Published online Jun 26, 2026. doi: 10.4252/wjsc.119228
Revised: February 15, 2026
Accepted: April 1, 2026
Published online: June 26, 2026
Processing time: 152 Days and 21 Hours
Bone marrow-derived mesenchymal stem cells (BMSCs) are a promising therapy for ulcerative colitis (UC). However, their clinical benefit is limited by inefficient homing to the inflamed colonic mucosa. Improving the migration of BMSCs to sites of intestinal inflammation remains a key challenge in the development of cell-based treatments for UC. Tongxie Yaofang (TXYF), a traditional Chinese medicine formula, has been shown to relieve symptoms in UC patients. Our previous in vitro studies also showed that TXYF enhances the migratory capacity of BMSCs. However, whether TXYF enhances the therapeutic effect of BMSCs transplantation in UC, and the mechanisms involved, remain unclear.
To determine whether TXYF promotes the homing of BMSCs and improves experimental colitis, and to explore the underlying mechanisms.
BMSCs from Sprague-Dawley rats were characterized via flow cytometry, and TXYF’s effects on migration were evaluated using scratch and Transwell assays. In a colitis model, the synergistic efficacy of TXYF and BMSCs was assessed through disease activity index, histology, immunohistochemistry, tracing, reverse transcription-quantitative polymerase chain reaction, and western blotting. Furthermore, the stromal cell-derived factor 1 (SDF-1)/C-X-C chemokine receptor type 4 (CXCR4) axis was investigated using specific antagonists to elucidate the molecular mechanisms of this combinatorial therapy.
TXYF promoted the in vitro migration of BMSCs. In vivo, the combination of TXYF with BMSCs transplantation alleviated colitis symptoms in rats, improving inflammatory responses, colonic tissue damage, and mucosal barrier function. Our findings suggest that TXYF may enhance the migratory capacity of BMSCs by modulating the SDF-1/CXCR4 axis, thereby increasing their homing to the colonic mucosa.
This study demonstrates that TXYF can enhance the homing efficiency of exogenous BMSCs to the colonic mucosa, likely through the SDF-1/CXCR4 axis, which contributes to the mitigation of experimental colitis.
Core Tip: Bone marrow-derived mesenchymal stem cells (BMSCs) are a promising therapy for ulcerative colitis (UC). However, their clinical use is limited by poor homing to the colonic mucosa. Tongxie Yaofang (TXYF) is a traditional Chinese medicine formula. Our findings indicate that TXYF enhances the homing of BMSCs to the colonic mucosa and ameliorates symptoms of UC. This effect appears to involve modulation of the stromal cell-derived factor 1/C-X-C chemokine receptor type 4 axis. These findings suggest that TXYF may serve as an adjunct strategy to improve the efficacy of BMSCs-based therapy for UC.
- Citation: Gong SS, Li ML, Liu L, Lv B. Tongxie Yaofang enhances the homing efficiency of exogenous bone marrow-derived mesenchymal stem cells to the colonic mucosa and alleviates ulcerative colitis. World J Stem Cells 2026; 18(6): 119228
- URL: https://www.wjgnet.com/1948-0210/full/v18/i6/119228.htm
- DOI: https://dx.doi.org/10.4252/wjsc.119228
Ulcerative colitis (UC) is a chronic, nonspecific inflammatory disorder of the gastrointestinal tract with an incompletely understood etiology. As a subtype of inflammatory bowel disease, UC typically follows a persistent, relapsing-remitting course and is often resistant to treatment. The disease can lead to serious complications, including intestinal perforation, toxic megacolon, and an increased risk of colorectal cancer, all of which can significantly reduce patients’ quality of life and functional status. The global prevalence of UC is estimated to exceed 5 million cases, with incidence rising worldwide[1]. In recent years, advances in biological agents and small-molecule therapies have improved clinical outcomes for UC patients. However, their widespread use is limited by potential adverse effects and high costs. Despite these pharmacological options, substantial therapeutic challenges remain. Clinical trials of induction therapy report remission rates below 30%, falling short of optimal targets[2]. This limited success is largely due to the complex and multifactorial nature of UC pathogenesis. Therefore, there is an urgent need to develop safe and effective alternative therapies for UC.
Mesenchymal stem cells (MSCs) are a heterogeneous population of stromal cells characterized by their self-renewal capacity and potential to differentiate into multiple lineages. MSCs transplantation has emerged as a promising therapeutic strategy for UC, primarily due to their immunosuppressive effects and tissue repair capabilities, which are mediated through three main mechanisms: Immunomodulation, angiogenesis, and regeneration of the intestinal epithelium[3]. Bone marrow-derived MSCs (BMSCs) are a distinct MSCs subtype with pluripotent properties. Compared with MSCs from other tissues, BMSCs exhibit higher proliferative capacity, enhanced self-renewal, low immunogenicity, and minimal risk of teratoma formation after transplantation, making them particularly suitable for clinical applications. Evidence suggests that BMSCs can differentiate into intestinal stem cell-like phenotypes and selectively home to injured colonic mucosa in response to local microenvironmental cues, where they contribute to mucosal regeneration[4]. Despite these advantages, the homing efficiency of exogenously administered BMSCs to sites of intestinal injury remains limited. Effective targeting and engraftment within damaged colonic mucosa are critical determinants of therapeutic success in BMSCs-based treatments for UC.
BMSCs do not inherently express specific homing-associated factors, so their in vivo migration largely depends on external cues, among which chemokines play a central role. C-X-C chemokine ligand 12, also known as stromal cell-derived factor-1 (SDF-1), is involved in regulating inflammatory responses. Its receptor, C-X-C chemokine receptor type 4 (CXCR4), is a key mediator of cellular homing and is highly expressed on the surface of BMSCs[5]. SDF-1 acts as a specific ligand for CXCR4, directing the migration of CXCR4-expressing cells along a concentration gradient. Binding of SDF-1 to CXCR4 enhances the recruitment of BMSCs to injured tissues and significantly improves their homing efficiency[6]. Both in vitro and in vivo studies have shown that the SDF-1/CXCR4 axis is critical for mediating BMSCs homing to multiple tissues, including the ovary[7], bone[8], and brain[9].
Tongxie Yaofang (TXYF) is a traditional Chinese medicine formula clinically used to relieve abdominal pain and diarrhea. In our previous study[10], we found that TXYF effectively alleviates colitis and promotes intestinal mucosal repair in UC. Additionally, our previous in vitro studies also showed that TXYF enhances the migratory capacity of BMSCs. Based on these observations, we aimed to investigate whether TXYF enhances the homing efficiency of transplanted BMSCs to the colonic mucosa, improves therapeutic outcomes in UC, and to explore the underlying mo
All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of the Zhejiang Chinese Medical University (IACUC Protocol No. IACUC-202404-26).
TXYF was prepared from Baizhu (Atractylodes macrocephala Koidz.), Baishao (Paeoniae Radix Alba), Chenpi (Citri Reticulatae Pericarpium), and Fangfeng (Saposhnikovia divaricate) in a ratio of 15:12:6:10. The raw herbs were soaked in eight times their volume of distilled water for 1 hour, followed by two consecutive decoction cycles, each lasting 30 minutes. The aqueous extracts from both boiling cycles were filtered separately, combined, and concentrated under reduced pressure to a 1:1 ratio, corresponding to the original herb concentration. The final preparation was stored at 4 °C until use. The com
| Herb name | Latin name | Major bioactive compounds |
| Baizhu | Atractylodes macrocephala Koidz. | Atractylenolide I, II, III |
| Baishao | Paeoniae Radix Alba | Paeoniflorin |
| Chenpi | Citri Reticulatae Pericarpium | Hesperidin |
| Fangfeng | Saposhnikovia divaricate | 5-O-methylvisamminol and cimifugin |
Male Sprague-Dawley (SD) rats (7 weeks old, 190 ± 10 g) were obtained from Shanghai Xipuer-Bikai Experimental Animal Co., Ltd. (Shanghai, China). The animals were acclimated for one week under controlled conditions, including a 12-hour light/dark cycle, a temperature of 22-24 °C, and relative humidity of 50%-60%, with ambient noise kept below 50 dB. Rats had free access to food and tap water prior to experimentation.
Male SD rats (4 weeks old) were anesthetized with 5% isoflurane and disinfected by immersion in 75% ethanol for 10 minutes. Femurs and tibias were aseptically removed, rinsed three times with phosphate-buffered saline, and the epiphyses were excised to expose the marrow cavity. Bone marrow was flushed using low-glucose Dulbecco’s modified Eagle’s medium supplemented with penicillin and streptomycin, then aspirated to obtain a single-cell suspension. Nucleated cells were isolated by Percoll density gradient centrifugation, resuspended in low-glucose Dulbecco’s modified Eagle’s medium containing 15% fetal bovine serum, adjusted to 1 × 106 cells/mL under microscopic observation, and cultured in a humidified CO2 incubator at 37 °C. The culture medium was fully replaced 48 hours after initial plating and every three days thereafter. Upon reaching 80%-90% confluence, BMSCs were detached using an equal-volume mixture of 0.25% trypsin and 0.02% EDTA under microscopic monitoring and subcultured at a 1:3 ratio (designated as passage 1, P1). When P3 BMSCs reached 60%-70% confluence, osteogenic (RAXMX-90021, OriCell®, China) and adipogenic (RAXMX-90031, OriCell®, China) differentiation media were applied separately. After 20 days of induction, alizarin red (C0148S, Beyotime, Shanghai, China) and Oil red O (C0157S, Beyotime, Shanghai, China) staining were performed to assess osteogenic and adipogenic differentiation, respectively. For immunophenotypic characterization, BMSCs were incubated at room temperature for 30 minutes with fluorochrome-conjugated antibodies against CD29 (ab322405, Abcam, United Kingdom), CD34 (ab81289, Abcam, United Kingdom), CD44 (ab316123, Abcam, United Kingdom), CD45 (ab10558, Abcam, United Kingdom), and CD90 (ab307736, Abcam, United Kingdom), followed by flow cytometric analysis. All procedures were performed according to the manufacturers’ instructions.
To ensure stability and reproducibility, a standardized protocol was followed for preparing TXYF-medicated serum. TXYF was administered to 20 male SD rats (200 ± 20 g) via oral gavage at a dose of 3.9 g/(kg∙day), calculated based on human-to-rat equivalent dose conversion. Rats received the treatment twice daily for five consecutive days to achieve steady-state levels of bioactive metabolites. One hour after the final administration, blood was collected from the abdominal aorta under aseptic conditions. To reduce individual metabolic variability, samples from all donor rats were pooled. Serum was isolated by centrifugation at 3000 rpm for 15 minutes at 4 °C, heat-inactivated at 56 °C for 30 minutes to remove complement activity, and sterile-filtered through a 0.22 μm microporous membrane. The processed serum was aliquoted into 1 mL microcentrifuge tubes and stored at -80 °C. Each aliquot was thawed only once to prevent repeated freeze-thaw cycles. Sterility was confirmed by incubating a portion of the serum in cell culture medium for 48 hours, which showed no signs of contamination. The optimal serum concentration for subsequent experiments was determined by evaluating BMSCs viability using the CCK-8 assay.
To assess the effect of TXYF on BMSCs migration in vitro, cells were divided into two groups: A control group and a TXYF-treated group. BMSCs were incubated with either blank rat serum or TXYF-containing serum for 48 hours. To further investigate whether TXYF regulates BMSCs migration via the SDF-1/CXCR4 axis, BMSCs were assigned to six experimental groups: Control (CON), SDF-1, SDF-1 + AMD3100, AMD3100, TXYF, and TXYF + AMD3100. Each group was treated with recombinant rat SDF-1 (100 ng/mL), AMD3100 (25 μg/mL), or TXYF-containing serum, administered alone or in combination, for 48 hours. Recombinant rat SDF-1 was purchased from Beyotime (Shanghai, China), and AMD3100 was obtained from Dalian Meilun Biotechnology Co., Ltd. (Dalian, Liaoning Province, China).
Wound healing assay: Cells were serum-starved for 24 hours prior to scratch wound induction to synchronize the cell cycle. Once fully adhered and reaching 100% confluence, a vertical scratch was made across the monolayer using a 200 μL pipette tip. Cells were then rinsed twice with serum-free medium to remove debris. Images were captured at this point under an inverted microscope and designated as the 0 hour time point. Cells were incubated in serum-free medium at
Transwell assay: BMSCs were harvested and adjusted to 1 × 106 cells/mL. For mechanistic studies, cells were pretreated with TXYF, the CXCR4 antagonist AMD3100 (25 μg/mL), or their combination for 48 hours prior to seeding. A total of 200 μL of the cell suspension was added to the upper chamber of each well. To establish a chemotactic gradient, 600 μL of serum-free α-MEM containing 100 ng/mL recombinant rat SDF-1 was added to the lower chamber. For the control group, 600 μL of serum-free α-MEM without SDF-1 was used to assess basal motility. After 24 hours of incubation, non-migrated cells on the upper surface were removed with cotton swabs. Migrated cells on the lower surface were fixed with 100% methanol and stained with 0.1% DAPI for 60 minutes. Fluorescence images from three randomly selected fields were captured, and the number of migrated cells was quantified.
To visualize BMSCs, P3 cells were labeled using a cell tracker. Briefly, BMSCs were transduced with lentiviral particles carrying the GFP reporter gene (MISSION® TurboGFP™ Control Vector; Sigma, MO, United States) to generate BMSCs-GFP. The BMSCs-GFP cells were then administered to rats via tail vein injection. At the end of the experiment, intestinal tissues were collected. The presence of BMSCs in the colonic mucosa was examined using a fluorescence microscope, and tissue sections were counterstained with DAPI. BMSCs-GFP cells, marked by GFP and counterstained with DAPI, were quantified at 100 × magnification using ImageJ software. Three randomly selected fields from each representative section were analyzed for cell counting.
After a one-week acclimatization period, rats were randomly assigned to the experimental groups. Colitis was induced by providing 5% dextran sulfate sodium (DSS) in drinking water for 10 consecutive days. From day 11 to day 22, the rats received various treatments including different doses of TXYF, mesalazine, AMD3100, recombinant SDF-1, or exogenous BMSCs according to the experimental protocol. A total of 64 male SD rats were randomly assigned to eight groups to evaluate the therapeutic effects of TXYF combined with exogenous BMSCs in alleviating UC symptoms: CON, DSS, mesalazine (0.27 g/kg/day, oral gavage), low-dose TXYF (TXYF-L, 1.95 g/kg/day, oral gavage), high-dose TXYF (TXYF-H, 3.9 g/kg/day, oral gavage), BMSCs, BMSCs + TXYF-L, and BMSCs + TXYF-H. To further explore how TXYF mo
Intestinal disease activity was assessed based on body weight loss, diarrhea with blood and mucus, and colonic shortening[13]. The disease activity index (DAI) was calculated by scoring three parameters weight loss, diarrhea, and rectal bleeding using a modified version of the system described by Murthy et al[14].
Colon tissues were fixed in 10% neutral-buffered formalin, embedded in paraffin, and processed for hematoxylin and eosin staining to evaluate histology. Histological sections were independently scored by two investigators blinded to the experimental groups, following established criteria[15].
Intestinal permeability was assessed by measuring plasma levels of fluorescein isothiocyanate-dextran (FITC-dextran; 4.0 kDa; Sigma-Aldrich, MO, United States). Blood samples were collected 3 hours after administration, centrifuged at
Total RNA was extracted from rat colon tissues and BMSCs using the SteadyPure Quick RNA Extraction Kit (AG21023; Accurate Biotechnology, Hunan Province, China) according to the manufacturer’s instructions. RNA concentrations were measured with a trace nucleic acid analyzer (Thermo Fisher Scientific, Waltham, MA, United States). Complementary DNA (cDNA) was synthesized by reverse transcription using the Evo M-MLV RT Mix Kit with gDNA Clean for qPCR (Ver. 2; AG11728; Accurate Biotechnology, Hunan Province, China). Quantitative polymerase chain reaction (qPCR) was performed on an ABI 7500 Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, United States). Primer sequences are listed in Table 2. β-actin served as the internal reference gene, and relative mRNA ex
| Gene | Direction | Sequence |
| β-actin | Forward | CTAAGGCCAACCGTGAAAAG |
| Reverse | AACACAGCCTGGATGGCTAC | |
| SDF-1 | Forward | GCCCTTCAGATTGTTGCAAGGC |
| Reverse | TGGGCTGTTGTGCTTACTTGT | |
| CXCR-4 | Forward | TCTGAGGCGTTTGGTGCTC |
| Reverse | GTTTTCATCCCGGAAGCAGG | |
| Claudin-4 | Forward | TTTTCGTGCTCCCCAACCTT |
| Reverse | ATGGGGAGCGAACAACTCAG | |
| ZO-1 | Forward | GATGTTTATGCGGACGGTGG |
| Reverse | CATTGCTGTGCTCTTAGCGG | |
| TNF-α | Forward | GATCGGTCCCAACAAGGAGG |
| Reverse | CTTGGTGGTTTGCTACGACG | |
| IL-6 | Forward | CACTTCACAAGTCGGAGGCT |
| Reverse | GAATTGCCATTGCACAACTCT | |
| IL-1β | Forward | CAGCTTTCGACAGTGAGGAGA |
| Reverse | TGTCGAGATGCTGCTGTGAG |
Total proteins were extracted using RIPA buffer (Beyotime, Shanghai, China). The proteins were separated by sodium-dodecyl sulfate gel electrophoresis, transferred onto polyvinylidene fluoride membranes, and incubated overnight with the following primary antibodies: Claudin-4 (1:2000, Proteintech, China), zonula occludens-1 (ZO-1, 1:5000, Proteintech, China), SDF-1 (1:500, Proteintech, China), CXCR4 (1:500, Proteintech, China), and β-actin (1:4000, Proteintech, China). Membranes were washed three times with Tris-buffered saline containing 0.1% Tween-20 for 10 minutes each. All samples were then incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibody (1:2000, Proteintech, China). Protein bands were visualized using enhanced chemiluminescence reagent. β-actin served as the internal reference. Gel images were captured with a Bio-Rad Gel Doc EZ Imager (Bio-Rad, Hercules, CA, United States), and the gray values of the target bands were quantified using ImageJ software.
The levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and IL-1β were measured using rat-specific ELISA kits (Beyotime, Shanghai, China) according to the manufacturer’s instructions.
Rats were randomly assigned to experimental groups using a random number table. To minimize observer bias, daily DAI scoring and histopathological assessments were performed independently by two investigators blinded to group assignments. Additionally, all molecular analyses, including enzyme linked immunosorbent assay, western blot, and real-time qPCR (RT-qPCR), were performed using coded samples, with group identities revealed only during the final statistical analysis.
All data are presented as mean ± SD and analyzed using GraphPad Prism 9.0. Normality and homogeneity of variance were assessed using the Shapiro-Wilk and Brown-Forsythe tests, respectively. For normally distributed data with equal variances, one-way ANOVA followed by Tukey’s post-hoc test was used for multiple group comparisons. For data with unequal variances, Welch’s ANOVA followed by Dunnett’s T3 post-hoc test was applied. Longitudinal data were analyzed using two-way repeated measures ANOVA followed by Sidak’s multiple comparisons test to assess differences between groups over time. For non-normally distributed data, the Kruskal-Wallis test followed by Dunn’s post-hoc test was used. Statistical significance was defined as P < 0.05.
The BMSCs isolated from rat bone marrow adhered to the culture plate within 48 hours. Under an inverted microscope at 100 × magnification, the cells displayed a long, spindle-shaped morphology with clear polarity, uniform size, and a healthy, full appearance (Figure 1A). To evaluate their differentiation potential, BMSCs were cultured for 20 days in osteogenic and adipogenic induction media, followed by staining with Alizarin red S and Oil red O. Alizarin red S staining revealed calcium-rich mineralized nodules with characteristic deep-red concentric deposits (Figure 1B), in
BMSCs were treated with different concentrations of TXYF-containing serum for 48 hours, and cell proliferation was assessed using the CCK-8 assay. Compared with the control group, 10% TXYF-containing serum significantly enhanced BMSC proliferation (Figure 2A, P < 0.001), and this concentration was therefore used in subsequent in vitro experiments. After pretreatment with 10% TXYF-containing serum for 12 hours, the migration rate of BMSCs was significantly higher than that of the control group (Figure 2B and C, P < 0.001). Similarly, Transwell assays showed that the number of migrated cells in the 10% TXYF-containing serum group was markedly increased compared with the control group (Figure 2D and E, P < 0.001).
To evaluate the therapeutic effects of TXYF combined with exogenous BMSCs in DSS-induced colitis, rats were administered 5% DSS in drinking water for 10 days to induce experimental colitis. Compared with the DSS group, treatment with TXYF-H + BMSCs, TXYF-L + BMSCs, TXYF-H, BMSCs, or mesalazine significantly alleviated colitis symptoms, as shown by reduced body weight loss, lower DAI scores, and less colon shortening (Figure 3A-D). Histopathological analysis of hematoxylin and eosin-stained colon sections revealed severe tissue damage in the DSS group, including extensive inflammatory cell infiltration, crypt destruction, and mucosal erosion. These pathological changes were markedly reduced in the treatment with TXYF-H + BMSCs, TXYF-L + BMSCs, TXYF-H, BMSCs, or mesalazine groups (Figure 3E and F). The interventions also decreased pro-inflammatory cytokine levels. Treatment with TXYF-H + BMSCs, TXYF-L + BMSCs, TXYF-H, BMSCs, or mesalazine groups significantly reduced TNF-α, IL-6, and IL-1β expression in colonic tissues compared with the DSS group (Figure 3G-L).
Intestinal permeability was evaluated by measuring serum FITC-dextran levels. Rats in the DSS group showed significantly elevated serum FITC-dextran concentrations compared with the control group (P < 0.001, Figure 3M), indicating impaired intestinal barrier function. In contrast, treatment with TXYF-H + BMSCs, TXYF-L + BMSCs, TXYF-H, BMSCs, or mesalazine significantly reduced FITC-dextran levels (P < 0.001, Figure 3M), suggesting restoration of barrier integrity. Considering the critical role of tight junction proteins in maintaining the intestinal mucosal barrier, mRNA and protein levels of ZO-1 and claudin-4 in colonic tissues were assessed. Both ZO-1 and claudin-4 were markedly downregulated in the DSS group (P < 0.001, Figure 3N-R), whereas their expression was significantly increased following treatment with TXYF-H + BMSCs, TXYF-L + BMSCs, TXYF-H, BMSCs, or mesalazine (P < 0.05, Figure 3N-R).
Further comparative analysis showed that the TXYF-H + BMSCs group achieved superior improvement in colitis symptoms and intestinal barrier restoration compared with the TXYF-L + BMSCs, TXYF-H, BMSCs, or mesalazine groups (P < 0.05, Figure 3). Based on these results, a high dose of TXYF was chosen for the subsequent in vivo mechanistic study. Notably, comparison between the TXYF-H monotherapy group and the TXYF-H + BMSCs combination group revealed that the latter exhibited significantly greater therapeutic efficacy. Specifically, the combination treatment resulted in: (1) Further reduction in body weight loss; (2) Lower DAI scores; (3) Less colon shortening; (4) Significantly decreased colonic concentrations of pro-inflammatory cytokines, including TNF-α, IL-6, and IL-1β; and (5) More robust restoration of colonic mucosal barrier integrity, compared with TXYF-H alone (P < 0.001). These findings indicate that while TXYF-H alone provides a foundational therapeutic benefit, its combination with BMSCs markedly enhances both regenerative and anti-inflammatory effects.
TXYF induces the migration of BMSCs via SDF-1/CXCR4 axis in vitro
SDF-1 and AMD3100, a specific CXCR4 antagonist, were used in Transwell assays to further investigate the role of the SDF-1/CXCR4 axis in TXYF-induced BMSC migration in vitro. Compared with the control group, both TXYF and SDF-1 treatments significantly enhanced BMSC migration, as evidenced by a marked increase in the number of cells traversing the membrane (P < 0.001; Figure 4A-D), with no significant difference between the two groups. In contrast, treatment with AMD3100 alone markedly inhibited both the migratory capacity and the number of migrated BMSCs (P < 0.001; Figure 4A-D). Co-treatment with AMD3100 and either TXYF or SDF-1 also significantly reduced migration rates and the number of migrated cells compared with TXYF or SDF-1 alone (P < 0.001; Figure 4A-D), indicating that AMD3100 attenuates the pro-migratory effects of both TXYF and SDF-1. The mRNA and protein expression levels of SDF-1 and CXCR4 in rat BMSCs were evaluated using RT-qPCR and western blotting. Both TXYF and SDF-1 treatments significantly upregulated SDF-1 and CXCR4 at the mRNA and protein levels compared with the control group. Conversely, AMD3100 treatment markedly downregulated the expression of these markers. Furthermore, the TXYF + AMD3100 and SDF-1 + AMD3100 groups showed significantly lower SDF-1 and CXCR4 expression compared with the TXYF and SDF-1 groups, respectively (Figure 4E-I). Collectively, these results demonstrate that TXYF promotes BMSCs migration in vitro via activation of the SDF-1/CXCR4 signaling pathway.
To confirm the role of the SDF-1/CXCR4 axis in the therapeutic effects of TXYF on BMSC homing and UC symptom relief, rats with DSS-induced colitis received daily intraperitoneal injections of SDF-1 from day 11 to day 22, along with tail vein infusions of AMD3100-pretreated BMSCs on days 11, 14, 17, and 20. As expected, treatment with TXYF or SDF-1 combined with BMSCs significantly mitigated disease progression. This was evidenced by reduced body weight loss (P < 0.001; Figure 5A), lower DAI scores (P < 0.001; Figure 5B), less colon shortening (P < 0.001; Figure 5C and D), improved histological outcomes (P < 0.001; Figure 5E and F), decreased colonic pro-inflammatory cytokine levels (P < 0.001; Figure 5G-L), and restoration of intestinal barrier integrity, as indicated by reduced colonic mucosal permeability (P < 0.001; Figure 5M-R). The therapeutic effect of TXYF + BMSCs was superior to BMSCs alone, but comparable to the SDF-1 + BMSCs group, with no statistically significant difference between them.
Assessment of BMSCs homing to the colonic mucosa revealed that both SDF-1 + BMSCs and TXYF + BMSCs significantly increased cell recruitment compared with BMSCs alone, with no significant difference between the two treatment groups (Figure 6). However, when BMSCs were pretreated with AMD3100, the protective effects of both SDF-1 + BMSCs and TXYF + BMSCs were abolished, and BMSC homing to inflamed colonic tissue was markedly reduced. These results indicate that TXYF enhances BMSC homing to the colonic mucosa and alleviates UC-like symptoms in DSS-induced colitis, likely via modulation of the SDF-1/CXCR4 signaling pathway (Figure 5S-W).
Excessive colorectal inflammation and disruption of intestinal mucosal integrity are hallmark features of UC[16]. After mucosal injury, partial repair can occur through the proliferation and differentiation of intestinal epithelial cells. MSCs are a heterogeneous population of stromal cells with self-renewal and multilineage differentiation capacities. Due to their immunomodulatory effects and regenerative potential, MSC transplantation has become one of the most promising therapeutic approaches for UC[17]. In recent years, numerous preclinical studies have shown that MSCs promote colonic repair in animal models of UC[18-21].
BMSCs are a distinct subset of MSCs with pluripotent characteristics. Compared with MSCs from other tissue sources, BMSCs demonstrate stronger proliferative capacity, rapid self-renewal, low immunogenicity, and minimal risk of teratoma formation after transplantation[22]. These advantages make BMSCs highly attractive for therapeutic use. Importantly, BMSCs have been proposed as a potential treatment for UC. Evidence from animal studies[19,23,24] and clinical trials[25-27] indicates that BMSCs can reduce pro-inflammatory cytokine levels and promote repair of damaged colonic mucosa. However, a key limitation remains the low efficiency of BMSCs homing to colonic mucosal tissue. The need for repeated administration reduces clinical feasibility, especially given the high cost of large-dose BMSCs therapy. Therefore, it is essential to further clarify the molecular mechanisms that regulate BMSCs homing to the colon and to develop strategies that enhance their targeted migration and engraftment.
Previous studies have shown that traditional Chinese medicine has unique therapeutic benefits in the management of UC. TXYF, a classical herbal formula first recorded in *Jingyue Quan Shu* (*Jingyue’s Complete Book*), consists of four main components: Rhizoma Atractylodis Macrocephalae, Radix Paeoniae Alba, Pericarpium Citri Reticulatae, and Radix Saposhnikoviae. Our previous study[10] demonstrated that TXYF promotes the migration and proliferation of intestinal epithelial cells in UC and inhibits apoptosis. These effects help maintain intestinal barrier integrity and facilitate mucosal healing. In the present study, we further investigated the synergistic effects of TXYF combined with BMSCs in the treatment of UC.
BMSCs were isolated from rat bone marrow and cultured in vitro to the third passage for subsequent experiments. Flow cytometry showed that the third-passage cells expressed typical rat BMSCs surface markers, including CD29+, CD90+, and CD44+, while lacking CD34 and CD45 expression. In addition, these cells retained multilineage differentiation capacity, as confirmed by adipogenic and osteogenic differentiation under specific induction conditions. In vitro Transwell and scratch assays demonstrated that TXYF enhanced the migratory ability of rat BMSCs. In vivo, combined treatment with TXYF and BMSCs markedly alleviated DSS-induced colitis in rats. This was reflected by increased body weight, reduced DAI and histological scores, less colon shortening, and decreased production of pro-inflammatory cytokines. Furthermore, the therapeutic effect of the combination therapy was superior to that of mesalazine, BMSCs alone, or TXYF alone.
Intestinal barrier dysfunction plays a critical role in the pathogenesis of UC[28]. Strategies that restore and maintain barrier integrity are therefore essential for effective disease control and mucosal healing. In the present study, the combination of TXYF and BMSCs significantly reduced colonic mucosal permeability in rats with UC and increased the expression of the tight junction proteins ZO-1 and claudin-4. The therapeutic effect was superior to that of mesalazine, TXYF alone, or BMSCs alone. These findings highlight the potential of combined TXYF and BMSCs therapy in promoting intestinal mucosal barrier repair in UC. To evaluate BMSCs homing efficiency, BMSCs were labeled with GFP and administered intravenously via the tail vein. The number of GFP-positive cells in colon tissue was then quantified by fluorescence microscopy. Compared with the BMSCs-only group, significantly more BMSCs were detected in the colonic mucosa of UC rats treated with TXYF plus BMSCs. This indicates that TXYF enhances BMSCs migration to the colonic mucosa. These results are consistent with previous reports by Cui et al[24] and Liu et al[23].
Because BMSCs lack intrinsic homing-specific factors, their in vivo homing efficiency is regulated by multiple mechanisms, among which chemokine-mediated signaling is critical. SDF-1 is widely recognized as a key regulator of the migration and homing of CXCR4-positive stem cells to sites of tissue injury[29]. Previous studies have shown that SDF-1 acts as an important cytokine that modulates local inflammatory responses and promotes tissue repair by recruiting BMSCs to damaged organs and tissues[7,9,30]. BMSCs migration is largely driven by the SDF-1 concentration gradient[31]. CXCR4, the specific receptor for SDF-1, is highly expressed on the surface of BMSCs and plays an essential role in their mobilization and recruitment[32]. The interaction between SDF-1 and CXCR4 directs the targeted migration of BMSCs to injured tissues[33,34]. In the present study, we found that TXYF upregulated SDF-1 expression in the colonic tissues of rats. Previous reports have demonstrated that the SDF-1/CXCR4 axis mediates BMSCs homing to the ovary[7], bone[8], and brain[9]. Based on these findings, we propose that TXYF enhances the homing of exogenous BMSCs to the colonic mucosa through activation of the SDF-1/CXCR4 axis, thereby contributing to the alleviation of UC.
We verified this hypothesis through both in vitro and in vivo experiments. In vitro, TXYF and SDF-1 each significantly promoted BMSCs migration, and no significant difference was observed between the two treatments. After exposure to AMD3100, a specific CXCR4 inhibitor, the ability of TXYF and SDF-1 to enhance BMSCs migration was markedly reduced. In vivo studies further showed that combined administration of TXYF or SDF-1 with GFP-labeled BMSCs significantly alleviated UC symptoms and increased BMSCs homing to the colonic mucosa in rats. However, when TXYF or SDF-1 was given together with AMD3100-pretreated BMSCs, the therapeutic effect was attenuated, and BMSCs migration to the colonic mucosa was markedly decreased.
Notably, the TXYF + BMSCs group demonstrated significantly greater therapeutic efficacy than the TXYF monotherapy group. This finding indicates that exogenous BMSCs are an essential component of the TXYF-based treatment strategy. The synergistic effect indicates that TXYF not only exerts direct anti-inflammatory activity but also modulates exogenously BMSCs to promote tissue repair and regeneration. Mechanistically, TXYF activates the SDF-1/CXCR4 signaling axis and promotes targeted BMSCs homing to inflamed colonic mucosa. In this microenvironment, BMSCs act together with the bioactive components of TXYF to restore intestinal mucosal homeostasis. The observation that the CXCR4 antagonist AMD3100 markedly reduced the therapeutic benefits of the TXYF + BMSCs group further confirms the critical role of this signaling pathway in TXYF-mediated enhancement of stem cell therapy. These results have strong potential relevance to human UC treatment, particularly in enhancing cell-therapy efficacy.
This study has several limitations. First, although TXYF was prepared according to standardized procedures and established references, no analytical quality control assessment was performed. Future studies will incorporate batch-to-batch chemical profiling, including quantitative analysis of marker compounds, to improve reproducibility and ensure consistent pharmacological activity. Second, while TXYF significantly enhanced the homing of exogenous BMSCs, the long-term survival and differentiation fate of these cells within the colonic niche were not fully determined due to limitations in current cell-tracking methods. Third, as a complex herbal formula, TXYF likely exerts its effects through multiple targets and pathways. Although our data highlight the key role of the SDF-1/CXCR4 axis in mediating BMSCs homing, as supported by the inhibitory effect of AMD3100, the involvement of additional signaling pathways cannot be excluded. Future research should further explore other mechanisms by which TXYF enhances BMSCs homing to provide a more comprehensive understanding of its pharmacological actions.
In conclusion, our results indicate that the combination of TXYF and BMSCs alleviates the manifestations of experimental colitis and produces greater therapeutic benefits than either treatment alone under the present conditions. This enhanced efficacy is likely attributable, at least in part, to the capacity of TXYF to promote BMSCs homing to the colonic mucosa through activation of the SDF-1/CXCR4 axis.
| 1. | Dubinsky M, Bleakman AP, Panaccione R, Hibi T, Schreiber S, Rubin D, Dignass A, Redondo I, Gibble TH, Kayhan C, Travis S. Bowel Urgency in Ulcerative Colitis: Current Perspectives and Future Directions. Am J Gastroenterol. 2023;118:1940-1953. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 49] [Reference Citation Analysis (0)] |
| 2. | Alsoud D, Verstockt B, Fiocchi C, Vermeire S. Breaking the therapeutic ceiling in drug development in ulcerative colitis. Lancet Gastroenterol Hepatol. 2021;6:589-595. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 187] [Cited by in RCA: 166] [Article Influence: 33.2] [Reference Citation Analysis (1)] |
| 3. | Guo G, Tan Z, Liu Y, Shi F, She J. The therapeutic potential of stem cell-derived exosomes in the ulcerative colitis and colorectal cancer. Stem Cell Res Ther. 2022;13:138. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 114] [Cited by in RCA: 115] [Article Influence: 28.8] [Reference Citation Analysis (1)] |
| 4. | Tian CM, Zhang Y, Yang MF, Xu HM, Zhu MZ, Yao J, Wang LS, Liang YJ, Li DF. Stem Cell Therapy in Inflammatory Bowel Disease: A Review of Achievements and Challenges. J Inflamm Res. 2023;16:2089-2119. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 43] [Cited by in RCA: 44] [Article Influence: 14.7] [Reference Citation Analysis (2)] |
| 5. | Gao J, Liang Y, Chen J, Shen H, Liu H. CXCR4 enhances the inhibitory effects of bone mesenchymal stem cells on lung cell apoptosis in a rat model of smoking-induced COPD. Apoptosis. 2023;28:639-652. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 11] [Reference Citation Analysis (0)] |
| 6. | Han R, Zhou H, Liang X, He S, Sun X, Guan Y, Song Y. Thermo-sensitive ε-polylysine-heparin-poloxamer hydrogel-encapsulated BMSCs promote endometrial regeneration. Mater Today Bio. 2025;31:101580. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 7] [Reference Citation Analysis (0)] |
| 7. | Ling L, Hou J, Liu D, Tang D, Zhang Y, Zeng Q, Pan H, Fan L. Important role of the SDF-1/CXCR4 axis in the homing of systemically transplanted human amnion-derived mesenchymal stem cells (hAD-MSCs) to ovaries in rats with chemotherapy-induced premature ovarian insufficiency (POI). Stem Cell Res Ther. 2022;13:79. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 72] [Reference Citation Analysis (1)] |
| 8. | Zhang H, Li X, Li J, Zhong L, Chen X, Chen S. SDF-1 mediates mesenchymal stem cell recruitment and migration via the SDF-1/CXCR4 axis in bone defect. J Bone Miner Metab. 2021;39:126-138. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 56] [Cited by in RCA: 55] [Article Influence: 11.0] [Reference Citation Analysis (0)] |
| 9. | Ma S, Zhou J, Huang T, Zhang Z, Xing Q, Zhou X, Zhang K, Yao M, Cheng T, Wang X, Wen X, Guan F. Sodium alginate/collagen/stromal cell-derived factor-1 neural scaffold loaded with BMSCs promotes neurological function recovery after traumatic brain injury. Acta Biomater. 2021;131:185-197. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 14] [Cited by in RCA: 55] [Article Influence: 11.0] [Reference Citation Analysis (0)] |
| 10. | Gong SS, Fan YH, Wang SY, Han QQ, Lv B, Xu Y, Chen X, He YE. Mucosa repair mechanisms of Tong-Xie-Yao-Fang mediated by CRH-R2 in murine, dextran sulfate sodium-induced colitis. World J Gastroenterol. 2018;24:1766-1778. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in CrossRef: 20] [Cited by in RCA: 16] [Article Influence: 2.0] [Reference Citation Analysis (0)] |
| 11. | Li TX, Hu L, Zhang MM, Sun J, Qiu Y, Rui JQ, Yang XH. A sensitive UPLC-MS/MS method for simultaneous determination of eleven bioactive components of Tong-Xie-Yao-Fang decoction in rat biological matrices. J Chromatogr B Analyt Technol Biomed Life Sci. 2014;944:90-100. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 16] [Cited by in RCA: 17] [Article Influence: 1.3] [Reference Citation Analysis (0)] |
| 12. | Peng SQ, Yan ZH, Xiang RQ, Xiong Q, Zhang C, Ning J, Zhang X, Zhu GH. [Chemical Constituent Analysis of Tongxie Yaofang Decoction by UPLC-LTQ-Orbitrap-MS]. Zhongguo Shiyan Fangjixue Zazhi. 2023;29:183-191. [DOI] [Full Text] |
| 13. | Hendrickson BA, Gokhale R, Cho JH. Clinical aspects and pathophysiology of inflammatory bowel disease. Clin Microbiol Rev. 2002;15:79-94. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 485] [Cited by in RCA: 412] [Article Influence: 17.2] [Reference Citation Analysis (1)] |
| 14. | Murthy SN, Cooper HS, Shim H, Shah RS, Ibrahim SA, Sedergran DJ. Treatment of dextran sulfate sodium-induced murine colitis by intracolonic cyclosporin. Dig Dis Sci. 1993;38:1722-1734. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 409] [Cited by in RCA: 464] [Article Influence: 14.1] [Reference Citation Analysis (0)] |
| 15. | Dieleman LA, Palmen MJ, Akol H, Bloemena E, Peña AS, Meuwissen SG, Van Rees EP. Chronic experimental colitis induced by dextran sulphate sodium (DSS) is characterized by Th1 and Th2 cytokines. Clin Exp Immunol. 1998;114:385-391. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 946] [Cited by in RCA: 972] [Article Influence: 34.7] [Reference Citation Analysis (5)] |
| 16. | Le Berre C, Honap S, Peyrin-Biroulet L. Ulcerative colitis. Lancet. 2023;402:571-584. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1251] [Cited by in RCA: 1247] [Article Influence: 415.7] [Reference Citation Analysis (5)] |
| 17. | Eiro N, Fraile M, González-Jubete A, González LO, Vizoso FJ. Mesenchymal (Stem) Stromal Cells Based as New Therapeutic Alternative in Inflammatory Bowel Disease: Basic Mechanisms, Experimental and Clinical Evidence, and Challenges. Int J Mol Sci. 2022;23:8905. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 54] [Reference Citation Analysis (0)] |
| 18. | Luo X, Deng J, Jiang X, Mi J, Bai Y, Zhang H, Li Y, Liu M, Cai C, Li P, Huang H, Xu Y, Qin Y, Mi Y, Ding H, Yang Z, Wu Y, Li Z, Lan L, Zhang L, Wang L, Chen G, Yue H, Luo OJ, Zhang B. Reconstitution of T cell-mediated immunity by umbilical cord-derived mesenchymal stem cells in ulcerative colitis. Clin Transl Med. 2025;15:e70452. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 4] [Cited by in RCA: 3] [Article Influence: 3.0] [Reference Citation Analysis (0)] |
| 19. | Wang K, Liu F, Deng J, Peng J, Wang M, Zhou H, Xu Y, Li F, Ouyang M. Bone marrow mesenchymal stem cell-derived circHECTD1 targets claudin1 through the CTCF/METTL3 axis to alleviate ulcerative colitis : Short title: BMSC-derived circHECTD1 alleviates UC. Cell Mol Life Sci. 2025;83:41. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 5] [Reference Citation Analysis (0)] |
| 20. | Ho CT, Kao YC, Shyu YM, Wang IC, Liu QX, Liu SW, Huang SC, Chiu H, Hsu LW, Hsu TS, Hsieh WC, Huang CC. Assembly of MSCs into a spheroid configuration increases poly(I:C)-mediated TLR3 activation and the immunomodulatory potential of MSCs for alleviating murine colitis. Stem Cell Res Ther. 2025;16:172. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 7] [Reference Citation Analysis (1)] |
| 21. | Li L, Lam I, Wang J, Yu H, Chan C, Cai S. Epigenetic mechanism of iPSC-MSC-EVs in colonic epithelial cell pyroptosis in ulcerative colitis cell models via modulation of ELF3/miR-342-3p/KDM6B axis and histone methylation. Int Immunopharmacol. 2025;157:114704. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 9] [Reference Citation Analysis (0)] |
| 22. | Yu T, Chu S, Liu X, Li J, Chen Q, Xu M, Wu H, Li M, Dong Y, Zhu F, Zhou H, Hu D, Fan H. Extracellular vesicles derived from EphB2-overexpressing bone marrow mesenchymal stem cells ameliorate DSS-induced colitis by modulating immune balance. Stem Cell Res Ther. 2021;12:181. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 6] [Cited by in RCA: 25] [Article Influence: 5.0] [Reference Citation Analysis (0)] |
| 23. | Liu XP, Cui GN, Li PQ, Dong JG, Zeng QT. [Effects of Shenling Baizhu Powder and Tongxie Yaofang on the growth and proliferation of BMSCs from bone marrow and peripheral blood in rats with ulcerative colitis]. Zhonghua Zhongyiyao Zazhi. 2020;35:368-372. |
| 24. | Cui ST, Liu XP, Cui GN, Li PQ, Zeng QT. [Effect of Shenlingbaizhu powder and Tongxie Yaofang on homing of BMSCs to colonic mucosa in rats with ulcerative colitis]. Zhongchengyao. 2020;42:480-484. [DOI] [Full Text] |
| 25. | Lazebnik LB, Kniazev OV, Konopliannikov AG, Parfenov AI, Ruchkina IN, Mikhaĭlova ZF, Tsaregorodtseva TM, Khomeriki SG, Rogozina VA, Gudkova RB, Shcherbakov PL, Konopliannikova OA. [Allogeneic mesenchymal stromal cells in patients with ulcerative colitis: two years of observation]. Eksp Klin Gastroenterol. 2010;3-15. [PubMed] |
| 26. | Lazebnik LB, Kniazev OV, Parfenov AI, Ruchkina IN, Rogozina VA, Konopliannikov AG. [Transplantation of allogeneic mesenchymal stem cells from the bone marrow increases duration of remission and reduces the risk of ulcerative colitis relapse]. Eksp Klin Gastroenterol. 2010;5-10. [PubMed] |
| 27. | Xiang H, Zhang X, Yang C, Xu W, Ge X, Zhang R, Qiu Y, Sun W, Li F, Xiang T, Chen H, Wang Z, Zeng Q. Autologous bone marrow stem cell transplantation for the treatment of ulcerative colitis complicated with herpes zoster: a case report. Front Med. 2016;10:522-526. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3] [Cited by in RCA: 4] [Article Influence: 0.4] [Reference Citation Analysis (0)] |
| 28. | Neurath MF, Vieth M. Different levels of healing in inflammatory bowel diseases: mucosal, histological, transmural, barrier and complete healing. Gut. 2023;72:2164-2183. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 117] [Cited by in RCA: 115] [Article Influence: 38.3] [Reference Citation Analysis (1)] |
| 29. | Cui H, Li Z, Chen S, Li X, Chen D, Wang J, Li Z, Hao W, Zhong F, Zhang K, Zheng Z, Zhan Z, Liu H. CXCL12/CXCR4-Rac1-mediated migration of osteogenic precursor cells contributes to pathological new bone formation in ankylosing spondylitis. Sci Adv. 2022;8:eabl8054. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 5] [Cited by in RCA: 34] [Article Influence: 8.5] [Reference Citation Analysis (0)] |
| 30. | Sun Y, Fang Y, Li X, Li J, Liu D, Wei M, Liao Z, Meng Y, Zhai L, Yokota H, Yang L, Yu Y, Zhang P. A static magnetic field enhances the repair of osteoarthritic cartilage by promoting the migration of stem cells and chondrogenesis. J Orthop Translat. 2023;39:43-54. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 24] [Reference Citation Analysis (0)] |
| 31. | Wang X, Wang C, Gou W, Xu X, Wang Y, Wang A, Xu W, Guo Q, Liu S, Lu Q, Meng H, Yuan M, Peng J, Lu S. The optimal time to inject bone mesenchymal stem cells for fracture healing in a murine model. Stem Cell Res Ther. 2018;9:272. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 53] [Cited by in RCA: 50] [Article Influence: 6.3] [Reference Citation Analysis (0)] |
| 32. | Fu X, Liu G, Halim A, Ju Y, Luo Q, Song AG. Mesenchymal Stem Cell Migration and Tissue Repair. Cells. 2019;8:784. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 846] [Cited by in RCA: 769] [Article Influence: 109.9] [Reference Citation Analysis (4)] |
| 33. | Ma J, Ni Z, Chen Q, Ma F, Shan C, Wu Y, Li W, Miao X, Wang X, Lin Y. Exploring the kidney-tonifying effect of Qi-Xian decoction for asthma treatment by modulating the proliferation and migration of endogenous BMSCs. Chin J Nat Med. 2025;23:100009. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 1] [Reference Citation Analysis (0)] |
| 34. | Kun W, Xiaomei C, Lei Y, Huizhi Z. Modulating Th1/Th2 drift in asthma-related immune inflammation by enhancing bone mesenchymal stem cell homing through targeted inhibition of the Notch1/Jagged1 signaling pathway. Int Immunopharmacol. 2024;130:111713. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 11] [Reference Citation Analysis (0)] |