT in assessing intestinal CrF and its clinical and molecular significance.
Thirty active CD patients (aged 14-40 years) who were hospitalized in the Department of Gastroenterology at Hainan Provincial People’s Hospital and met the CD diagnostic criteria established in the 2018 China Inflammatory Bowel Disease Diagnosis and Treatment Expert Consensus were included[19]. The exclusion criteria included contraindications for CT examination and endoscopic examination. Thirty healthy volunteers, aged 14-40 years, with a gender ratio matching that of the CD patients, were also enrolled. The study was approved by the Ethics Committee of Hainan Provincial People’s Hospital.
Colonoscopic examinations were performed routinely. The CD Simplified Endoscopic Score for CD system was used for scoring[20].
Colonic tissue was fixed in polyformaldehyde, embedded in paraffin, and sectioned into 4 μm slices. Standard he
Detection of factors related to colitis/fibrosis and PPARγ2/occludin molecules
Immunohistochemical detection of the inflammatory cytokine tumor necrosis factor-α (TNF-α) and the fibrosis-related cytokine transforming growth factor-β (TGF-β) was performed. Immunohistochemistry and real time-polymerase chain reaction (PCR) were used to detect the mRNA expression of the adiposity-related factor PPARγ2 and the intestinal mucosal barrier-associated factor occludin.
Colon tissue processing: Colon tissue was dehydrated in graded alcohol, cleared in xylene, infiltrated with paraffin wax, and embedded. The embedded tissue was then sectioned into 5 μm slices.
Immunohistochemical staining: After deparaffinization, sections underwent antigen retrieval. Endogenous peroxidase was blocked, followed by blocking with normal goat serum. Sections were then incubated with primary antibodies (dilutions listed in Table 1), followed by incubation with horseradish peroxidase labeled goat anti-rabbit/mouse secondary antibody. Finally, freshly prepared 3,3’-diaminobenzidine chromogenic solution was used for visualization.
| Antibody | Dilution ratio |
| TGF-β | 1:100 |
| TNF-α | 1:100 |
| PPARγ2 | 1:100 |
| Occludin | 1:200 |
mRNA expression was determined by real-time quantitative PCR. Briefly, RNA was extracted from the tissue of the terminal ileum by using Trizol and DNase I. Primers were designed based on the gene sequences of mice (Table 2). β-actin was used as an internal reference. RNA was then reverse transcribed into cDNA according to the manufacturer’s instructions for the TAKARA PrimeScript kit (TAKARA-RR047A). Real-time quantitative PCR was performed under the following conditions: Pre-denaturation at 94 °C for 5 minutes; 30 cycles of denaturation at 94 °C for 1 minute and extension at 57-60 °C; and a final extension at 72 °C for 7 minutes. Results are expressed as the ratio of target gene expression to that of the control gene (β-actin).
| Name | Primer | Sequence | Size |
| β-actin | Forward | GAGACCTTCAACACCCCAGC | 103 bp |
| Reverse | ATGTCACGCACGATTTCCC | ||
| PPARγ2 | Forward | CCCTGGCAA AGCATTTGTAT | 109 bp |
| Reverse | ACTGGCACCCTTGAAAAATG | ||
| Occludin | Forward | CCACCCGCGTACAACCTTCTT | 174 bp |
| Reverse | GAAGCCGGCCTTGCACATGCC |
The Siemens SOMATOM Definition Flash dual-source CT system features cutting-edge energy spectrum purification technology and dual-energy imaging technology, offering faster scanning speed, lower radiation dose, and clearer tissue imaging compared to conventional CT scans. It is equipped with image reconstruction and processing software based on a material decomposition (MMD) algorithm.
The MMD algorithm utilizes dual-energy spectral data to calculate the proportions of each component within each voxel through dual-material or triple-MMD. For example, in abdominal imaging, it is commonly assumed that a voxel consists of three materials: Fat, non-fat soft tissue, and iodinated contrast agent. By solving a system of linear equations based on the decay values at two energy levels, the algorithm determines the fat fraction within the voxel, generating a fat fraction image.
Pre-examination preparation: High-fiber foods (e.g., vegetables and fruits) should be avoided for three days prior to the examination. On the day of the examination, 2000 mL of 25% mannitol was administered orally. Fifteen minutes before the scan, 20 mg of scopolamine was administered intramuscularly.
Scan sequence: The scanning sequence included non-contrast, dual-energy dynamic, and venous enhancement phases. The non-contrast parameters were as follows: Tube voltage 120 kV, pitch 0.7, slice reconstruction 0.5, collimator width 128 mm × 0.6 mm, reconstructed layer thickness 1 mm, and reconstruction interval 0.7 mm.
CT scans were performed using a dual-energy protocol without contrast agent. The scanning parameters were as follows: Detector collimation 128 mm × 0.6 mm, pitch 0.6, gantry rotation time 0.5 seconds, and matrix 512 × 512. The tube voltage combination was 100 kV and Sn150 kV.
Image analysis: DECT images were independently reviewed by two CT diagnostic physicians with senior professional titles. First, the image quality was evaluated, including location, pixelation, and artifacts, followed by analysis of the signal characteristics of lesions on non-contrast imaging and dynamic enhancement features. The presence of intestinal wall inflammation, fibrosis, and fat accumulation was assessed on DECT images. Intestinal wall inflammation was defined as wall thickening with partial enhancement accompanied by vascular changes; intestinal wall fibrosis was defined as transmural enhancement. Subsequently, a radiologist with over 5 years of experience in intestinal CT reading, without knowledge of clinical, endoscopic, or pathological results, selected three regions of interest in the fat-accumulating intestinal segments on the DECT images. The regions of interest selection avoided necrotic areas, with a threshold of 100 HU. CT values were measured and averaged. Fat content was calculated using the MMD algorithm built into the dual-source CT system.
Statistical analyses were performed using IBM SPSS Statistics 29 software. Normality of measurement data was tested by the Kolmogorov-Smirnov test, and data conforming to a normal distribution are expressed as the mean ± SD. Spearman correlation analysis was employed to evaluate the correlations of intestinal inflammation, fibrosis, and fat quantification with histological scores and intestinal-associated molecular expression. A P value < 0.05 was considered significant.
Among all the subjects, DECT provided high-quality imaging that clearly depicted CrF and its adjacent tissues (Figure 1). Patients with active CD exhibited significantly greater CrF volume compared to those in the quiescent phase and healthy controls. Notably, during the quiescent phase, CrF volume remained higher compared with that in healthy controls (Figure 1), indicating that it did not return to baseline.
To validate the potential clinical relevance of CrF volume, we examined the relationship between CrF volume and disease activity markers, including CD activity index (CDAI) and endoscopic scores (Figure 2, Table 3). Similar to the trend observed in CrF volume during CD active and quiescent phases, both clinical markers were markedly increased in active CD compared with those in the quiescent phase and control groups. Furthermore, our analysis demonstrated a positive correlation between CrF volume and clinical disease activity (CDAI: r = 0.927; endoscopic score: r = 0.904), indicating that the decline in CrF volume during remission could be associated with clinical improvement.
Given the positive correlation between CrF volume and endoscopic scores, we hypothesized that there might be a strong positive correlation between CrF volume and intestinal histopathology, such as the intensity of inflammatory infiltration, fibrosis, and intestinal epithelial apoptosis. We assessed the degrees of inflammatory infiltration by Truelove scores and fibrosis by Masson scores. In line with the CrF volume trend shown in Figure 1, Truelove and Masson scores were significantly higher in active CD. Although both scores declined in the quiescent phase, they remained above baseline control levels. Moreover, CrF volume exhibited strong positive correlations with the Truelove inflammation score (r = 0.917) and the Masson fibrosis score (r = 0.932). Besides, epithelial apoptosis assessed by TUNEL staining showed similar changes during active and quiescent phases. Taken together, there is a strong positive correlation between intestinal CrF and intestinal histopathology in CD (Figure 3, Table 4).
Considering the established role of TNF-α in inflammation and TGF-β in fibrosis, we also tested the relationship between CrF volume and these two cytokines. We first detected the dynamic changes of the two cytokines within the samples. Similarly, the levels of the two cytokines were significantly upregulated during active CD and markedly decreased during remission. Correlation analysis also validated their positive correlation with intestinal CrF (TNF-α: r = 0.936; TGF-β: r = 0.891) (Figure 4, Table 5).
Next, we analyzed the potential role of CrF in adipogenesis and intestinal barrier dysfunction. To that end, the adipogenic regulator PPARγ2 and occludin, a critical TJ protein responsible for maintaining intestinal mucosal barrier, were analyzed by qPCR and immunostaining. We found that the expression levels of PPARγ2 were in parallel with CrF accumulation (r = 0.917) at both protein and mRNA levels, suggesting active adipogenesis. Conversely, the expression levels of occludin showed a significant negative correlation with CrF accumulation (r = -0.926), further supporting the impairment of the intestinal epithelial barrier in CD (Figures 5 and 6, Table 6).
| Group | Intestinal CrF | PPARγ2 | Occludin | ||
| Protein | Gene | Protein | Gene | ||
| Normal control (n = 30) | 17.24 ± 5.16 | 0.003 ± 0.001 | 1.14 ± 0.21 | 0.015 ± 0.002 | 1.12 ± 0.33 |
| Active phase (n = 30) | 104.67 ± 26.51a | 0.025 ± 0.002a | 5.83 ± 0.17a | 0.002 ± 0.001a | 0.41 ± 0.08a |
| Quiescent phase (n = 30) | 32.69 ± 11.42a,b | 0.004 ± 0.001a,b | 2.06 ± 0.20a,b | 0.006 ± 0.002a,b | 0.65 ± 0.11a,b |
Given the strong association between CrF and CD, the role of CrF in CD is increasingly recognized. CrF is not only involved in intestinal inflammation and fibrosis, but may also play an important role in carcinogenesis. Clinically, CrF has been shown to be crucial for the non-invasive assessment of CD disease activity, treatment efficacy, and even for predicting disease progression and prognosis[23]. Therefore, accurate detection of CrF in CD patients—particularly the quantitative measurement of CrF volume—is essential in the management of CD patients. Notably, while intestinal ultrasound and conventional CT are undeniably useful for monitoring CD, they are less effective in assessing CrF[24,25]. With advances in technology, dual-source CT with its associated MMD algorithm has been developed and has proven effective in detecting CrF in CD and enabling its quantitative measurement[26]. Accordingly, this study aimed to utilize DECT for intestinal imaging and to investigate the potential role of DECT-assessed intestinal CrF in relation to clinical manifestations and molecular changes in CD patients.
Given the complexity of CD, we focused on patients with active and relatively quiescent CD, specifically those with colonic and terminal ileal lesions that were accessible for endoscopic detection and biopsy. This cohort enabled us to investigate both the clinical manifestations and molecular mechanisms of CD. Comparison with a healthy control group provided insights into disease progression[27]. Of note, elderly patients with CD are relatively rare and often present with confounding factors due to a prolonged disease course. Pediatric CD, meanwhile, exhibits distinct characteristics that differ significantly from adult CD. Therefore, we restricted the study population to individuals aged 14-40 years.
First, our findings demonstrated that DECT can effectively visualize intestinal CrF and distinguish it from adjacent tissue in CD, producing high-quality images. While DECT has shown promise in assessing fat deposition in the liver, bone marrow, and pancreas, its application to intestinal fat remains poorly studied[28,29]. Although De Kock et al[26] reported the use of DECT for evaluating intestinal CrF, their study did not include clinical staging of CD. In the present study, we found that intestinal CrF volume was significantly higher during active CD, markedly decreased during remission, yet remained significantly upregulated compared to control groups. This aligns with the clinical observation that CD progression persists even during remission. The persistence of elevated CrF in quiescent CD, despite clinical improvement, may be attributed to ongoing inflammation or irreversible adipose tissue remodeling, a finding also observed in our study. It should be noted that the clinical course of CD is protracted, and the clinical quiescent phase is relative; even with active treatment, the potential underlying molecular mechanisms remain unresolved.
Second, we found that DECT with the MMD algorithm could accurately quantify CrF in CD. The quantitative results exhibited strong concordance with the established clinical manifestations of CD, including CDAI score, endoscopic score, Truelove score, and Masson score. Additionally, we examined intestinal epithelial cell apoptosis in CD and found that the alterations in apoptosis were consistent with the extent of CrF. While Shao et al[30] previously reported that intestinal CrF in CD might be related to disease severity, their study was limited, particularly by the absence of histopathological and molecular markers analysis. Although our study identified a strong link between changes in CrF volume and clinical indicators as well as inflammatory-fibrotic factors, a causal conclusion could not be generated, and further investigation is required in future studies.
By analyzing the expression of PPARγ2 and occludin in active and quiescent CD, we found that changes in intestinal CrF paralleled the protein and gene expression levels of PPARγ2 and occludin across disease phases. This concordance suggests that DECT quantification of CrF reflects the molecular mechanisms underlying CD pathogenesis. Aggeletopoulou et al[31] reported potential specific molecular mechanisms associated with CrF in CD, and our results are largely consistent with their findings. Given the highly complex role of CrF in intestinal inflammation and fibrosis, PPARγ2 and occludin likely represent only part of this mechanism, necessitating further research. A potential bidirectional re
In conclusion, our study demonstrates that DECT with the MMD algorithm can effectively visualize CrF in CD, correlating with the clinical manifestations, histopathological features, and molecular mechanisms of the disease. This approach holds promise as a novel non-invasive diagnostic tool for future CD assessment, therapeutic efficacy evaluation, and prognosis prediction. Certainly, our study has several limitations. These include a relatively small sample size, inclusion of only active and quiescent disease phases, and exclusion of patients who had received treatment. Additionally, we did not evaluate specific DECT imaging parameters of CrF in the context of CD. Further studies are warranted to address these issues.
| 1. | Torres J, Mehandru S, Colombel JF, Peyrin-Biroulet L. Crohn's disease. Lancet. 2017;389:1741-1755. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 2287] [Cited by in RCA: 2126] [Article Influence: 236.2] [Reference Citation Analysis (7)] |
| 2. | Kraehenbuhl JP, Pringault E, Neutra MR. Review article: Intestinal epithelia and barrier functions. Aliment Pharmacol Ther. 1997;11 Suppl 3:3-8; discussion 8. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 22] [Cited by in RCA: 39] [Article Influence: 1.3] [Reference Citation Analysis (0)] |
| 3. | Laissue JA, Chappuis BB, Müller C, Reubi JC, Gebbers JO. The intestinal immune system and its relation to disease. Dig Dis. 1993;11:298-312. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 28] [Cited by in RCA: 28] [Article Influence: 0.8] [Reference Citation Analysis (0)] |
| 4. | Harari Y, Weisbrodt NW, Moody FG. Ileal mucosal response to bacterial toxin challenge. J Trauma. 2000;49:306-313. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 13] [Cited by in RCA: 18] [Article Influence: 0.7] [Reference Citation Analysis (0)] |
| 5. | Kiyono H, Kweon MN, Hiroi T, Takahashi I. The mucosal immune system: from specialized immune defense to inflammation and allergy. Acta Odontol Scand. 2001;59:145-153. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 25] [Cited by in RCA: 31] [Article Influence: 1.2] [Reference Citation Analysis (0)] |
| 6. | Takeuchi K, Maiden L, Bjarnason I. Genetic aspects of intestinal permeability in inflammatory bowel disease. Novartis Found Symp. 2004;263:151-8; discussion 159. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 4] [Cited by in RCA: 5] [Article Influence: 0.3] [Reference Citation Analysis (0)] |
| 7. | Shen L, Su L, Turner JR. Mechanisms and functional implications of intestinal barrier defects. Dig Dis. 2009;27:443-449. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 120] [Cited by in RCA: 118] [Article Influence: 6.9] [Reference Citation Analysis (5)] |
| 8. | Gassler N, Rohr C, Schneider A, Kartenbeck J, Bach A, Obermüller N, Otto HF, Autschbach F. Inflammatory bowel disease is associated with changes of enterocytic junctions. Am J Physiol Gastrointest Liver Physiol. 2001;281:G216-G228. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 279] [Cited by in RCA: 274] [Article Influence: 11.0] [Reference Citation Analysis (0)] |
| 9. | Zeissig S, Bürgel N, Günzel D, Richter J, Mankertz J, Wahnschaffe U, Kroesen AJ, Zeitz M, Fromm M, Schulzke JD. Changes in expression and distribution of claudin 2, 5 and 8 lead to discontinuous tight junctions and barrier dysfunction in active Crohn's disease. Gut. 2007;56:61-72. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1048] [Cited by in RCA: 981] [Article Influence: 51.6] [Reference Citation Analysis (4)] |
| 10. | Hollander D, Vadheim CM, Brettholz E, Petersen GM, Delahunty T, Rotter JI. Increased intestinal permeability in patients with Crohn's disease and their relatives. A possible etiologic factor. Ann Intern Med. 1986;105:883-885. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 635] [Cited by in RCA: 549] [Article Influence: 13.7] [Reference Citation Analysis (17)] |
| 11. | Mencarelli A, Distrutti E, Renga B, D'Amore C, Cipriani S, Palladino G, Donini A, Ricci P, Fiorucci S. Probiotics modulate intestinal expression of nuclear receptor and provide counter-regulatory signals to inflammation-driven adipose tissue activation. PLoS One. 2011;6:e22978. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 66] [Cited by in RCA: 79] [Article Influence: 5.3] [Reference Citation Analysis (0)] |
| 12. | Ha CWY, Martin A, Sepich-Poore GD, Shi B, Wang Y, Gouin K, Humphrey G, Sanders K, Ratnayake Y, Chan KSL, Hendrick G, Caldera JR, Arias C, Moskowitz JE, Ho Sui SJ, Yang S, Underhill D, Brady MJ, Knott S, Kaihara K, Steinbaugh MJ, Li H, McGovern DPB, Knight R, Fleshner P, Devkota S. Translocation of Viable Gut Microbiota to Mesenteric Adipose Drives Formation of Creeping Fat in Humans. Cell. 2020;183:666-683.e17. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 379] [Cited by in RCA: 345] [Article Influence: 57.5] [Reference Citation Analysis (7)] |
| 13. | Zoabi A, Bentov-Arava E, Sultan A, Elia A, Shalev O, Orevi M, Gofrit ON, Margulis K. Adipose tissue composition determines its computed tomography radiodensity. Eur Radiol. 2024;34:1635-1644. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 12] [Reference Citation Analysis (0)] |
| 14. | Figueiredo P, Marques EA, Gudnason V, Lang T, Sigurdsson S, Jonsson PV, Aspelund T, Siggeirsdottir K, Launer L, Eiriksdottir G, Harris TB. Computed tomography-based skeletal muscle and adipose tissue attenuation: Variations by age, sex, and muscle. Exp Gerontol. 2021;149:111306. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 2] [Cited by in RCA: 21] [Article Influence: 4.2] [Reference Citation Analysis (0)] |
| 15. | Chung R, Dane B, Yeh BM, Morgan DE, Sahani DV, Kambadakone A. Dual-Energy Computed Tomography: Technological Considerations. Radiol Clin North Am. 2023;61:945-961. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 13] [Reference Citation Analysis (0)] |
| 16. | Graffy PM, Sandfort V, Summers RM, Pickhardt PJ. Automated Liver Fat Quantification at Nonenhanced Abdominal CT for Population-based Steatosis Assessment. Radiology. 2019;293:334-342. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 128] [Cited by in RCA: 123] [Article Influence: 17.6] [Reference Citation Analysis (0)] |
| 17. | Li XH, Feng ST, Cao QH, Coffey JC, Baker ME, Huang L, Fang ZN, Qiu Y, Lu BL, Chen ZH, Li Y, Bettenworth D, Iacucci M, Sun CH, Ghosh S, Rieder F, Chen MH, Li ZP, Mao R. Degree of Creeping Fat Assessed by Computed Tomography Enterography is Associated with Intestinal Fibrotic Stricture in Patients with Crohn's Disease: A Potentially Novel Mesenteric Creeping Fat Index. J Crohns Colitis. 2021;15:1161-1173. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 71] [Cited by in RCA: 70] [Article Influence: 14.0] [Reference Citation Analysis (0)] |
| 18. | D'Angelo T, Cicero G, Mazziotti S, Ascenti G, Albrecht MH, Martin SS, Othman AE, Vogl TJ, Wichmann JL. Dual energy computed tomography virtual monoenergetic imaging: technique and clinical applications. Br J Radiol. 2019;92:20180546. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 31] [Cited by in RCA: 116] [Article Influence: 16.6] [Reference Citation Analysis (0)] |
| 19. | Lichtenstein GR, Loftus EV, Isaacs KL, Regueiro MD, Gerson LB, Sands BE. ACG Clinical Guideline: Management of Crohn's Disease in Adults. Am J Gastroenterol. 2018;113:481-517. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1222] [Cited by in RCA: 1069] [Article Influence: 133.6] [Reference Citation Analysis (3)] |
| 20. | Daperno M, D'Haens G, Van Assche G, Baert F, Bulois P, Maunoury V, Sostegni R, Rocca R, Pera A, Gevers A, Mary JY, Colombel JF, Rutgeerts P. Development and validation of a new, simplified endoscopic activity score for Crohn's disease: the SES-CD. Gastrointest Endosc. 2004;60:505-512. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1538] [Cited by in RCA: 1441] [Article Influence: 65.5] [Reference Citation Analysis (4)] |
| 21. | Argmann C, Hou R, Ungaro RC, Irizar H, Al-Taie Z, Huang R, Kosoy R, Venkat S, Song WM, Di'Narzo AF, Losic B, Hao K, Peters L, Comella PH, Wei G, Atreja A, Mahajan M, Iuga A, Desai PT, Branigan P, Stojmirovic A, Perrigoue J, Brodmerkel C, Curran M, Friedman JR, Hart A, Lamousé-Smith E, Wehkamp J, Mehandru S, Schadt EE, Sands BE, Dubinsky MC, Colombel JF, Kasarskis A, Suárez-Fariñas M. Biopsy and blood-based molecular biomarker of inflammation in IBD. Gut. 2023;72:1271-1287. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 4] [Cited by in RCA: 90] [Article Influence: 22.5] [Reference Citation Analysis (0)] |
| 22. | Li XH, Fang ZN, Guan TM, Lin JJ, Sun CH, Huang SY, Mao R, Lu BL, Cao QH, Feng ST, Li ZP. A novel collagen area fraction index to quantitatively assess bowel fibrosis in patients with Crohn's disease. BMC Gastroenterol. 2019;19:180. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 2] [Cited by in RCA: 14] [Article Influence: 2.0] [Reference Citation Analysis (1)] |
| 23. | Bauer-Rowe KE, Pham B, Griffin M, Liang NE, Kim A, Lu JM, Januszyk M, Guo JL, De Santis S, Xing Y, Prystupa A, Sidhu I, Suh EJ, Foster DS, Korah M, Goyal A, Wan DC, Norton JA, Delitto D, Pizarro TT, Naik SL, Hyun JS, Longaker MT. Creeping fat-derived mechanosensitive fibroblasts drive intestinal fibrosis in Crohn's disease strictures. Cell. 2025;188:6536-6553.e26. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 35] [Cited by in RCA: 25] [Article Influence: 25.0] [Reference Citation Analysis (0)] |
| 24. | Puca P, Del Vecchio LE, Ainora ME, Gasbarrini A, Scaldaferri F, Zocco MA. Role of Multiparametric Intestinal Ultrasound in the Evaluation of Response to Biologic Therapy in Adults with Crohn's Disease. Diagnostics (Basel). 2022;12:1991. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 10] [Cited by in RCA: 8] [Article Influence: 2.0] [Reference Citation Analysis (0)] |
| 25. | Zhou Z, Xiong Z, Cheng R, Luo Q, Li Y, Xie Q, Xiao P, Hu D, Hu X, Shen Y, Li Z. Volumetric visceral fat machine learning phenotype on CT for differential diagnosis of inflammatory bowel disease. Eur Radiol. 2023;33:1862-1872. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 26] [Reference Citation Analysis (1)] |
| 26. | De Kock I, Delrue L, Lecluyse C, Hindryckx P, De Vos M, Villeirs G. Feasibility study using iodine quantification on dual-energy CT enterography to distinguish normal small bowel from active inflammatory Crohn's disease. Acta Radiol. 2019;60:679-686. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 18] [Cited by in RCA: 28] [Article Influence: 4.0] [Reference Citation Analysis (1)] |
| 27. | Nakase H, Uchino M, Shinzaki S, Matsuura M, Matsuoka K, Kobayashi T, Saruta M, Hirai F, Hata K, Hiraoka S, Esaki M, Sugimoto K, Fuji T, Watanabe K, Nakamura S, Inoue N, Itoh T, Naganuma M, Hisamatsu T, Watanabe M, Miwa H, Enomoto N, Shimosegawa T, Koike K. Evidence-based clinical practice guidelines for inflammatory bowel disease 2020. J Gastroenterol. 2021;56:489-526. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 427] [Cited by in RCA: 409] [Article Influence: 81.8] [Reference Citation Analysis (0)] |
| 28. | Molwitz I, Leiderer M, Özden C, Yamamura J. Dual-Energy Computed Tomography for Fat Quantification in the Liver and Bone Marrow: A Literature Review. Rofo. 2020;192:1137-1153. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 5] [Cited by in RCA: 23] [Article Influence: 3.8] [Reference Citation Analysis (0)] |
| 29. | Huang S, Liang Y, Zhong X, Luo Q, Yao X, Nong Z, Luo Y, Luo L, Jiang W, Qin X, Lv Y. Pancreatic fat fraction in dual-energy computed tomography as a potential quantitative parameter in the detection of type 2 diabetes mellitus. Eur J Radiol. 2023;159:110668. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 11] [Reference Citation Analysis (1)] |
| 30. | Shao C, He C, Zheng P, Zhou P, Chen X. Preoperative prediction of tumor budding and lymphovascular invasion in colon cancer using dual-energy CT: a prospective study with internal model validation. Abdom Radiol (NY). 2025;50:3406-3414. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 3] [Reference Citation Analysis (0)] |
| 31. | Aggeletopoulou I, Tsounis EP, Mouzaki A, Triantos C. Creeping Fat in Crohn's Disease-Surgical, Histological, and Radiological Approaches. J Pers Med. 2023;13:1029. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 20] [Cited by in RCA: 21] [Article Influence: 7.0] [Reference Citation Analysis (0)] |