Lysyl oxidase and hypoxia-inducible factor 1α: biomarkers of gastric cancer

Table 1 Primer sequences

Target gene		Primer sequences
HIF1α	Forward	CATAAAGTCTGCAACATGGAAGGT
	Reverse	ATTTGATGGGTGAGGAATGGGTT
LOX	Forward	CAGGCACCGACCTGGATATGG
	Reverse	CGTACGTGGATGCCTGGATGTAGT
β-actin	Forward	TGGCACCCAGCACAATGAA
	Reverse	CTAAGTCATAGTCCGCCTAGAAGCA

Table 2 Relationship between lysyl oxidase and clinicopathological factors in patients with gastric cancer

Characteristics	Sample size, n	LOX		P
		Low expression (%)	High expression (%)
Gender		90 (64.3)	50 (35.7)
Male	112	73 (65.2)	39 (34.8)	0.659
Female	28	17 (60.7)	11 (39.3)
Age
< 60 yr	67	44 (65.7)	23 (34.3)	0.743
≥ 60 yr	73	46 (63.0)	27 (37.0)
Tumor location
Upper part	57	37 (64.9)	20 (35.1)	0.978
Middle part	34	21 (61.8)	13 (38.2)
Lower part	44	29 (65.9)	15 (34.1)
Total stomach	5	3 (60.0)	2 (40.0)
Tumor size
< 5 cm	57	39 (68.4)	18 (31.6)	0.397
≥ 5 cm	83	51 (61.4)	32 (38.6)
Depth of invasion
T1	5	5 (100.0)	0 (0.0)	0.005
T2	13	12 (92.3)	1 (7.7)
T3	85	56 (65.9)	29 (34.1)
T4	37	17 (45.9)	20 (54.1)
Lymphatic metastasis
0	34	33 (97.1)	1 (2.9)	0.000
1-2	32	24 (75.0)	8 (25.0)
3-6	31	21 (67.7)	10 (32.3)
7-15	37	12 (32.4)	25 (67.6)
≥ 16	6	0 (0.0)	6 (100.0)
Borrmann classification
Type I	16	12 (75.0)	4 (25.0)	0.340
Type II or III	110	67 (60.9)	43 (39.1)
Type IV	11	8 (72.7)	3 (27.3)
Type V	3	3 (100.0)	0 (0.0)
WHO histological classification
Adenocarcinoma	77	48 (62.3)	29 (37.7)	0.862
Signet-ring cell carcinoma	17	13 (76.5)	4 (23.5)
Mucinous adenocarcinoma	8	5 (62.5)	3 (37.5)
Mixed carcinoma	32	20 (62.5)	12 (37.5)
Neuroendocrine carcinoma	6	4 (66.7)	2 (33.3)
Lauren parting
Intestinal type	65	42 (64.6)	23 (35.4)	0.909
Diffuse type	68	43 (63.2)	25 (36.8)
Mixed type	7	5 (71.4)	2 (28.6)
Differentiation grade
Low and middle	107	68 (63.6)	39 (36.4)	0.744
High	33	22 (66.7)	11 (33.3)
Cancer embolus
Yes	51	29 (56.9)	22 (43.1)	0.165
No	89	61 (68.5)	28 (31.5)
Affect neural
Yes	50	29 (58.0)	21 (42.0)	0.247
No	90	61 (67.8)	29 (32.2)
TNM staging
I	10	10 (100.0)	0 (0.0)	0.000
II	49	44 (89.8)	5 (10.2)
III	81	36 (44.4)	45 (55.6)

LOX: Lysyl oxidase; WHO: Word Health Organization; TNM: Tumor-node-metastasis.

Table 3 Relationship between hypoxia-inducible factor 1α and clinicopathological factors in patients with gastric cancer

Characteristics	Sample size, n	HIF1α		P
		Low expression (%)	High expression (%)
Gender		93 (66.4)	47 (33.6)
Male	112	76 (67.9)	36 (32.1)	0.474
Female	28	17 (60.7)	11 (39.3)
Age
< 60 yr	67	47 (70.1)	20 (29.9)	0.372
≥ 60 yr	73	46 (63.0)	27 (37.0)
Tumor location
Upper part	57	41 (71.9)	16 (28.1)	0.702
Middle part	34	19 (55.9)	15 (44.1)
Lower part	44	30 (68.2)	14 (31.8)
Total stomach	5	3 (60.0)	2 (40.0)
Tumor size
< 5 cm	57	41 (71.9)	16 (28.1)	0.253
≥ 5 cm	83	52 (62.7)	31 (37.3)
Depth of invasion
T1	5	5 (100.0)	0 (0.0)	0.001
T2	13	12 (92.3)	1 (7.7)
T3	85	60 (70.6)	25 (29.4)
T4	37	16 (43.2)	21 (56.8)
Lymphatic metastasis
0	34	29 (85.3)	5 (14.7)	0.000
1-2	32	24 (75.0)	8 (25.0)
3-6	31	23 (74.2)	8 (25.8)
7-15	37	17 (45.9)	20 (54.1)
≥ 16	6	0 (0.0)	6 (100.0)
Borrmann classification
Type I	16	11 (68.8)	5 (31.2)	0.183
Type II or III	110	76 (69.1)	34 (30.9)
Type IV	11	4 (36.4)	7 (63.6)
Type V	3	2 (66.7)	1 (33.3)
WHO histological classification
Adenocarcinoma	77	55 (71.4)	22 (28.6)	0.725
Signet-ring cell carcinoma	17	12 (70.6)	5 (29.4)
Mucinous adenocarcinoma	8	6 (75.0)	2 (25.0)
Mixed carcinoma	32	20 (62.5)	12 (37.5)
Neuroendocrine carcinoma	6	4 (66.7)	2 (33.3)
Lauren parting
Intestinal type	65	42 (64.6)	23 (35.4)	0.155
Diffuse type	68	44 (64.7)	24 (35.3)
Mixed type	7	7 (100.0)	0 (0.0)
Differentiation grade
Low and middle	107	72 (67.3)	35 (32.7)	0.698
High	33	21 (63.6)	12 (36.4)
Cancer embolus
Yes	51	32 (62.7)	19 (37.3)	0.485
No	89	61 (68.5)	28 (31.5)
Affect neural
Yes	50	30 (60.0)	20 (40.0)	0.230
No	90	63 (70.0)	27 (30.0)
TNM staging
I	10	10 (100.0)	0 (0.0)	0.000
II	49	44 (89.8)	5 (10.2)
III	81	39 (48.1)	42 (51.9)

HIF1α: Hypoxia-inducible factor 1α; WHO: Word Health Organization; TNM: Tumor-node-metastasis.

Table 4 Univariate analyses of disease-free survival and overall survival in patients with gastric cancer

Gene	Expression	Cases, n	Disease free survival			Overall survival
			mo	P		mo	P
LOX	High	50	15.6	0.037	4.352	22.9	0.033	4.524
	Low	90	26.7			40.2
HIF1α	High	47	14.0	0.003	8.712	20.4	0.003	8.992
	Low	93	26.9			40.2

LOX: Lysyl oxidase; HIF1α: Hypoxia-inducible factor 1α.