Brief Reports
Copyright ©The Author(s) 2001. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Feb 15, 2001; 7(1): 111-114
Published online Feb 15, 2001. doi: 10.3748/wjg.v7.i1.111
Establishment of transgenic mouse harboring hepatitis B virus (adr subtype) genomes
Yi Ping Hu, Wei Jiang Hu, Wen Chao Zheng, Jian Xiu Li, De Shun Dai, Xin Min Wang, Shu Zhong Zhang, Hong Yu Yu, Wei Sun, Guang Rong Hao
Yi Ping Hu, Wei Jiang Hu, Jian Xiu Li, De Shun Dai, Xin Min Wang, Shu Zhong Zhang, Department of Cell Biology, Second Military Medical University, Shanghai 200433, China
Wen Chao Zheng, University of Wisconsin, Madison, WI 53705, USA
Hong Yu Yu, Department of Pathology, Second Military Medical University, Shanghai 200433, China
Wei Sun, Guang Rong Hao, Center of Laboratory Animals, Second Military Medical University, Shanghai 200433, China
Yi Ping Hu, Professor, and now is working at Second Military Medical University , having more then 40 papers published.
Author contributions: All authors contributed equally to the work.
Supported by Projects of Tackling Key Problems in Science and Technology from the State Science and Technology Ministry (TJ99-LA01) and Shanghai Science and Technology Commission (994919033)
Correspondence to: Professor Yi Ping Hu, Department of Cell Biology, Second Military Medical University Shanghai 200433, China. yphu@ smmu.edu.cn
Telephone: 0086-21-25070240 Fax: 0086-21-25070240
Received: May 30, 2000
Revised: June 16, 2000
Accepted: June 23, 2000
Published online: February 15, 2001

Abstract
Key Words: hepatitis B virus, mice transgenic, genome, polymerase chain reaction, immunohistochemistry, microscopy, electron, danes particles



INTRODUCTION

Hepatitis B virus (HBV) belongs to the group of hepatovirus, a major pathogen of human acute and chronic hepatitis B[1-4], which has a very close association with human hepatocellular carcinoma (HCC)[5-8]. For example, a statistical data from a hospital in Shanghai showed that 80% of HCC patients were positive for HBsAg (personal communication). The published data reported that people infected with HBV have a 200-fold greater risk of developing HCC than age-matched population not infected with HBV[9-11]. So HBV infection, including its consequences, is one of the key problems for the human health in the world. Since HBV only infects human beings and a few kinds of higher primates[12-14], the lack of culture cell and animal model impede the study of biological characteristics of HBV and human hepatitis B in the laboratory[15,16]. In 1985, the first transgenic mouse carrying HBV genes was generated[17], and thereafter the transgenic mouse system was applied in HBV studies[18-26].

HBV prevailing in the world has at least 4 subtypes[27-30], ayw, adr, ayr and adw, among which subtype adr is the most prevailing in China[31,32]. The complete genome of subtype adr has been cloned and analyzed from HBV infected population in China. It was identified that subtype adr was different from other 3 subtypes in DNA and protein sequence[33]. In order to produce the animal model for exploring adr subtype of HBV associated biomedical issues, we generated transgenic mice harboring complete genome from subtype adr of HBV by microinjection method, in which the HBsAg gene and HBeAg gene could be expressed, and the genomic DNA of HBV could be replicated and packed into complete virus particles. This model will be very useful for examination of many aspects of HBV and its associated biomedical issues in vivo.

MATERIALS AND METHODS

HBV genome of adr subtype was obtained from plasmid -padr-1-dimer. C57 mouse strain was bought from Animal Center of Shanghai Birth Control Research Institute. PCR primers for identification were designed by ourselves according to S region of HBV genome, primer 1: 5’CCCAACCTCCAATCACTCACC3’, primer 2: 5’ACGAACCACTGAACAAATGGC3’, synthesized by GIBCO BRL company (USA). The themostable DNA polymerase was bought from Sangon Co. (Canada), antigen-antibody ELISA kit of HBV was the product of Sino-American Bio-Engineering Co. (China). Primera gene Labeling System kit was bought from Promega Co. (USA). Antibodies for immunohistochemistry assay were products of Dako Co. (USA). Reagents for transmission electron microscopy were standard ones (China).

Preparation of HBV DNA and microinjection

padr-1-dimer has two copies of intact HBV (adr subtype) genome head to tail, cloned in BamH I site of plasmid pBR322 (Figure 1). Restriction enzymes Sal I and Cla I were used to digest Padr-1-dimer, followed by 7 g·L-1 agarose gel electrophoresis of the digested products, the 7.0 kb band was retrieved, purified and dissolved in TE buffer for microinjection. Microinjection and embryo manipulation were performed according to the methods described in References[34-36].

Figure 1
Figure 1 Restriction map and microinfection fragment of padr-1-dimer. C: Cla I; B: Bam HI; H: Hind III; S: Sal I
PCR and Southern-blotting of integrated transgenes

Genomic DNA from tail tissue of transgenic mice and normal mouse were prepared, and amplified with primers in S region according to the cycling program: 94 °C, 30 s; 60 °C, 40 s; 72 °C, 45 s; run 35 cycles in 50 µL reaction system. Fifteen µL of PCR products were loaded on 15 g·L-1 agarose gel in the presence of 0.5 µg ethidium bromide per mL. 380 bp band was visualized by UV fluorescence. Southern blot was performed on genomic DNA by agarose electrophoresis of 30 µg restricted DNA with Bam HI. Nylon filtrates were hybridized with the probe including HBV genome labeled with α-P32-dATP for further characterization of the transgenic mice.

HBV gene expression in transgenic mice

HBV gene expression in serum Venous blood in eye sockets of mice was collected, serum was isolated by centrifugation, and then used for HBsAg and HBeAg ELISA or RIA.

HBV gene expression in tissues The distribution of HBsAg and HBcAg was assessed by the labeled-avidin-biotin detection procedure. Briefly paraffin-embedded sections were treated for 10 min at 37 °C with 30 mL·L-1 hydrogen peroxide and washed with PBS. Rabbit anti-HBsAg primary antiserum at 1:100 dilution, and goat anti-HBcAg primary antiserum at 1:200 dilution were applied over night at room temperature. After washing with PBS, a secondary antiserum consisting of biotin-conjugated goat anti-rabbit IgG and rabbit anti-goat IgG was applied at 1:200 dilution for 40 min at 37 °C, and then washed with PBS. Then the preparation was treated with 1:100 dilution ABC complex stained with DAB, and finally counterstained with hematoxylin.

Assay of serum antibody of transgenic mice

Fifty µL of the serum from transgenic mouse was assayed for anti-HBsAg, anti-HBeAg and anti-HBcAg by ELISA according to the Kit protocol.

Pathological findings analysis

Serum ALT and AST Serum ALT and AST were tested with auto-biochemical analyzer.

Histopathological study The specimens of liver, kidney, heart, spleen from transgenic mice were fixed in formalin, paraffin embedded, sectioned and stained with HE.

Examination of HBV Dane’s particles in liver tissue from transgenic mice under TEM Several immunohistochemically HBV-positive mouse liver specimens were fixed over night at 4 °C in 40 mL·L-1 paraformaldehyde and 1 g·L-1 glutaradehyde in PBS. They were then postfixed in 10 g·L-1 OsO4 in cacodylate buffer for 1 hr at room temperature, dehydrated in gradient ethanol, and embedded in epoxy resin. This sections were cut on an LKB Ultratome III, mounted on copper grids, stained in uranyl acetate and lead citrate, and examined with electron microscope.

RESULTS
Microinjection and embryo manipulation

Hundreds of molecules of target fragment were microinjected into male pronuclei of fertilized eggs. Of 355 fertilized eggs microinjected, 262 of manipulated eggs survived; the survival rate was 73.8%. Thirteen of female recipient mice were transplanted with microinjected eggs through one of the ovarioles, and 2 of the transplanted mice were pregnant; the pregnant rate was 15.4%. Six small mice were born and all of them survived; the survival rate was 100%.

Founder mice and the identification of HBV DNA integration in transgenic mice

PCR and Southern-blotting results indicated that 4 mice were positive. So four founders were obtained. The founder mice were named HB adr dimer-x. The positive rate was 66%. Then the founders were mated with the normal mice of the same line. 27 F1 offspring of the founder mice were born. In 14 of them PCR showed positive genomic DNA PCR. The offspring of F1 were 56 mice, 28 of them were positive, and the positive rate was 50%. The exogenous genes can be transmitted through the germ line (Figure 2).

Figure 2
Figure 2 Southern-blot analysis of the HBV transgenic mice. Lane 1: positive control; Lane 2: negative control; Lane3-6: transgenic mouse
HBV genes expression in transgenic mice

HBV gene expression in serum The HBsAg and HBeAg were detected in the serum with ELISA and RIA. And the expression level of HBsAg was higher than that of HBeAg, and the gene expression was different in different founders (Table 1). The concentration of HBsAg in the serum was about 3000 IU·L-1.

Table 1 The ELISA result of founder mice and normal mice (A450).
AntigenControl
Transgenic mice
NegativePositiveHB-2HB-3HB-4HB-5
HBsAg0.011.420.170.060.260.23
HBeAg0.011.560.060.060.080.09

Distribution of HBsAg and HBcAg in transgenic mice Immunohistochemical study of liver and kidney tissues from transgenic mice indicated that the distribution of positive hepatocytes was uneven, HBsAg-positive particles were located mainly in cytoplasm of hepatocytes. HBsAg expression level was weaker in kidney than in liver; the products of immune reactions of HBcAg-positive were not very certain, and mainly emerged in a few nuclei of hepatocytes from the individuals that were invariably HBsAg-positive (Figure 3). No obvious product of immune reaction from HBsAg and HBcAg positive mice was found in spleen, skin, testis and other detected tissues.

Figure 3
Figure 3 Immunohistochemical analysis of HBV antigens in transgenic mouse tissues. A. HBsAg in the liver; B. HBcAg in the liver; C. HBsAg in the kidney

Serum antibody in transgenic mice The ELISA test indicated that there was no significant positive result of HBV antibodies in HBV transgenic mouse serum.

HBV Dane’s particles in liver in transgenic mice under TEM HBsAg particles (spherial and filamental) were found in the endoplasmic reticulum of some hepatocytes, a few of in renal tubule-epithalia, and the cytoplasm of a few Kupffer cells (Figure 4).

Figure 4
Figure 4 Dane’s particles under electron microscope.
Histopathological findings in transgenic mice

Histopathologic observation in transgenic mice tissues Mice have been monitored histologically for over 1 year without evidence of pathological changes in any organ, especially the liver and kidney. The serum ALT and AST assays indicated that there was no significant difference between the transgenic mice and the normal ones.(P > 0.05) (Table 2).

Table 2 Aminotransferase in the transgenic mice (n = 12, x ± s).
MiceALT (nkat·L-1)AST (nkat·L-1)
Normal698.5 ± 471.83597.4 ± 7669.9
Transgenic708.5 ± 491.84349.2 ± 7248.1
DISCUSSION

The HBV transgenic mice show replication of the HB virus in the hepatocytes, but have no evidence of cytopathology of the liver and other organs or tissues.

In theory, HBV genes microinjected are complete in structure, and can be expressed and replicated in their bodies[37,38], because we have purposefully prepared the fragment which contains two copies of intact HBV (adr subtype) genomes head-to-tail to make it sure that all of four open reading frames of HBV genome are complete in structure. Four of the founders all showed serum HBsAg-positive, but the expression level is different. We think this is due to the different integrated site of HBV DNA. In general, the exogenous gene will be integrated into multi-sites in transgenic mice. This is similar with the other reports[39,40].

Immunohistochemical assays of several tissues from transgenic mice revealed that HBV gene tissue-dependent expressions were tissue-dependent, and the genes were mainly expressed in the liver and kidney, but the expression level was different; this is similar to HBV-infection in nature. Examination of liver and kidney tissue from transgenic mice under transmission electron microscope revealed the existence of Dane’s particles and HBsAg particles in hepatocytes, which confirmed the ability of HBV genome replication in the transgenic mice.

Serum anti-HBs, anti-HBc and anti-HBe detected by ELISA were negative in all of the transgenic mice, and suggested that these mice were tolerant to HBsAg, HBcAg and HBeAg; this result was consistent with that of other author’s reports[41]. Now, we obtain the F3 generation positive mice. The HBV DNAs were able to be transmitted through the germ line of the mice from one generation to another.

The results of our experiments shows that HBVgenome introduced by microinjection is integrated into the mouse genome, and the HBV genes can be expressed, replicated and packaged. So these lines of HBV transgenic mice may be used as the animal model for the study on HBV and its associated biomedical issue. And it can also be applied in the selection of anti-HBV drugs and vaccine[42,43]. It is also useful for exploring the mechanism of HBV infection.

Footnotes

Edited by Lu HM Proofread by Ma JY

References
1.  Lok AS. Hepatitis B infection: pathogenesis and management. J Hepatol. 2000;32:89-97.  [PubMed]  [DOI]
2.  Wu XN. Update therapy of chronic hepatitis B in China: Recent progress. China Natl J New Gastroenterol. 1996;2:65-68.  [PubMed]  [DOI]
3.  Tang ZY. Clinical research of hepatocellular carcinoma in the 21st century. China Natl J New Gastroenterol. 1995;1:2-3.  [PubMed]  [DOI]
4.  Pan BR, Yang SF, Ma LS. Acute liver failure: a progress report. China Natl J New Gastroenterol. 1995;1:4-8.  [PubMed]  [DOI]
5.  Chisari FV, Ferrari C. Hepatitis B virus immunopathogenesis. Annu Rev Immunol. 1995;13:29-60.  [PubMed]  [DOI]
6.  Tiollais P, Pineau P, Wei Y, Dejean A, Buendia MA. [Hepatitis B virus and hepatocellular carcinoma]. Bull Acad Natl Med. 1998;182:73-77; discussion 77-78.  [PubMed]  [DOI]
7.  Cromlish JA. Hepatitis B virus-induced hepatocellular carcinoma: possible roles for HBx. Trends Microbiol. 1996;4:270-274.  [PubMed]  [DOI]
8.  Tiollais P, Pineau P, Wei Y, Dejean A, Buendia MA. [Hepatitis B virus and hepatocellular carcinoma]. Bull Acad Natl Med. 1998;182:73-77; discussion 77-78.  [PubMed]  [DOI]
9.  Wu MC. Clinical research advances in primary liver cancer. World J Gastroenterol. 1998;4:471-474.  [PubMed]  [DOI]
10.  Wu GY, Wu CH. Gene therapy and liver diseases. World J Gastroentero. 1998;4:18-19.  [PubMed]  [DOI]
11.  Tangkijvanich P, Hirsch P, Theamboonlers A, Nuchprayoon I, Poovorawan Y. Association of hepatitis viruses with hepatocellular carcinoma in Thailand. J Gastroenterol. 1999;34:227-233.  [PubMed]  [DOI]
12.  Hu X, Margolis HS, Purcell RH, Ebert J, Robertson BH. Identification of hepatitis B virus indigenous to chimpanzees. Proc Natl Acad Sci USA. 2000;97:1661-1664.  [PubMed]  [DOI]
13.  Lanford RE, Chavez D, Brasky KM, Burns RB, Rico-Hesse R. Isolation of a hepadnavirus from the woolly monkey, a New World primate. Proc Natl Acad Sci USA. 1998;95:5757-5761.  [PubMed]  [DOI]
14.  Pugh JC, Bassendine MF. Molecular biology of hepadnavirus replication. Br Med Bull. 1990;46:329-353.  [PubMed]  [DOI]
15.  Xu XP, Yang JZ, Gao Y. Recent advances in the application of cultured hepatocytes into bioartificial liver. China Natl J New Gastroenterol. 1996;2:182-184.  [PubMed]  [DOI]
16.  Peeples ME, Komai K, Radek R, Bankowski MJ. A cultured cell receptor for the small S protein of hepatitis B virus. Virology. 1987;160:135-142.  [PubMed]  [DOI]
17.  Chisari FV, Pinkert CA, Milich DR, Filippi P, McLachlan A, Palmiter RD, Brinster RL. A transgenic mouse model of the chronic hepatitis B surface antigen carrier state. Science. 1985;230:1157-1160.  [PubMed]  [DOI]
18.  Zhu HZ, Cheng GX, Chen JQ, Kuang SY, Cheng Y, Zhang XL, Li HD, Xu SF, Shi JQ, Qian GS. Preliminary study on the production of transgenic mice harboring hepatitis B virus X gene. World J Gastroenterol. 1998;4:536-539.  [PubMed]  [DOI]
19.  Larkin J, Clayton M, Sun B, Perchonock CE, Morgan JL, Siracusa LD, Michaels FH, Feitelson MA. Hepatitis B virus transgenic mouse model of chronic liver disease. Nat Med. 1999;5:907-912.  [PubMed]  [DOI]
20.  DeLoia JA, Burk RD, Gearhart JD. Developmental regulation of hepatitis B surface antigen expression in two lines of hepatitis B virus transgenic mice. J Virol. 1989;63:4069-4073.  [PubMed]  [DOI]
21.  Chisari FV, Filippi P, Buras J, McLachlan A, Popper H, Pinkert CA, Palmiter RD, Brinster RL. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proc Natl Acad Sci USA. 1987;84:6909-6913.  [PubMed]  [DOI]
22.  Reifenberg K, Löhler J, Pudollek HP, Schmitteckert E, Spindler G, Köck J, Schlicht HJ. Long-term expression of the hepatitis B virus core-e- and X-proteins does not cause pathologic changes in transgenic mice. J Hepatol. 1997;26:119-130.  [PubMed]  [DOI]
23.  Koike K, Moriya K, Yotsuyanagi H, Shintani Y, Fujie H, Tsutsumi T, Kimura S. Compensatory apoptosis in preneoplastic liver of a transgenic mouse model for viral hepatocarcinogenesis. Cancer Lett. 1998;134:181-186.  [PubMed]  [DOI]
24.  Guidotti LG, Matzke B, Pasquinelli C, Shoenberger JM, Rogler CE, Chisari FV. The hepatitis B virus (HBV) precore protein inhibits HBV replication in transgenic mice. J Virol. 1996;70:7056-7061.  [PubMed]  [DOI]
25.  Koike K, Moriya K, Iino S, Yotsuyanagi H, Endo Y, Miyamura T, Kurokawa K. High-level expression of hepatitis B virus HBx gene and hepatocarcinogenesis in transgenic mice. Hepatology. 1994;19:810-819.  [PubMed]  [DOI]
26.  Chisari FV. Hepatitis B virus transgenic mice: insights into the virus and the disease. Hepatology. 1995;22:1316-1325.  [PubMed]  [DOI]
27.  Echevarría JE, León P, López JA, Tenorio A, Domingo CJ, Echevarría JM. HBsAg subtype distribution among different populations of HBsAg carriers in Spain. Eur J Epidemiol. 1995;11:39-45.  [PubMed]  [DOI]
28.  Kidd-Ljunggren K, Couroucé AM, Oberg M, Kidd AH. Genetic conservation within subtypes in the hepatitis B virus pre-S2 region. J Gen Virol. 1994;75:1485-1490.  [PubMed]  [DOI]
29.  Echevarría JE, Tenorio A, Couroucé AM, León P, Echevarría JM. Polymerase chain reaction can resolve some undefined cases of hepatitis B virus antigenic subtyping. J Med Virol. 1994;42:217-223.  [PubMed]  [DOI]
30.  Okamoto H, Imai M, Tsuda F, Tanaka T, Miyakawa Y, Mayumi M. Point mutation in the S gene of hepatitis B virus for a d/y or w/r subtypic change in two blood donors carrying a surface antigen of compound subtype adyr or adwr. J Virol. 1987;61:3030-3034.  [PubMed]  [DOI]
31.  Fan J, Zhuang H, Li Y. [Comparison of sequences of hepatitis B virus S gene fragment in eight cities of China]. Zhonghua Yufang Yixue Zazhi. 1997;31:140-143.  [PubMed]  [DOI]
32.  Yuan TT, Tai PC, Shih C. Subtype-independent immature secretion and subtype-dependent replication deficiency of a highly frequent, naturally occurring mutation of human hepatitis B virus core antigen. J Virol. 1999;73:10122-10128.  [PubMed]  [DOI]
33.  Gan RB, Chu MJ, Shen LP, Qian SW, Li ZP. The complete nucleotide sequence of the cloned DNA of hepatitis B virus subtype adr in pADR-1. Sci Sin B. 1987;30:507-521.  [PubMed]  [DOI]
34.  Hu Y, Qin S, Xu Y, Liu Z. [Tissue-specific expression of the chimeric gene delta KpF in transgenic mice]. Yichuan Xuebao. 1992;19:27-33.  [PubMed]  [DOI]
35.  Kupriyanov S, Zeh K, Baribault H. Double pronuclei injection of DNA into zygotes increases yields of transgenic mouse lines. Transgenic Res. 1998;7:223-226.  [PubMed]  [DOI]
36.  Gordon K, Ruddle FH. Gene transfer into mouse embryos. Dev Biol (N Y 1985). 1986;4:1-36.  [PubMed]  [DOI]
37.  Guidotti LG, Matzke B, Schaller H, Chisari FV. High-level hepatitis B virus replication in transgenic mice. J Virol. 1995;69:6158-6169.  [PubMed]  [DOI]
38.  Farza H, Hadchouel M, Scotto J, Tiollais P, Babinet C, Pourcel C. Replication and gene expression of hepatitis B virus in a transgenic mouse that contains the complete viral genome. J Virol. 1988;62:4144-4152.  [PubMed]  [DOI]
39.  Araki K, Miyazaki J, Hino O, Tomita N, Chisaka O, Matsubara K, Yamamura K. Expression and replication of hepatitis B virus genome in transgenic mice. Proc Natl Acad Sci USA. 1989;86:207-211.  [PubMed]  [DOI]
40.  Guidotti LG, Matzke B, Schaller H, Chisari FV. High-level hepatitis B virus replication in transgenic mice. J Virol. 1995;69:6158-6169.  [PubMed]  [DOI]
41.  Wirth S, Guidotti LG, Ando K, Schlicht HJ, Chisari FV. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. J Immunol. 1995;154:2504-2515.  [PubMed]  [DOI]
42.  Zhoug S, Wen SM, Zhang DF, Wang QL, Wang SQ, Ren H. Sequencing of PCR amplified HBV DNA pre-c and c regions in the 2.2.15 cells and antiviral action by targeted antisense oligonucleotide directed against sequence. World J Gastroenterol. 1998;4:434-436.  [PubMed]  [DOI]
43.  Li H, Li RC, Liao SS, Yang JY, Zeng XJ, Wang SS. Persistence of hepatitis B vaccine immune protection and response to hepatitis B booster immunization. World J Gastroenterol. 1998;4:493-496.  [PubMed]  [DOI]