Hepatitis B virus preS1 deletion is related to viral replication increase and disease progression

Table 1 Clinical data of the subjects in cohort I (292 subjects) and cohort II (90 subjects) n (%)

Clinical factor	Cohort I	Cohort II
Patient No.	292	90
Age in years, mean ± SD	46.8 ± 16.0	37.8 ± 9.6
Male	225 (77.1)	46 (51.1)
HBeAg-positive	162 (55.5)	58 (64.4)
Liver disease No.	C : CH : LC : HCC	C : CH
	66 : 33 : 67 : 126	36 : 54
ALT [IU/liter (mean ± SD)]	77.7 ± 153.4	117.4 ± 226.5
Median of HBV-DNA (range)	979.4 (0-6000)1	1.3 × 109 (100-15.1 × 109)2

¹Median of HBV-DNA: pg/mL;

²Median of HBV-DNA: copies/mL. C: Carrier; CH: Chronic hepatitis; LC: Liver cirrhosis; HCC: Hepatocellular carcinoma; HBeAg: Hepatitis B virus e antigen; ALT: Alanine aminotransferase; IU: International unit.

Table 2 Primers and HybProbes developed to identify hepatitis B virus preS1 start codon deletion variants by real-time polymerase chain reaction

	Name	Sequence (5'→3')	Tm (°C)1	Target sequence	Channel
Forward primer	HBV_sF	GGGTCACCATATTCTTGGGAAC	62.5	203 - 224 bp of S gene
Reverse primer	HBV_sR	CGAATGCTCCCRCTCCTAC	60.5 or 63.3	203 - 224 bp of S gene
Anchor probe	WT_A	ACAGAAAGATTCGTCCCCATGCCTTGTCGAGG -FL2	72.1
Sensor probe	WT_S	LC Red6403-TGGAAGACGGACCTCCCATG-PH	63.4	Wild type S gene	640
Anchor probe	18D_A	GATTGGGAACAGAAAGATTCGTCCCCATGCC-FL	70.3
Sensor probe	18D_S	LC Red6104-TCGAGGTTTGCTGTAGCT-PH5	59.9	18 bp deletion	610
Anchor probe	21D_A	CCAGAGGATTGGGAACAGAAAGATTCGTCCCC-FL	70.5
Sensor probe	21D_S	LC Red640-GCCTTGTCGAGTGCTGTAGC -PH	64.7	21 bp deletion	640
Anchor probe	15D_A	ACAGAAAGATTCGTCCCCATGCCTTGTCGAGG -FL	73.2
Sensor probe	15D_S	LC Red6706-TTGGTGCTGTAGCTCTT-PH	57	15 bp deletion	670
Anchor probe	preS1_A	GATCCTTGTTGGGGTTGAAGTCCC-FL	65.8
Sensor probe	preS1_S	LC Red6104-ATCTGGATTGTTTGAGTTGGCT-PH	62.4	PreS1	610

¹Temperature was calculated using LC PDS software (version 2.0);

²FL: Fluorescein;

³LC Red640: Light Cycler dye Red640;

⁴LC Red610: Light Cycler dye Red610;

⁵PH: Phosphate;

⁶LC Red670: Light Cycler dye Red670. Tm: Melting temperature; 15D, 18D, 21D_A: 15, 18, 21 base pair deletion anchor probe; 15D, 18D, 21D_S: 15, 18, 21 base pair deletion sensor probe; S gene: Surface region gene.

Table 3 Sensitivity of fluorescence resonance energy transfer-based real-time polymerase chain reaction assay, according to the subjects’ clinical statuses n (%)

Diseases	Number of tests positive/total
	Cohort I	Cohort II
HCC	109/125 (87.2)
LC	59/69 (85.5)
CH	33/33 (100)	50/54 (92.6)
C	63/66 (95.5)	27/36 (75)
Total	264/292 (90.4)	77/90 (85.6)

HCC: Hepatocellular carcinoma; LC: Liver cirrhosis; CH: Chronic hepatitis; C: Carrier.

Table 4 Ten types of polymorphism detected by fluorescence resonance energy transfer-based real-time polymerase chain reaction assay and their prevalences among the 341 detected subjects

Types	n (%)
WT only	241 (70.7)
15 del only	3 (0.9)
18 del only	3 (0.9)
21 del only	4 (1.2)
WT + 15 del	16 (4.7)
WT + 18 del	47 (13.8)
WT + 21 del	6 (1.8)
WT + 15 del + 18 del	18 (5.3)
WT + 18 del + 21 del	2 (0.6)
WT + 15 del + 18 del + 21 del	1 (0.3)
Total	341

WT: Wild type; 15, 18, 21 del: 15, 18, 21 base pair deletion mutant; FRET-based real-time PCR: Fluorescence resonance energy transfer-based real-time polymerase chain reaction.

Table 5 Comparison of clinical data between subjects of cohort I and II with and without deletion variants n (%)

Clinical factor	Cohort I			Cohort II
	Wild type (n = 192)	Deletion (n = 72)	P value	Wild type (n = 49)	Deletion (n = 28)	P value
Age in years, mean ± SD	46.3 ± 15.7	44.7 ± 17.8	0.471	35.8 ± 8.9	39.1 ± 11.1	0.186
Male	148 (77.1)	52 (72.2)	0.423	20 (40.8)	16 (57.1)	0.235
HBeAg-positive	98 (51.0)	54 (75.0)	< 0.001	29 (69.2)	26 (92.9)	0.002
Liver disease (C : CH : LC : HCC)	43 : 27 : 47 : 75	20 : 6 : 12 : 34		18 : 31	9 : 19
ALT [IU/liter (mean ± SD)]	87.7 ± 182.4	54.4 ± 33.5	0.295	125.5 ± 271.2	120.9 ± 160.3	0.935
Median of HBV-DNA (range)	797.7 (0-6000)1	1678.9 (0-6000)1	0.013	8.3 × 108 (100-10.1 × 109)2	2.2 × 109 (2.3 × 103-15.1 × 109)2	0.049

¹Median level of HBV-DNA, pg/mL;

²Median level of HBV-DNA, copies/mL. C: Carrier; CH: Chronic hepatitis; LC: Liver cirrhosis; HCC: Hepatocellular carcinoma; HBeAg: Hepatitis B virus e antigen; ALT: Alanine aminotransferase.

Table 6 Comparison of the clinical data between the combined cohort I and II subjects with and without deletion and the prevalence of 3 types of deletion variants, according to their clinical statuses n (%)

	Wild type (n = 241)	Deletion (n = 100)	21 del (n = 13)	18 del (n = 70)	15 del (n = 38)	P value
Age in years, mean ± SD	44.1 ± 15.2	43.1 ± 16.3	51.6 ± 15.7	42.0 ± 15.9	40.3 ± 14.8	0.564
Male	168 (69.7)	68 (68.0)	6 (69.2)	46 (65.7)	24 (63.1)	0.797
HBeAg-positive	127 (52.7)	80 (80.0)	8 (61.5)	58 (82.9)	33 (86.8)	< 0.001
Liver disease (C : CH : LC : HCC)	61 : 58 : 47 : 75	29 : 25 : 12 : 34	4 : 3 : 0 : 8	21 : 17 : 9 : 23	12 : 13 : 5 : 8
ALT [IU/liter (mean ± SD)]	96.8 ± 207.1	81.1 ± 111.2	63.2 ± 43.3	85.5 ± 128.3	89.0 ± 122.4	0.476

One patient from hepatocellular carcinoma (HCC) has mixed mutations of 15, 18 and 21 deletion. Three patients from HCC have mixed mutations of both 15 and 18 deletion. Two patients from liver cirrhosis (LC) have mixed mutations of both 15 and 18 deletion. Two patients from LC have mixed mutations of both 18 and 21 deletion. Six patients from chronic hepatitis (CH) have mixed mutations of both 15 and 18 deletion. Seven patients from C have mixed mutations of both 15 and 18 deletion. Median of hepatitis B virus-DNA was converted into copies/mL according to a conversion constant presented by NIH (1 pg = 280000 copies). C: Carrier; HBeAg: Hepatitis B virus e antigen; ALT: Alanine aminotransferase.

Table 7 Comparison of fluorescence resonance energy transfer-based real-time polymerase chain reaction vs direct sequencing protocol for detection of deletion variants n (%)

Direct sequencing	Result for FRET-based real-time PCR
	Only wild type (n = 13)1	Mixed infection (n = 10)2
Only wild type	13 (100)	3
Mixed infection	0	7 (70)

¹Thirteen samples that were identified as only wild type infection by FRET-based real-time PCR were subjected to a direct sequencing protocol;

²The samples identified as mixed infection with both wild type and deletion variant by FRET-based real-time PCR were subjected to a direct sequencing protocol. FRET-based real-time PCR: Fluorescence resonance energy transfer-based real-time polymerase chain reaction.