Original Research Open Access
Copyright ©The Author(s) 1997. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Jun 15, 1997; 3(2): 111-113
Published online Jun 15, 1997. doi: 10.3748/wjg.v3.i2.111
A prospective study of vertical transmission of hepatitis C virus
De-Gui Sun, Cai-Yun Liu, Shu-Cong Wang, Yu-Qi Yang, Guan County Sanitary and Antiepidemic Station, Guan County 065500, Hebei Province, China
Zong-Da Meng, Yong-De Sun, Hebei Provincial Sanitary and Antiepidemic Station, Guan County 065500, Hebei Province, China
Zheng-Lun Liang, Hui Zhuang, Beijing Medical University, Beijing 100000, China
De-Gui Sun, male, born on June 1, 1953, in Guan County, Hebei Province, graduated from Langfang Health School, Associate Professor, specialized in the prevention of viral hepatitis, with 27 papers published
Author contributions: All authors contributed equally to the work.
Supported by The Hebei Scientific Foundation, No. 91021701, and the National “8th Five Year” Research Project.
Correspondence to: Dr. De-Gui Sun, Guan County Sanitary and Antiepidemic Station, Guan County 065500, Hebei Province, China
Telephone: +86-316-6362937
Received: September 20, 1996
Revised: January 31, 1997
Accepted: March 1, 1997
Published online: June 15, 1997

Abstract

AIM: To prospectively study the mechanism of mother to infant transmission of hepatitis C virus (HCV).

METHODS: Using a nested PCR for detection of HCV RNA and the second generation ELISA for detection of anti-HCV, 13 pregnant women who suffered from post transfusion hepatitis C (PT-HCV) and their 15 babies were studied to evaluate mother to infant transmission of HCV.

RESULTS: The total infection rate of HCV was 86.7% in the babies, including one case of clinical HCV (7.7%), three subclinical cases of HCV (23.1%), and nine inapparent cases of HCV (69.2%). The positive rates of anti-HCV and HCV RNA declined with the age of the babies, to 7.7% for anti-HCV and 15.4% for HCV RNA at the age of three years.

CONCLUSION: Babies born to mothers infected with HCV were vertically infected with HCV at a high rate, but the consequences were not serious. Four fetuses born, born through induced labor to mothers positive for anti-HCV and HCV, were all infected by HCV, suggesting that the mother to infant transmission of HCV mainly occurred in the uterus.

Key Words: Hepatitis C virus, RNA, Viral, Disease transmission, Vertical



INTRODUCTION

It is well known that mother to infant transmission of hepatitis B virus (HBV) is the main cause of chronic carrier HBV, and the vertical transmission rate of human immunodeficiency virus (HIV) is also high with grave consequences. However, the existence and extent of vertical transmission of hepatitis C virus (HCV) are still largely unclear. Serological markers (anti-HCV) indicate various rates of vertical transmission of HCV[1-3]. Recently, the polymerase chain reaction (PCR) has been developed, which has enabled more accurate and reliable studies of vertical transmission of HCV[4,5]. In this study, we prospectively followed 15 infants born to 13 mothers with post transfusion HCV (PT-HCV). The results suggest that the rate of vertical transmission of HCV is high, but that the consequences in the infants are not serious, and that the transmission occurs mainly in the uterus.

MATERIALS AND METHODS
Mother to infant transmission

Pregnant women with PT-HCV and their offspring were selected (13 mo and 15 offspring). Mothers were interviewed, and their sera were collected at three, seven and nine months during pregnancy, and at one month after delivery. Sera of infants was collected at the ages of one, three, and six months, and every six months thereafter. Parents provided informed consent for the infants.

Infection in utero

Five fetuses from five anti-HCV-positive women with induced labor and 97 fetuses from 97 anti-HCV-negative women with induced labor were studied. Liver tissue and sera of the fetuses were collected and frozen.

Serologic tests and gene amplification

Anti-HCV antibody was tested by second generation ELISA kits provided by YesBiotech Lab (C, Ns3, Ns4, Ns5) and Shenyang Huimin, Co.

RT-nested PCR[6] was used for the HCV RNA PCR test, and the primers were from the 5′ untranslated region of the HCV genome. For the genotype PCR, the primers were from the core region[7] (Table 1).

Table 1 Sequences of hepatitis C virus test and genotype primers.
PurposeCodePositionnDirectionSequences (5'-)Target geno bp type
TestF15′NC153SenseGGCGACACTCCACCATGAATC
R1154AntisenseGGTGCACGGTCTACGAGACCT324
F3204SenseATGAGTGTCGTGCAGCCTCCA111
R3203AntisenseGTTTATCCAAGAAAGGACCCG
TypeAC256SenseCGCGCGACTAGGAAGACTTC
B186AntisenseATGTACCCCATGAGGTGGGC272
C104SenseAGGAAGACTTCCGAGCGGTC
D1132AntisenseTGCCTTGGGGATAGGCTGAC57I
D2133AntisenseGAGCCATCCTGCCCTCCCCA144II
D3134AntisenseCCAAGAGGGACGGGAACCTC174III
D4135AntisenseACCCTCGTTTCCGTACAGAG123IV

HBsAg screening kits (RPHA) were provided by the Institute of Beijing Biological Products, and the conformative reagents were provided by the Beijing Sihuan Factory.

Definition of hepatitis and HCV infection

Clinical cases of HCV. were defined as patients who were positive for anti HCV, who had elevated alanine aminotransferase (ALT) level, and who had symptoms and signs of hepatitis.Subclinical HCV cases were defined as patients who were positive both for HCV RNA and anti HCV and who had elevated ALT, but who did not have symptoms and signs of hepatitis. Inapparent cases of HCV were defined as patients positive both for HCV RNA and anti HCV, but who had normal ALT levels.Anti-HCV antibody passive transfer cases were defined as newborns who were positive for anti HCV antibody initially, but subsequently anti HCV negative. Infection with HCV in utero was defined as the detection of HCV RNA in the liver tissue or heart blood of a fetus.

RESULTS
Infection of mothers

Between 1988 and 1990, we recruited 13 mo aged 22 to 40 years (mean: 28.6 ± 4.6 years) who suffered from PT-HCV. None of these mothers were infected with HBV. Table 3 shows the mothers’ sera markers of HCV. During pregnancy, five cases had clinical HCV, one had subclinical HCV, six had unapparent HCV, and three were only anti HCV positive. All mothers had normal ALT levels at one month after delivery, but two cases still had symptoms and signs of HCV.

Table 3 Serological markers and clinical feature of infants.
CodeMothers infected with hepatitis C virus during pregnancy
Months from conception to disease onsetAge (months) of infants
1
3
6
9
12
18
24
36
CRACRACRACRACRACRACRACRACRA
1+++13+++1++-++-++-++-++-++-++-
1-2+--32++-++-++-+-----
2+++137++-++-++----------------
2-2++-54++-++----------
-++----------
4+++11++-++-++-++-++-++--+--+-
5+++17++-++-++-NNN-+--+-------
6++-12++++++++-++--++-+-------
7++-17------------------------
8++-30++-NNN++-NNN---
9++-25++-++-++-NNN---
10+++23++-++-++----
11++-37------------
12++-112+++NNNNNN------
13+--29++-NNNNNN------
Infection of infants

Of the 15 infants (5 male, 9 female), seven were followed up for three years, six for one year, and two for nine months. The infection rate of HCV was 86.7% (13/15), and two infants (13.3%) were negative both for anti-HCV antibody and HCV RNA. Among the 13 infected infants, one (7.7%) had clinical HCV, 2 (23.1%) subclinical infection, and 9 (69.2%) inapparent HCV infection (Table 3). Table 4 summarizes the characteristics of anti-HCV antibody and HCV RNA during follow-up. The seroconversion rate was 100% before three months, with some starting to turn negative at six months, and the rate decreasing toy 33.3% at 18 mo. Anti-HCV was persistently positive in one infant over 36 mo (16.7%). The detection rates of HCV RNA were the same as that of anti-HCV antibody before 9 mo, but were 66.7% at 18 mo and 33.3% at 36 mo. We did not find cases of anti-HCV antibody passive transfer only, or re-positive cases after negative conversion.

Table 4 Serological profiles of infants during follow-up.
Month(s)NumberAnti hepatitis C virus antibody +
hepatitis C virus RNA +
Number%Number%
112 (13)12 (13)100.0 (100.0)12 (13)100.0 (100.0)
39 (11)9 (11)100.0 (100.0)9 (11)100.0 (100.0)
610 (11)9 (10)90.0 (90.9)9 (10)90.0 (90.9)
911 (13)6 (6)54.5 (46.2)5 (5)45.5 (38.5)
1212 (13)3 (3)25.0 (23.1)5 (5)41.7 (38.5)
186 (13)2 (2)33.3 (15.4)4 (4)66.7 (30.8)
246 (13)1 (1)16.7 (7.7)2 (2)33.4 (15.4)
366 (13)1 (1)16.7 (7.7)2 (2)33.3 (15.4)

The genotypes of 10 HCV RNA positive infants born to nine HCV RNA positive mothers were all of genotype II.

Infection of HCV in uterine

Four fetuses from women who underwent induced labor were positive for both anti-HCV antibody and HCV RNA in cord and heart sera, and their liver tissues were HCV RNA positive as well. However, a fetus from a woman who was positive only for anti-HCV was uninfected with HCV, and the sera and liver tissues were all negative for anti-HC V and HCV RNA.

DISCUSSION

In this prospective study, we used a nested PCR for HCV RNA detection and a second generation ELISA for anti-HCV detection. The results suggest that the vertical transmission rate of HCV is high (86.7%). This vertical transmission can lead to clinical HCV, subclinical HCV, and inapparent infection. These results are consistent with the results reported by Thaler[4]. Our results also showed that the types of clinical manifestations and the duration of HCV RNA was related to the conditions of mothers in pregnancy.

Infants born to mothers with clinical HCV had a high rate of clinical HCV. Their HCV RNA and anti-HCV antibody could persist for a long time-as much as three years in 2. Furthermore, the clinical manifestations types of infants were related to the clinical manifestations of their mothers. One baby born to a mother who had acute HCV during pregnancy had clinical HCVs, with persistent viremia up to three years, but three babies whose mothers were had chronic or inapparent HCV during pregnancy showed inapparent infection and their HCV RNA and anti-HCV disappeared in six to nine months. The results suggest is indicated that mothers with acute hepatitis C transmit HCV to their babies at a high rate.

The grave consequences of vertical transmission of HBV are well known. The rate of vertical transmission of HCV is higher in our study, but mainly (69.2%) resulted in inapparent HCV, the virus was cleared in one year in most cases, and only a few (15.4%) were persistently positive for 3 years. These results suggested the consequence of HCV vertical transmission are not as serious as those associated with vertical HBV transmission. Unlike the transmission of HBV, the transmission of HCV mainly occurs in uterus. (1) The infants were all positive for anti-HCV antibody and HCV RNA at one month after delivery. (2) The detection rates of anti-HCV and HCV RNA decreased with with age. And (3) All of fetuses from For mothers with induced labor who were positive for anti HCV and HCV RNA, all of their fetuses were positive for anti-HCV and HCV RNA in heart sera, and one of those fetuses was HCV RNA positive in liver tissue.

Footnotes

Original title: China National Journal of New Gastroenterology (1995-1997) renamed World Journal of Gastroenterology (1998-)

S- Editor: Filipodia L- Editor: Jennifer E- Editor: Liu WX

References
1.  Kuroki T, Nishiguchi S, Fukuda K, Shiomi S, Monna T, Murata R, Isshiki G, Hayashi N, Shikata T, Kobayashi K. Mother-to-child transmission of hepatitis C virus. J Infect Dis. 1991;164:427-429.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 32]  [Cited by in F6Publishing: 35]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
2.  Reesink HW, Wong VC, Ip HM, van der Poel CL, van Exel-Oehlers PJ, Lelie PN. Mother-to-infant transmission and hepatitis C virus. Lancet. 1990;335:1216-1217.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 43]  [Cited by in F6Publishing: 43]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
3.  Chen DS, Lin HH, Chang MH. Mother to child transmission of hepatitis C virus: reply. J Infect Dis. 1991;164:428-431.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 11]  [Cited by in F6Publishing: 12]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
4.  Thaler MM, Park CK, Landers DV, Wara DW, Houghton M, Veereman-Wauters G, Sweet RL, Han JH. Vertical transmission of hepatitis C virus. Lancet. 1991;338:17-18.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 197]  [Cited by in F6Publishing: 194]  [Article Influence: 5.9]  [Reference Citation Analysis (0)]
5.  Novati R, Thiers V, Monforte AD, Maisonneuve P, Principi N, Conti M, Lazzarin A, Brechot C. Mother-to-child transmission of hepatitis C virus detected by nested polymerase chain reaction. J Infect Dis. 1992;165:720-723.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 113]  [Cited by in F6Publishing: 105]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
6.  Garson JA, Tedder RS, Briggs M, Tuke P, Glazebrook JA, Trute A, Parker D, Barbara JA, Contreras M, Aloysius S. Detection of hepatitis C viral sequences in blood donations by "nested" polymerase chain reaction and prediction of infectivity. Lancet. 1990;335:1419-1422.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 438]  [Cited by in F6Publishing: 436]  [Article Influence: 12.8]  [Reference Citation Analysis (0)]
7.  Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, Tanaka T, Sato K, Tsuda F, Miyakawa Y. Typing hepatitis C virus by polymerase chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources. J Gen Virol. 1992;73:673-679.  [PubMed]  [DOI]  [Cited in This Article: ]  [Cited by in Crossref: 859]  [Cited by in F6Publishing: 858]  [Article Influence: 26.8]  [Reference Citation Analysis (0)]