Effects of thalidomide on angiogenesis and tumor growth and metastasis of human hepatocellular carcinoma in nude mice

Table 1 Primer sequences and PCR reaction conditions.

Gene	Primers	Products size	Annealing Temp/Time	Cycles
VEGF (all isoforms)	Upper: CCTGGTGGACATCTTCCAGGAGTACC	196 bp	58°C/30 s	30
	Lower: GAAGCTCATCTCTCCTATGTGCTGGC
G3PDH	Upper: ACCACAGTCCATGCCATCAC	450 bp	58°C/30 s	30
	Lower: TCCACCACCCTGTTGCTGTA

Table 2 Comparison of serum concentrations of ALT and AFP and TNF-α between groups (mean±SD).

Groups	ALT (IU/L)	AFP (mg/L)	TNF-α(ng/L)
Control (n = 12)	102.35±39.29	25.68±14.38	42.69±6.99
Therapy (n = 12)	87.88±35.38	19.40±13.58	28.64±4.64a

^aP<0.05 vs control group.