Conservation and variability of hepatitis B core at different chronic hepatitis stages

Table 1 Primer design and polymerase chain reaction protocols for each amplified region

	PCR	Primer	Primer sequence (5'- > 3')	Amplified region	Protocol
1st step	PCR1	Forward	TAGGAGGCTGTAGGCATA	1774-2930	95 ºC 5 min; (95ºC 20 s, 49 ºC 20 s, 72 ºC 15 s) × 35 cycles; 72 ºC 3 min
		Reverse	GGAAAGAATCCCAGAGG
2nd step	PCR2 A.1	Forward A.1	GTTGTAAAACGACGGCCAGTTTCAAGCCTCCAAGCTGT	1863-2317	95 ºC 2 min; (95 ºC 20 s, 58 ºC 20 s, 72 ºC 15s ) × 35 cycles; 72 ºC 3 min
		Reverse A.1	CACAGGAAACAGCTATGACCGATAGGGGCATTTGGTGGTCT
	PCR2 A.2	Forward1 A.2	GTTGTAAAACGACGGCCAGTGGTTTCATATTTCTTGCC	2205-2483	95 ºC 2 min; (95 ºC 20 s, 50 ºC 20 s, 72 ºC 15 s) × 35 cycles; 72 ºC 3 min
		Forward2 A.2	GTTGTAAAACGACGGCCAGTGGTTTCACATTTCCTGTC
		Forward3 A.2	GTTGTAAAACGACGGCCAGTGGTTTCACATTTCTTGTC
		Forward4 A.2	GTTGTAAAACGACGGCCAGTGGTTTCACATTTCCTGCC
		Reverse A.2	CACAGGAAACAGCTATGACCTCCCACCTTATGAGTCCAAG
3rd step	PCR3	Forward (specific per sample)	GTTGTAAAACGACGGCCAGT+specific 10 nt MID		95 ºC 2 min; (95 ºC 20 s, 60 ºC 20 s, 72 ºC 15 s) × 20 cycles; 72 ºC 3 min
		Reverse (specific per sample)	CACAGGAAACAGCTATGACC+specific 10 nt MID

Bold nucleotides indicate the M13 sequence. Forward primers in PCR2-A2 were multiplexed at the same concentration to cover all HBV genotypes. The protocols of amplification are reported. A.1: Amplicon 1; A.2: Amplicon 2; PCR: Polymerase chain reaction; MID: Multiplex identifier.

Table 2 Main clinical and viral characteristics of hepatitis B virus-infected patients enrolled in the study

Median [IQR]	CHB (n = 16)	HCC (n = 17)	LC (n = 5)	P value
Age	38.5 [33.5-46.5]	67 [58-69]	56 [48-66]	0.002
Viral load (log IU/mL)	6.8 [5.7-8.0]	5.5 [4.7-6.7]	5.7 [4.8-6.2]	NS
ALT	56.5 [41.25-180.5]	70 [47-212]	46 [43-79]	NS
AST	56 [34.75-124]	120.5 [59-163.5]	66.45 [48.675-84.225]	NS
Platelets (109/L)	183 [161.5-226]	136 [98.5-255]	81.5 [61.25-101.75]	NS
Proportion
Gender (male)	11/16	15/17	3/5
HBeAg (positive)	8/16	3/17	0/5
Genotype, % (n)
A	18.8 (3)	5.9 (1)	20.0 (1)
C	37.5 (6)	5.9 (1)	20.0 (1)
D	25.0 (4)	64.7 (11)	40.0 (2)
D/A	(0)	5.9 (1)	0.0 (0)
D/E	6.3 (1)	11.8 (2)	0.0 (0)
E	6.3 (1)	0.0 (0)	20.0 (1)
F	6.3 (1)	5.9 (1)	0.0 (0)

D/E and D/A indicate mixtures of the 2 genotypes. The frequency of each genotype within the clinical groups is reported as percentage (%) and number of patients (n). CHB: Chronic hepatitis B infection without liver damage; HCC: Hepatocellular carcinoma; LC: Liver cirrhosis; ALT: Alanine aminotransferase (normal value < 40 IU/mL); AST: Aspartate aminotransferase (normal value < 40 IU/mL); IQR: Interquartile range; NS: No-statistical P value.

Table 3 Relative frequencies of nucleotide insertions/deletions detected

Clinical stage (n/total)	Patient	Relative frequency (% of mutated haplotypes)
		1951 (1 nt: T)	2085 (1 nt: G)
CHB (8/16)	1	8.36 (8.7)
	2		17.12 (40)
	3		3.19 (5)
	4	0.37 (5.9)
	9	2.02 (8.82)
	10		1.34 (50)
	12		1.04 (10)
	13	2.79 (22.22)
HCC (2/17)	28		0.78 (4)
	33		2.42 (4.8)
LC (1/5)	34		17.42 (19.2)

The table shows the relative frequency of insertions/deletions, together with the percentage (%) of mutated haplotypes per patient. Only patients carrying these mutations were included in the table. CHB: Chronic hepatitis B infection without liver damage; HCC: Hepatocellular carcinoma; LC: Liver cirrhosis; T: Thymine; G: Guanine; nt: Nucleotide.