Single nucleotide polymorphisms in the CDH17 gene of colorectal carcinoma

doi:10.3748/wjg.v18.i48.7251

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 18, Issue 48

This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (4399)

All Articles published online

The chart showing PDF series, HTML series, Figures (1-2) series, Tables (1-7) series.

Item

Count

PDF

302

HTML

2347

Figures (1-2)

157

Tables (1-7)

118

Sum=2924

Publishing Process of This Article

The chart showing Browse series, Download series.

Item

Count

Browse

769

Download

703

Sum=1472

Dec 28, 2012 (publication date) through Apr 25, 2024

Times Cited of This Article

Times Cited (7)

Journal Information of This Article

Publication Name

World Journal of Gastroenterology

ISSN

1007-9327

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Original Article

World J Gastroenterol. Dec 28, 2012; 18(48): 7251-7261
Published online Dec 28, 2012. doi: 10.3748/wjg.v18.i48.7251

Table 1 Primer sequences and fragment sizes of polymerase chain reaction products

Gene	SNPs site (refSNP )	Primer sequence(5’-3’)	Fragment sizes of PCR products (bp)
CDH17	c.343A>G (rs2243518)	Forward primer: CCAACATGGTTTCCTTTTCCTC	159
	c.343A>G (rs2243518)	Reverse primer: GTTCTGCCTTACTGAGCCTTCG	159
	c.2216A>C (rs1051624)	Forward primer: AATCCAGGGTCTGAAGTTGTA	198
	c.2216A>C (rs1051624)	Reverse primer: TACTAGCCTGAGTTGCCTATA	198

SNPs: Single nucleotide polymorphisms; PCR: Polymerase chain reaction.

Table 2 The correlation between the genotype of CDH17 gene c.343A>G and clinicopathologic parameters in colorectal carcinomas n (%)

Clinicopathologic parameters	n	*Genotype CDH17* c.343A>G**			χ²	P value
Clinicopathologic parameters	n	A/A	A/G	G/G	χ²	P value
Gender
Male	47	10 (21.3)	25 (53.2)	12 (25.5)	2.236	0.327
Female	46	16 (34.8)	19 (41.3)	11 (23.9)	2.236	0.327
Age (yr)
< 50	29	10 (34.5)	15 (51.7)	4 (13.8)	2.854	0.240
≥ 50	64	16 (25)	29 (45.3)	19 (29.7)	2.854	0.240
Tumor location
Colon	32	8 (25.0)	16 (50.0)	8 (25.0)	0.229	0.892
Rectum	61	18 (29.5)	28 (45.9)	15 (24.6)	0.229	0.892
Tumor size (cm)
< 5	68	18 (26.5)	34 (50.0)	16 (23.5)	0.734	0.693
≥ 5	25	8 (32.0)	10 (40.0)	7 (28.0)	0.734	0.693
Macroscopic appearance
Protrude type	31	8 (25.8)	17 (54.8)	6 (19.4)	1.948	0.745¹
Ulcer type	46	12 (26.1)	21 (45.7)	13 (28.3)
Infiltrating type	16	6 (37.5)	6 (37.5)	4 (25.0)
Colloid type	0	0 (0.0)	0 (0.0)	0 (0.0)
Histologic type
Adenocarcinoma	71	18 (25.4)	34 (47.9)	19 (26.8)	2.179	0.703¹
Adenocarcinoma and mucinous carcinoma	9	4 (44.4)	3 (33.3)	2 (22.2)
Mucinous carcinoma	13	4 (30.8)	7 (53.8)	2 (15.4)
Undifferentiated carcinoma	0	0 (0.0)	0 (0.0)	0 (0.0)
Adenosquamous carcinoma	0	0 (0.0)	0 (0.0)	0 (0.0)
Squamous cell carcinoma	0	0 (0.0)	0 (0.0)	0 (0.0)
Invasion depth
Submucosa	2	0 (0.0)	2 (100.0)	0 (0.0)	0.696	0.706²
Muscular layer	34	12 (35.3)	15 (44.1)	7 (20.6)
Serous coat	48	12 (25)	21 (43.8)	15 (31.3)
Other organs	9	2 (22.2)	6 (66.7)	1 (11.1)
Differentiation degree
Well-differentiated	4	0 (0.0)	2 (50.0)	2 (50.0)	2.212	0.331²
Moderately-differentiated	63	17 (27.0)	33 (52.4)	13 (20.6)
Poorly-differentiated	26	9 (34.6)	9 (34.6)	8 (30.8)
Lymph node metastasis
No	59	16 (27.1)	35 (59.3)	8 (13.6)	13.105	0.001³
Yes	34	10 (29.4)	9 (26.5)	15 (44.1)	13.105	0.001³
TNM grade
I	26	8 (30.8)	16 (61.5)	2 (7.7)	10.344	0.006²³
II	31	7 (22.6)	18 (58.1)	6 (19.4)
III	33	9 (27.3)	9 (27.3)	15 (45.5)
IV	3	2 (66.7)	1 (33.3)	0 (0.0)
Hematogenous metastasis
No	90	24 (26.7)	43 (47.8)	23 (25.6)	2.556	0.279¹
Yes	3	2 (66.7)	1 (33.3)	0 (0.0)	2.556	0.279¹
Recurrence
No	91	24 (26.4)	44 (48.4)	23 (25.3)	5.267	0.072¹
Yes	2	2 (100.0)	0 (0.0)	0 (0.0)	5.267	0.072¹

¹The Fisher’s Exact Test;

²The Kruskal-Wallis Test;

³Statistically significant.

Table 3 The correlation between the genotype of CDH17 gene c.2216A>C and clinicopathologic parameters in colorectal carcinomas n (%)

Clinicopathologic parameters	n	*Genotype CDH17* c.2216A>G**			χ²	P value
Clinicopathologic parameters	n	A/A	A/C	C/C	χ²	P value
Gender
Male	47	20 (42.6)	5 (10.6)	22 (46.8)	3.656	0.161
Female	46	11 (23.9)	7 (15.2)	28 (60.9)	3.656	0.161
Age (yr)
< 50	29	6 (20.7)	5 (17.2)	18 (62.1)	3.176	0.204
≥ 50	64	25 (39.1)	7 (10.9)	32 (50.0)	3.176	0.204
Tumor location
Colon	32	10 (31.3)	6 (18.8)	16 (50.0)	1.485	0.476
Rectum	61	21 (34.4)	6 (9.8)	34 (55.7)	1.485	0.476
Tumor size (cm)
< 5	68	25 (36.8)	5 (7.4)	38 (55.9)	7.144	0.028³
≥ 5	25	6 (24.0)	7 (28.0)	12 (48.0)	7.144	0.028³
Macroscopic appearance
Protrude type	31	11 (35.5)	4 (12.9)	16 (51.6)	1.025	0.906¹
Ulcer type	46	16 (34.8)	5 (10.9)	25 (54.3)
Infiltrating type	16	4 (25.0)	3 (18.8)	9 (56.3)
Colloid type	0	0 (0.0)	0 (0.0)	0 (0.0)
Histologic type
Adenocarcinoma	71	23 (32.4)	10 (14.1)	38 (53.5)	1.684	0.794¹
Adenocarcinoma and mucinous carcinoma	9	4 (44.4)	0 (0.0)	5 (55.6)
Mucinous carcinoma	13	4 (30.8)	2 (15.4)	7 (53.8)
Undifferentiated carcinoma	0	0 (0.0)	0 (0.0)	0 (0.0)
Adenosquamous carcinoma	0	0 (0.0)	0 (0.0)	0 (0.0)
Squamous cell carcinoma	0	0 (0.0)	0 (0.0)	0 (0.0)
Invasion depth
Submucosa	2	2 (100.0)	0 (0.0)	0 (0.0)	1.610	0.447²
Muscular layer	34	12 (35.3)	4 (11.8)	18 (52.9)
Serous coat	48	14 (29.2)	5 (10.4)	29 (60.4)
Other organs	9	3 (33.3)	3 (33.3)	3 (33.3)
Differentiation degree
Well-differentiated	4	0 (0.0)	0 (0.0)	4 (100.0)	0.090	0.956²
Moderately-differentiated	63	24 (38.1)	9 (14.3)	30 (47.6)
Poorly-differentiated	26	7 (26.9)	3 (11.5)	16 (61.5)
Lymph node metastasis
No	59	25 (42.4)	10 (16.9)	24 (40.7)	11.143	0.004³
Yes	34	6 (17.6)	2 (5.9)	26 (76.5)	11.143	0.004³
TNM grade
I	26	12 (46.2)	4 (15.4)	10 (38.5)	6.710	0.035²³
II	31	12 (38.7)	5 (16.1)	14 (45.2)
III	33	6 (18.2)	2 (6.1)	25 (75.8)
IV	3	1 (33.3)	1 (33.3)	1 (33.3)
Hematogenous metastasis
No	90	30 (33.3)	11 (12.2)	49 (54.4)	1.243	0.537¹
Yes	3	1 (33.3)	1 (33.3)	1 (33.3)	1.243	0.537¹
Recurrence
No	91	29 (31.9)	12 (13.2)	50 (54.9)	4.088	0.130¹
Yes	2	2 (100.0)	0 (0.0)	0 (0.0)	4.088	0.130¹

¹The Fisher’s Exact Test;

²The Kruskal-Wallis Test;

³Statistically significant.

Table 4 The correlation between the genotype and allele frequencies of CDH17 gene c.343A>G and lymph node metastasis n (%)

	Lymph node metastasis		OR (95%CI)
	No	Yes
Genotype			OR (95%CI)
A/G	35 (59.3)	9 (26.5)	1.000 (reference)
A/A	16 (27.1)	10 (29.4)	2.431 (0.828-7.139)
G/G	8 (13.6)	15 (44.1)	7.292 (2.360-22.532)
Allele frequency
A	67 (56.8)	29 (42.6)	1.000 (reference)
G	51 (43.2)	39 (57.4)	1.767 (0.967-3.229)

OR: Odds ratios.

Table 5 The correlation between the genotype and allele frequency of CDH17 gene c.343A>G and tumor-node-metastasis grade n (%)

	TNM grade				Mean rank
	I	II	III	IV	Mean rank
Genotype
A/G	16 (61.5)	18 (58.1)	9 (27.3)	1 (33.3)	39.32
A/A	8 (30.8)	7 (22.6)	9 (27.3)	2 (66.7)	48.15
G/G	2 (7.7)	6 (19.4)	15 (45.5)	0 (0.0)	60.39
Allele frequency
A	32 (61.5)	32 (51.6)	27 (40.9)	5 (83.3)	87.71
G	20 (38.5)	30 (48.4)	39 (59.1)	1 (16.7)	99.68

TNM: Tumor-node-metastasis.

Table 6 The correlation between the genotype and allele frequency of CDH17 gene c.2216A>C and lymph node metastasis n (%)

	Lymph node metastasis		OR (95%CI)
	No	Yes
Genotype			OR (95%CI)
A/C	10 (16.9)	2 (5.9)	1.000 (reference)
A/A	25 (42.4)	6 (17.6)	1.200 (0.206-6.977)
C/C	24 (40.7)	26 (76.5)	5.417 (1.076-27.272)
Allele frequency
A	60 (50.8)	14 (20.6)	1.000 (reference)
C	58 (49.2)	54 (79.4)	3.990 (2.002-7.953)

OD: Odds ratio.

Table 7 The correlation between the genotype and allele frequency of CDH17 gene c.2216A>C and tumor-node-metastasis grade n (%)

	TNM grade				Mean rank
	I	II	III	IV	Mean rank
Genotype
A/C	4 (15.4)	5 (16.1)	2 (6.1)	1 (33.3)	42
A/A	12 (46.2)	12 (38.7)	6 (18.2)	1 (33.3)	38.77
C/C	10 (38.5)	14 (45.2)	25 (75.8)	1 (33.3)	53.3
Allele frequency
A	28 (53.8)	29 (46.8)	14 (21.2)	3 (50.0)	78.09
C	24 (46.2)	33 (53.2)	52 (78.8)	3 (50.0)	103.68

TNM: Tumor-node-metastasis.

Citation: Chen RY, Cao JJ, Chen J, Yang JP, Liu XB, Zhao GQ, Zhang YF. Single nucleotide polymorphisms in the CDH17 gene of colorectal carcinoma. World J Gastroenterol 2012; 18(48): 7251-7261
URL: https://www.wjgnet.com/1007-9327/full/v18/i48/7251.htm
DOI: https://dx.doi.org/10.3748/wjg.v18.i48.7251