BPG is committed to discovery and dissemination of knowledge
Brief Article Open Access
©2012 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Oct 14, 2012; 18(38): 5404-5411
Published online Oct 14, 2012. doi: 10.3748/wjg.v18.i38.5404
Different risk factors influence peptic ulcer disease development in a Brazilian population
Rodrigo Buzinaro Suzuki, Rodrigo Faria Cola, Larissa Tranquilino Bardela Cola, Department of Genotyping, Hemocenter, Marilia Medical School, Marilia 17519-030, São Paulo, Brazil
Rodrigo Buzinaro Suzuki, André Eterovic, Márcia Aparecida Sperança, Center for Natural and Human Sciences, Universidade Federal do ABC, Santo André 09210-170, São Paulo, Brazil
Camila Garcia Ferrari, Department of Molecular Biology, Marilia Medical School, Marilia 17519-030, São Paulo, Brazil
Fred Ellinger, Altino Luiz Therezo, Luis Carlos da Silva, Department of Pathology, Marilia Medical School, Marilia 17519-030, São Paulo, Brazil
Author contributions: Suzuki RB contributed to the collection and processing of biopsy samples, epidemiological and molecular comparative analyses; Cola RF and Cola LTB contributed with analytic tools and molecular analysis; Ferrari CG contributed with molecular analysis; Ellinger F, Therezo AL and Silva LC contributed equally to the histopathological analysis; Eterovic A contributed with statistical analysis; and Sperança MA designed the research, wrote the paper and contributed to all comparative analyses.
Supported by Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP), Research Grant 06/01223-0; Fellowship CGF 2001/14509-5
Correspondence to: Márcia Aparecida Sperança, PhD, Center for Natural and Human Sciences, Universidade Federal do ABC, Rua Santa Adélia, 166 Bloco A, Torre 3, 6º andar Sala 625, Bairro Bangu 09210-170, Santo André, São Paulo, Brazil. marcia.speranca@ufabc.edu.br
Telephone: +55-11-49968373 Fax: +55-11-49960090
Received: January 6, 2012
Revised: April 12, 2012
Accepted: April 20, 2012
Published online: October 14, 2012

Abstract

AIM: To investigate age, sex, histopathology and Helicobacter pylori (H. pylori) status, as risk factors for gastroduodenal disease outcome in Brazilian dyspeptic patients.

METHODS: From all 1466 consecutive dyspeptic patients submitted to upper gastroscopy at Hospital das Clinicas of Marilia, antral biopsy specimens were obtained and subjected to histopathology and H. pylori diagnosis. All patients presenting chronic gastritis (CG) and peptic ulcer (PU) disease localized in the stomach, gastric ulcer (GU) and/or duodenal ulcer (DU) were included in the study. Gastric biopsies (n = 668) positive for H. pylori by rapid urease test were investigated for vacuolating cytotoxin A (vacA) medium (m) region mosaicism by polymerase chain reaction. Logistic regression analysis was performed to verify the association of age, sex, histopathologic alterations, H. pylori diagnosis and vacA m region mosaicism with the incidence of DU, GU and CG in patients.

RESULTS: Of 1466 patients submitted to endoscopy, 1060 (72.3%) presented CG [male/female = 506/554; mean age (year) ± SD = 51.2 ± 17.81], 88 (6.0%) presented DU [male/female = 54/34; mean age (year) ± SD = 51.4 ± 17.14], and 75 (5.1%) presented GU [male/female = 54/21; mean age (year) ± SD = 51.3 ± 17.12] and were included in the comparative analysis. Sex and age showed no detectable effect on CG incidence (overall χ2 = 2.1, P = 0.3423). Sex [Odds ratios (OR) = 1.8631, P = 0.0058] but not age (OR = 0.9929, P = 0.2699) was associated with DU and both parameters had a highly significant effect on GU (overall χ2 = 30.5, P < 0.0001). The histopathological results showed a significant contribution of ageing for both atrophy (OR = 1.0297, P < 0.0001) and intestinal metaplasia (OR = 1.0520, P < 0.0001). Presence of H. pylori was significantly associated with decreasing age (OR = 0.9827, P < 0.0001) and with the incidence of DU (OR = 3.6077, P < 0.0001). The prevalence of m1 in DU was statistically significant (OR = 2.3563, P = 0.0018) but not in CG (OR = 2.678, P = 0.0863) and GU (OR = 1.520, P= 0.2863).

CONCLUSION: In our population, male gender was a risk factor for PU; ageing for GU, atrophy and metaplasia; and H. pylori of vacA m1 genotype for DU.

Key Words: Helicobacter pylori; Gastric ulcer disease; Duodenal ulcer disease; Gastric atrophy; Helicobacter pylori vacuolating cytotoxin A medium region mosaicism



INTRODUCTION

Helicobacter pylori (H. pylori), a Gram-negative microaerophylic bacterium, is associated with a broad spectrum of digestive tract diseases such as chronic gastritis, gastric and duodenal ulcers, gastric cancer and lymphoproliferative disorders[1]. H. pylori infection prevalence and clinical outcome of the colonized patients varies according to several considerations including bacterial factors and host and environmental characteristics such as age, ethnic group, genera, geography and socioeconomic conditions[2].

The role of H. pylori in the interaction with the host has an impact on the pattern and severity of gastritis and its clinical outcome[3]. The physiologic mechanisms involved in these H. pylori-induced pathological differences are still unknown; however, one of the major bacterium virulence factors, the vacuolating cytotoxin A (vacA), seems to be involved. The vacA protein encoded by the polymorphic H. pylori vacA gene, is produced and secreted by all bacterium strains and induces the formation of intracellular vacuoles in epithelial cell lines in vitro[4-6]. Polymorphism of the vacA gene is distributed in three principal regions: the signal (s), intermediate (i), and middle (m) regions, each being divided in two main types, numbered 1 and 2[7,8], which are differently associated with several mechanisms of pathogenicity in vitro and in vivo[6,9-15]. The s1, i1, and m1 types have been shown to be independently associated with more severe forms of H. pylori-induced diseases[8,16].

Studies conducted in several countries have shown that type 1 and 2 alleles of vacA polymorphisms are both widespread in all populations examined, except in the Japanese, among whom type 2 alleles are rare[17,18]. Thus, outside Asia, vacA-type 1 and cagA-positive H. pylori strains are more frequently associated with severe H. pylori-induced peptic ulcer diseases than vacA-type 2 cagA-negative bacterium strains[7,19-22]. In Brazil, a country of continental dimensions, this association has been observed in children[23,24] but is controversial in the adult population[25-27].

Environmental and demographic data also interfere with the pathophysiology of H. pylori-associated gastric diseases. In the adult population of Brazil, H. pylori infection can range from 60%-90%[28-31]. In Marilia, a city of São Paulo State, the serological prevalence of H. pylori determined in blood donors was 57% and a risk factor associated with IgG and/or IgA H. pylori antibodies was low educational level[32]. Considering the large geographical dimensions of Brazil, with its regionally specific socioeconomic and cultural conditions reflected by the high and variable prevalence of H. pylori, there are few epidemiological studies on gastric diseases.

So far, all comparative Brazilian studies on gastric disease epidemiology, H. pylori prevalence and vacA gene mosaicism have generally been carried out on small populations and on H. pylori strains isolated in culture. Therefore, considering that gastric and duodenal ulcer diseases depend on different physiological trigger mechanisms, we comparatively investigated the role of age, gender, histopathologic antral gastric alterations and the H. pylori status, including the vacA m region mosaicism detected directly in biopsies, as risk factors for gastric ulcer (GU), duodenal ulcer (DU) and chronic gastritis (CG) in patients consecutively attending at Hospital das Clinicas of Marilia, São Paulo, Brazil, during a period of four years.

MATERIALS AND METHODS
Patients

Adult patients (n = 1466) resident in Marilia city, São Paulo State, Brazil, aged 19 to 91 years, underwent esophagogastroduodenoscopy (EGD) for upper abdominal pain or dyspeptic symptoms from January 2003 through December 2006 at the Gastroenterology Outpatient Clinic of the Hospital das Clínicas of Marília Medical School. All who presented GU, DU (by endoscopy) and/or CG (by histology), were enrolled in this study.

Endoscopy and biopsies

The EGD was accomplished by fibroendoscope (GIF-XP20, GIF-XQ20) or video-endoscope (GIF-100), both from Olympus Medical Systems, Shinjuku-ku, Tokyo, Japan. Gastric or duodenal ulcer diagnosis was defined by endoscopy and two fragments of the antrum were collected to perform rapid urease (RUT) and histopathological tests. The biopsy used for RUT was further submitted to DNA extraction. The protocol used is in agreement with the Helsinki Declaration and was approved by the Ethical Committee in Human Research from Marilia Medical School, under reference number 388/01.

Histology

One antral specimen was fixed in 40 g/L of formaldehyde and embedded in paraffin. Sections were Giemsa stained for H. pylori evaluation and were stained with hematoxylin and eosin for assessment of histopathologic alterations according to the Sydney classification[33].

Helicobacter pylori vacA genotyping

The same biopsy used for RUT was submitted to DNA extraction with the employment of the GFx DNA extraction kit purchased from Amersham/Pharmacia Biotec, following the manufacturer’s instructions. DNA was quantified in agarose gel electrophoresis using the Invitrogen low mass ladder and 50-100 μg of total DNA were used in the polymerase chain reaction (PCR) reactions with the oligonucleotides[34]: MA sense (5’CACAGCCACTTTYAATAACGA3’) and MB antisense (5’CGTCAAAATAATTCCAAGGG3’), which amplify a fragment of 400 bp or 476 bp corresponding to the vacA m regions 1 and 2, respectively. PCR condition was 94 °C for 5 min followed by 40 cycles of 94 °C 1 min/60 °C 1 min/72 °C 1 min and one cycle at 72 °C 7 min, with a total volume of 25 μL containing 1 × PCR buffer, 200 μmol dNTPs, 2.0 mmol MgCl2, 1 μmol of each oligonucleotide, 1.25 U Taq DNA Polimerase Platinum Brazil (Invitrogen). In all PCR reactions a negative and a positive control were used corresponding to, respectively, sterile water and H. pylori vacA m1 and/or m2 PCR positive gastric biopsies. The products of PCR reactions were resolved in 15 g/L agarose gels, stained with ethidium bromide and photographed under ultraviolet light.

Statistical analysis

Incidences of CG, DU, and GU in patients submitted to endoscopy were investigated using age (in years) and sex as independent factors. Only for patients who developed at least one of these diseases, the role of age, sex, CG, GU, and DU were verified as independent factors to evaluate the presence of atrophy, intestinal metaplasia, H. pylori and vacA m1 and m2 genotypes, each assessed individually. Incidences were coded as “1” and absences (of evidence) as “0” (males were also coded as “1”, females as “0”). Cases without the complete records needed for each analysis were discarded. Multivariable screenings were performed by additive logistic regression models for detection of significant effects of the independent factors on each response variable. New models were made after discarding irrelevant variables and significant parameters of these last models were used to describe the relationship among factors and responses by means of logit functions. Critical P-values were considered after a Bonferroni correction based on the number of similar tests. All logistic regression analyses were performed using a free on-line device for Logistic Regression calculation provided by Pezzulo (2012)[35].

RESULTS

Among 1466 patients submitted to endoscopy, 1060 (72.3%) presented CG [male/female = 506/554; mean age (year) ± SD = 51.2 ± 17.81], 88 (6.0%) presented DU [male/female = 54/34; mean age (year) ± SD = 51.4 ± 17.14], and 75 (5.1%) presented GU [male/female = 54/21; mean age (year) ± SD = 51.3 ± 17.12], and were included in the comparative analysis. More than one of these diseases was presented by 120 (8.2%) individuals and 369 (25.2%) patients were free of them (Figure 1). Most of the other endoscopic and histopathologic alterations were related to gastroesophageal tract diseases (data not shown). Mean age and gender of the included CG, GU and GC patients are summarized.

Figure 1
Figure 1 Incidence of chronic gastritis, duodenal ulcer and gastric ulcer disease and distribution of the investigated independent variables. A: Incidence of gastric diseases in patients who underwent endoscopy (n = 1466); B: Distribution of the histopathological parameters of atrophy (n = 1020); C: Intestinal metaplasia (n = 1094); D: Positive histological diagnosis of Helicobacter pylori (H. pylori) (n = 1045); E: H. pylori vacA m1 genotypes (n = 668); F: H. pylori vacA m2 genotypes (n = 668). CG: Chronic gastritis; DU: Duodenal ulcer; GU: Gastric ulcer; vacA: Vacuolating cytotoxin A. Values outside circles are negative tests.

Distribution of atrophy, intestinal metaplasia, H. pylori histological diagnosis and vacA m region mosaicism in patients presenting CG, DU and GU are summarized in Figure 1.

Atrophy and intestinal metaplasia were investigated among antral gastric biopsies of 1020 and 1094 patients, respectively, with 243 (23.8%) positive for atrophy and 140 (12.8%) for intestinal metaplasia.

Detection of H. pylori was performed directly from biopsy specimens by two different tests: histology and RUT. Histology is the gold standard H. pylori diagnostic test employed in our clinical routine which together with histopathological analysis is used to decide for H. pylori eradication therapy. RUT showed a very low positive predictive value for H. pylori-associated gastric diseases and a high discrepancy when compared to histology; consequently these data were excluded from the study (data not shown). Among 1045 patients investigated for H. pylori by histology, 539 (51.6%) were positive.

Among 668 biopsies of patients positive for RUT investigated for vacA m region mosaicism by PCR directly on biopsy specimens, 484 were positive, with 251 (51.8%) of m1 and 233 (48.2%) of m2 genotypes.

Results of the additive logistic regression models to evaluate the contribution of age and sex to the incidence of CG, DU and GU among patients who underwent gastroscopy are summarized in Table 1. Sex and age showed no detectable effect on CG incidence (overall χ2 = 2.1, P = 0.3423). Sex (OR = 1.8631, P = 0.0058) but not age (OR = 0.9929, P = 0.2699) affected DU, and both parameters had a highly significant association with GU (overall χ2 = 30.5, P < 0.0001), with contributions of both coefficients (age OR = 1.0233, P = 0.0017; sex OR = 3.0790, P < 0.0001). A posterior test for the age/sex interaction showed it to be nonsignificant (OR = 0.9888, P = 0.4844). The incidence of GU increased with age and further, at a given age, males had a higher probability of developing GU (Figure 2).

Table 1 Additive logistic regression models to evaluate the contribution of age and sex among patients who underwent gastroscopy (ntotal = 1466).
FactorCGDUGU
Overalln (+)10608875
χ2 (v = 2)2.148.9930.51
P0.34230.01121< 0.00011
β00.738-2.724-4.836
Ageβ10.003-0.0070.023
SE0.00340.00650.0073
P0.35110.26990.00171
OR1.0030.9931.023
CI-0.9970.9801.009
CI+1.0101.0061.038
Sexβ20.1240.6221.125
SE0.11020.22560.2636
P0.25980.00581< 0.00011
OR1.1321.8633.079
CI-0.9121.1971.837
CI+1.4052.8995.162
Figure 2
Figure 2 Logistic regression curves of age and sex as independent factors to explain gastric ulcer disease incidence. The model has a significant fit, with contributions of both coefficients (χ2 = 30.5, P < 0.0001). Additional test for the age/sex interaction had a nonsignificant result (β3 = -0.011, SE = 0.0161, P = 0.4844, OR = 0.989, CI- = 0.958, CI+ = 1.021). OR: Odds ratios; CI: Confidence intervals; GU: Gastric ulcer.

Additive logistic regression models were constructed to investigate the contribution of age, sex, CG, DU and GU to atrophy, intestinal metaplasia, H. pylori presence and vacA m1 and m2 mosaicism (Table 2).

Table 2 Logistic regression models to evaluate the contribution of age, sex, chronic gastritis, duodenal ulcer.
FactorAtrophyMetaplasiaH. pylorim1m2
Overallntotal102010941045668668
n (+)243140539251233
χ235.1871.6747.839.885.85
v1121.001
P< 0.00011< 0.00011 < 0.000110.001710.0156
β0-2.614-4.7330.881-0.589-0.038
Ageβ10.0270.050-0.018--0.012
SE0.00470.00630.0039-0.0048
P< 0.00011< 0.00011 < 0.00011-0.0162
OR1.0271.0510.983-0.989
CI-1.0181.0380.975-0.979
CI+1.0371.0640.990-0.998
DUβ2--1.2550.857-
SE--0.27020.2739-
P-- < 0.000110.00181-
OR--3.5062.356-
CI---2.0651.377-
CI+--5.9544.031-

The results for histopathological parameters showed a significant contribution of age for both atrophy (OR = 1.0297, P < 0.0001) and intestinal metaplasia (OR = 1.0520, P < 0.0001). Atrophy incidence increased with age (Figure 3) and a new model with only age as the independent factor also had a highly significant fit (overall χ2 = 35.2, P < 0.0001; age OR = 1.0273, P < 0.0001) though more parsimonious (Table 2). In the case of intestinal metaplasia, it was necessary to check for the contribution of CG, which was discarded after the Bonferroni correction. A new model with only age as the independent factor also had a highly significant fit (overall χ2 = 71.7, P < 0.0001; age OR = 1.0509, P < 0.0001) though more parsimonious (Table 2). Intestinal metaplasia increased with age, but at a lower level than atrophy for a given age (Figure 3).

Figure 3
Figure 3 Logistic regression curves of age as an independent factor to explain atrophy and intestinal metaplasia incidences. All patients who underwent endoscopy and who had at least one of the three diseases were included in the analysis. Both models had highly significant fits (atrophy OR = 1.0297, P < 0.0001; intestinal metaplasia OR = 3.6077, P < 0.0001). OR: Odds ratios.

Presence of H. pylori was significantly associated with age (OR = 0.9827, P < 0.0001) and occurrence of DU (OR = 3.6077, P < 0.0001) (Table 3). A new model with only age and DU as independent factors also had a highly significant fit (overall χ2 = 47.8, P < 0.0001; age OR = 0.9826, P < 0 .0001; DU OR = 3.5063, P < 0.0001) but was more parsimonious (Table 3). An additional model showed that age/DU had no effect on the presence of H. pylori3 = 0.0085, SE = 0.0168, P = 0.6142, OR = 1.0085, CI- = 0.9758, CI+ = 1.0423). H. pylori incidence decreased with age and DU incidence contributed to higher probabilities in developing detectable levels of the bacterium, despite individual age (Figure 4).

Table 3 Additive logistic regression models to evaluate the contribution of age, sex, chronic gastritis, duodenal ulcer and gastric ulcer disease.
FactorAtrophyMetaplasiaH. pylorim1m2
Overallntotal102010941045668668
n(+)243140539251233
χ2(v = 5)64.3478.6350.1413.4610.64
P < 0.00011< 0.00011 < 0.000110.019410.05911
β0-24.434-6.6160.832-1.448-0.225
Ageβ10.0290.051-0.017-0.003-0.012
SE0.00470.00640.00390.00480.0048
P< 0.00011 < 0.00011< 0.000110.56460.01391
OR1.0301.0520.9830.9970.988
CI-1.0201.0390.9750.9880.979
CI+1.0391.0650.9901.0070.998
Sexβ20.0640.101-0.1790.035-0.327
SE0.15300.1900.12830.16350.1659
P0.67750.59690.16290.83200.0485
OR1.0661.1060.8361.0350.721
CI-0.7900.7610.6500.7520.521
CI+1.4381.6071.0751.4260.998
CGβ321.6761.8070.1350.9850.378
SE> 1000.84270.45330.57420.5710
P0.99780.03200.76610.08630.5082
OR> 1006.0901.1442.6781.459
CI-0.0001.1680.4710.8690.477
CI+> 10031.7612.7828.2534.469
DUβ40.552 -0.3131.2830.856-0.175
SE0.26580.39720.27120.27710.2931
P0.03770.4308< 0.000110.002010.5496
OR1.7370.7313.6082.3530.839
CI-1.0320.3362.1201.3670.472
CI+2.9241.5936.1394.0501.491
GUβ5-0.0650.483-0.0320.4190.267
SE0.38250.42600.31850.39270.4038
P0.86600.25670.92000.28630.5083
OR0.9381.6210.9691.5201.306
CI-0.4430.7040.5190.7040.592
CI+1.9843.7361.8083.2822.883
Figure 4
Figure 4 Logistic regression curves of age and duodenal ulcer disease as independent factors to explain Helicobacter pylori incidence. The model had a highly significant fit (age OR = 0.9827, P < 0.0001; DU OR = 3.6077, P < 0.0001). A posterior test for the age/DU interaction had a nonsignificant result (β3 = 0.0085, SE = 0.0168, P = 0.6142, OR = 1.0085, CI- = 0.9758, CI+ = 1.0423). DU: Duodenal ulcer; OR: Odds ratios; CI: Confidence intervals; H. pylori: Helicobacter pylori.

The five independent factors studied for the H. pylori vacA m1 and m2 genotypes resulted in nonsignificant additive regression logistic models after Bonferroni correction. However, the evaluation of the contribution of the variables indicates a possible effect of DU (Table 3). A new model with only DU as the independent factor had a highly significant fit (overall χ2 = 9.9, P = 0.0017) (Table 2). The incidence probability of m1 in DU patients was 0.5667 and in DU negative patients was 0.3569 (OR = 2.3563, P = 0.0018). In the case of m2, the evaluation of the variable contributions indicated a possible effect of age (Table 2). A new model with only age as the independent factor also had a nonsignificant fit, and was discarded by the adopted critical P-value (overall χ2 = 5.8, P = 0.0156; age OR = 0.9885, P = 0.0162) (Table 2).

DISCUSSION

In order to verify the differential contribution of age, gender, histopathological outcome, H. pylori and vacA m region mosaicism with incidence of PU and CG, we investigated comparatively all cases of DU (88), GU (75) and CG (1060) found after analysis of 1466 patients consecutively submitted to gastroscopy in Hospital das Clinicas of Marilia, São Paulo, Brazil, over four years.

The most prevalent gastric disease found in our consecutive dyspeptic patients was CG (72.3%) followed by gastroesophageal alterations not included in this study. Peptic ulcer disease was prevalent in 11.1% of the patients, with 6.0% of GU and 5.1% of DU. Male gender had a statistically significant association with both PU incidences. Our results are in accordance with research done in the southern region of Brazil where DU and GU had a similar prevalence and were associated with male gender[36]. However, in a recent large scale PU epidemiological study carried out in a tertiary care hospital in another city of São Paulo State, Brazil, the prevalence of DU was four times higher than GU[37] and in this population there was a significant predominance of woman in the PU group[38]. These regional differences reinforce the specificity of risk factors associated with severe gastric diseases and the need to perform local investigations to improve health care strategies.

There are differences in the gastrointestinal physiological modifications that lead to gastric and duodenal ulcers, whose causes are multifactorial and also related to population characteristics and to specific gastroduodenal alterations due to association of H. pylori with host mucosa[39]. In our study, increasing age was a risk factor for the development of GU. The mean age of GU and DU patients in the Brazilian ulcer study performed in a hospital in São Paulo also differed significantly, being higher in GU[37]. Thus, more epidemiological studies have to be done in order to identify the risk factors associated with age and the onset of GU in the Marilia population.

The eradication of H. pylori infection cured both gastric and duodenal ulcers, and the cure rates are similar, suggesting that H. pylori is the key factor in peptic ulcer diseases independent of the ulcer site[40]. However, a number of studies have shown the participation of other risk factors such as smoking, alcohol intake, and nonsteroidal antiinflammatory drug (NSAID) use in the etiology of PU, which are principally associated with GU[39,41,42]. In our study the prevalence of H. pylori infection observed by histology was significantly higher in DU than in GU and CG (P < 0.0001). Also, in the Danish epidemiologic PU study, IgG against H. pylori was higher in DU (87.2%) when compared to GU (60%) patients. In another city of São Paulo, there was also found to be a higher prevalence of H. pylori in DU (64%) than in GU (57%) patients[37]. These results suggest the participation of a major number of risk factors not associated with H. pylori involved in the development of GU rather than DU. Moreover, a very important and large scale follow-up study of ulcer patients performed in Europe[43] showed that GU can be a risk factor in the development of gastric cancer, while in DU this relationship was inversely observed, which suggests that GU and gastric cancer have etiologic factors in common that are not found in DU.

As a consequence of H. pylori gastric mucosa colonization, gastric acid secretion is altered with it being induced or impaired in response to the release of factors produced or induced by the bacterium, resulting in different topographic phenotypes of gastritis and the presence of atrophy. Gastritis associated with atrophy in the corpus is accompanied by hypochlorhydria and carries the highest risk for GU and cancer, whereas hyperchlorhydria produced by gastritis in the antrum predisposes to DU[43,44]. In our patients, antrum atrophy was more prevalent in DU than in GU, corroborating the hypothesis that DU can be a result of antral gastric atrophy. However, increasing age and not H. pylori presence was significantly related to the occurrence of atrophy and intestinal metaplasia. These results are in agreement with an epidemiological study performed in a rural population of Korea[45] and also in previous gastric physiological studies which have demonstrated the association of atrophic gastritis with increasing age[46,47].

In Northern Peninsular Malaysia, the prevalence of H. pylori increased in adult old-age groups, even when old and geriatric adults were compared[48]. In our investigated population, H. pylori incidence decreased significantly with age (Figure 4). These results can be indicative of a populational specific characteristic associated with the clearing of H. pylori during the course of a chronic infection, or can be related to the diagnosis of H. pylori in antrum biopsies since the expression of gastritis in the antrum, but not in the cardia or corpus, seems to decrease with age[49]. New research is necessary to answer these questions.

Polymorphisms in the m region of the H. pylori vacA gene affect the cell tropism of the toxin[50]; the m1 type of vacA shows toxicity toward a broader range of cells than the m2 type[51,52]. In Asia, where there is a high predominance of s1 alelle in the s region polymorphism of the vacA gene, the vacA m region mosaicism shows a variation within East Asia[53], with m1 strains being more prevalent in regions where there is a higher prevalence of gastric cancer, suggesting that m1 strains of H. pylori are more pathogenic. In Brazil, the involvement of vacA gene mosaicism with gastric diseases in adults is controversial[25-27]; in all these studies the size of investigated patient populations has been small and bacterium strains were isolated before genotyping which can cause a bias due to selection pressure by in vitro growth conditions. Our work was performed during a period of four years and the investigation of vacA m region mosaicism was done directly on biopsy specimens by PCR. Our results are the first in Brazil to find association of vacA m1 allele specific to adult DU patients when compared to GU and CG (P < 0.0018), indicating that in our region high prevalence of H. pylori and the strains harboring the vacA m1 genotype are more frequently associated with the development of DU.

Nowadays, PU remains the cause of significant morbidity, especially in older age groups, representing an important world health problem[54]. Its etiology in either the stomach (GU) or duodenum (DU) is multifactorial and depends on the interplay of a gastritis phenotype and of physiological gastroduodenal alterations as a result of environment, H. pylori genetic background and host interactions, which vary regionally. In this study we found that PU is associated with male gender when compared to CG and that there were risk factor differences associated with DU and GU. H. pylori and vacA m1 genotype were associated with DU while older age at disease commitment was associated with GU. Thus, in spite of the few large scale Brazilian studies on epidemiological characteristics of gastric diseases with stratification of PU in GU and DU, we find high regional variation, indicating that local population investigation has to be carried out in order to improve treatment and prevention of severe gastric diseases.

COMMENTS
Background

Helicobacter pylori (H. pylori), a Gram-negative microaerophylic bacterium, is associated with a broad spectrum of digestive tract diseases such as chronic gastritis, gastric and duodenal ulcers, gastric cancer and lymphoproliferative disorder. H. pylori infection prevalence and clinical outcome of the colonized patients varies according to several considerations including bacterial factors and host and environmental characteristics such as age, ethnic group, genera, geography and socioeconomic conditions.

Research frontiers

The physiologic mechanisms involved in these H. pylori-induced pathological differences are still unknown; however, one of the major bacterium virulence factors, the vacuolating cytotoxin A (vacA), seems to be involved. The s1, i1, and m1 types have been shown to be independently associated with more severe forms of H. pylori-induced diseases.

Innovations and breakthroughs

Gastric biopsies positive for H. pylori by rapid urease test were investigated for vacA medium (m) region mosaicism by polymerase chain reaction. Logistic regression analysis was performed to verify the association of age, sex, histopathologic alterations, H. pylori diagnosis and vacA m region mosaicism.

Applications

These results can be indicative of a populational specific characteristic associated with the clearing of H. pylori during the course of a chronic infection, or can be related to the diagnosis of H. pylori in antrum biopsies since the expression of gastritis in the antrum, but not in the cardia or corpus, seems to decrease with age. New research is necessary to answer these questions.

Peer review

This is a good descriptive study in which authors analyze age, sex, histopathology and H. pylori status, as risk factors for gastroduodenal disease outcome in Brazilian dyspeptic patients. The results are interesting and suggest that male gender was a risk factor for peptic ulcer; ageing for gastric ulcer, atrophy and metaplasia; and H. pylori of vacA m1 genotype for duodenal ulcer.

References
1.  Mégraud F. [Helicobacter pylori infection: Review and practice]. Presse Med. 2010;39:815-822.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 12]  [Article Influence: 0.8]  [Reference Citation Analysis (2)]
2.  Aguilar GR, Ayala G, Fierros-Zárate G. Helicobacter pylori: recent advances in the study of its pathogenicity and prevention. Salud Publica Mex. 2001;43:237-247.  [PubMed]  [DOI]
3.  Egan BJ, Holmes K, O'Connor HJ, O'Morain CA. Helicobacter pylori gastritis, the unifying concept for gastric diseases. Helicobacter. 2007;12 Suppl 2:39-44.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 22]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
4.  Telford JL, Ghiara P, Dell'Orco M, Comanducci M, Burroni D, Bugnoli M, Tecce MF, Censini S, Covacci A, Xiang Z. Gene structure of the Helicobacter pylori cytotoxin and evidence of its key role in gastric disease. J Exp Med. 1994;179:1653-1658.  [PubMed]  [DOI]
5.  Cover TL. The vacuolating cytotoxin of Helicobacter pylori. Mol Microbiol. 1996;20:241-246.  [PubMed]  [DOI]
6.  Cover TL, Halter SA, Blaser MJ. Characterization of HeLa cell vacuoles induced by Helicobacter pylori broth culture supernatant. Hum Pathol. 1992;23:1004-1010.  [PubMed]  [DOI]
7.  Atherton JC, Cao P, Peek RM, Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem. 1995;270:17771-17777.  [PubMed]  [DOI]
8.  Rhead JL, Letley DP, Mohammadi M, Hussein N, Mohagheghi MA, Eshagh Hosseini M, Atherton JC. A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer. Gastroenterology. 2007;133:926-936.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 335]  [Cited by in RCA: 304]  [Article Influence: 16.0]  [Reference Citation Analysis (2)]
9.  Gebert B, Fischer W, Weiss E, Hoffmann R, Haas R. Helicobacter pylori vacuolating cytotoxin inhibits T lymphocyte activation. Science. 2003;301:1099-1102.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 439]  [Cited by in RCA: 401]  [Article Influence: 17.4]  [Reference Citation Analysis (1)]
10.  Manente L, Perna A, Buommino E, Altucci L, Lucariello A, Citro G, Baldi A, Iaquinto G, Tufano MA, De Luca A. The Helicobacter pylori's protein VacA has direct effects on the regulation of cell cycle and apoptosis in gastric epithelial cells. J Cell Physiol. 2008;214:582-587.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 34]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
11.  Pai R, Cover TL, Tarnawski AS. Helicobacter pylori vacuolating cytotoxin (VacA) disorganizes the cytoskeletal architecture of gastric epithelial cells. Biochem Biophys Res Commun. 1999;262:245-250.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 41]  [Cited by in RCA: 39]  [Article Influence: 1.4]  [Reference Citation Analysis (2)]
12.  Szabò I, Brutsche S, Tombola F, Moschioni M, Satin B, Telford JL, Rappuoli R, Montecucco C, Papini E, Zoratti M. Formation of anion-selective channels in the cell plasma membrane by the toxin VacA of Helicobacter pylori is required for its biological activity. EMBO J. 1999;18:5517-5527.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 232]  [Cited by in RCA: 214]  [Article Influence: 7.9]  [Reference Citation Analysis (0)]
13.  Terebiznik MR, Raju D, Vázquez CL, Torbricki K, Kulkarni R, Blanke SR, Yoshimori T, Colombo MI, Jones NL. Effect of Helicobacter pylori's vacuolating cytotoxin on the autophagy pathway in gastric epithelial cells. Autophagy. 2009;5:370-379.  [PubMed]  [DOI]
14.  Torres VJ, VanCompernolle SE, Sundrud MS, Unutmaz D, Cover TL. Helicobacter pylori vacuolating cytotoxin inhibits activation-induced proliferation of human T and B lymphocyte subsets. J Immunol. 2007;179:5433-5440.  [PubMed]  [DOI]
15.  Willhite DC, Blanke SR. Helicobacter pylori vacuolating cytotoxin enters cells, localizes to the mitochondria, and induces mitochondrial membrane permeability changes correlated to toxin channel activity. Cell Microbiol. 2004;6:143-154.  [PubMed]  [DOI]
16.  Basso D, Zambon CF, Letley DP, Stranges A, Marchet A, Rhead JL, Schiavon S, Guariso G, Ceroti M, Nitti D. Clinical relevance of Helicobacter pylori cagA and vacA gene polymorphisms. Gastroenterology. 2008;135:91-99.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 321]  [Cited by in RCA: 289]  [Article Influence: 16.1]  [Reference Citation Analysis (1)]
17.  Yamaoka Y, Kodama T, Gutierrez O, Kim JG, Kashima K, Graham DY. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J Clin Microbiol. 1999;37:2274-2279.  [PubMed]  [DOI]
18.  Ito Y, Azuma T, Ito S, Miyaji H, Hirai M, Yamazaki Y, Sato F, Kato T, Kohli Y, Kuriyama M. Analysis and typing of the vacA gene from cagA-positive strains of Helicobacter pylori isolated in Japan. J Clin Microbiol. 1997;35:1710-1714.  [PubMed]  [DOI]
19.  van Doorn NE, Namavar F, van Doorn LJ, Durrani Z, Kuipers EJ, Vandenbroucke-Grauls CM. Analysis of vacA, cagA, and IS605 genotypes and those determined by PCR amplification of DNA between repetitive sequences of Helicobacter pylori strains isolated from patients with nonulcer dyspepsia or mucosa-associated lymphoid tissue lymphoma. J Clin Microbiol. 1999;37:2348-2349.  [PubMed]  [DOI]
20.  Rudi J, Kuck D, Rudy A, Sieg A, Maiwald M, Stremmel W. Helicobacter pylori vacA genotypes and cagA gene in a series of 383 H. pylori-positive patients. Z Gastroenterol. 2000;38:559-564.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 10]  [Cited by in RCA: 12]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
21.  Leanza AG, Matteo MJ, Crespo O, Antelo P, Olmos J, Catalano M. Genetic characterisation of Helicobacter pylori isolates from an Argentinean adult population based on cag pathogenicity island right-end motifs, lspA-glmM polymorphism and iceA and vacA genotypes. Clin Microbiol Infect. 2004;10:811-819.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 16]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
22.  Catalano M, Matteo M, Barbolla RE, Jimenez Vega DE, Crespo O, Leanza AG, Toppor J, Antelo P. Helicobacter pylori vacA genotypes, cagA status and ureA-B polymorphism in isolates recovered from an Argentine population. Diagn Microbiol Infect Dis. 2001;41:205-210.  [PubMed]  [DOI]
23.  De Gusmão VR, Nogueira Mendes E, De Magalhães Queiroz DM, Aguiar Rocha G, Camargos Rocha AM, Ramadan Ashour AA, Teles Carvalho AS. vacA genotypes in Helicobacter pylori strains isolated from children with and without duodenal ulcer in Brazil. J Clin Microbiol. 2000;38:2853-2857.  [PubMed]  [DOI]
24.  Garcia GT, Aranda KR, Gonçalves ME, Cardoso SR, Iriya K, Silva NP, Scaletsky IC. High prevalence of clarithromycin resistance and cagA, vacA, iceA2, and babA2 genotypes of Helicobacter pylori in Brazilian children. J Clin Microbiol. 2010;48:4266-4268.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 20]  [Cited by in RCA: 30]  [Article Influence: 1.9]  [Reference Citation Analysis (1)]
25.  Brito CA, Silva LM, Jucá N, Leal NC, de Souza W, Queiroz D, Cordeiro F, Silva NL. Prevalence of cagA and vacA genes in isolates from patients with Helicobacter pylori-associated gastroduodenal diseases in Recife, Pernambuco, Brazil. Mem Inst Oswaldo Cruz. 2003;98:817-821.  [PubMed]  [DOI]
26.  Ashour AA, Magalhães PP, Mendes EN, Collares GB, de Gusmão VR, Queiroz DM, Nogueira AM, Rocha GA, de Oliveira CA. Distribution of vacA genotypes in Helicobacter pylori strains isolated from Brazilian adult patients with gastritis, duodenal ulcer or gastric carcinoma. FEMS Immunol Med Microbiol. 2002;33:173-178.  [PubMed]  [DOI]
27.  Martins LC, Corvelo TC, Demachki S, Araujo MT, Assumpção MB, Vilar SC, Freitas FB, Barbosa HP, Fecury AA, do Amaral RK. Clinical and pathological importance of vacA allele heterogeneity and cagA status in peptic ulcer disease in patients from North Brazil. Mem Inst Oswaldo Cruz. 2005;100:875-881.  [PubMed]  [DOI]
28.  Almeida Cunha RP, Alves FP, Rocha AM, Rocha GA, Camargo LM, Nogueira PO, Camargo EP, Queiroz DM. Prevalence and risk factors associated with Helicobacter pylori infection in native populations from Brazilian Western Amazon. Trans R Soc Trop Med Hyg. 2003;97:382-386.  [PubMed]  [DOI]
29.  Ito LS, Oba SM, Hamajima N, Marie SK, Uno M, Shinjo SK, Kino A, Lavilla F, Inoue M, Tajima K. Helicobacter pylori seropositivity among 963 Japanese Brazilians according to sex, age, generation, and lifestyle factors. Jpn J Cancer Res. 2001;92:1150-1156.  [PubMed]  [DOI]
30.  Lyra AC, Santana G, Santana N, Silvany-Neto A, Magalhães E, Pereira EM, Mascarenhas R, Lyra MC, Veiga A, Ferreira K. Seroprevalence and risk factors associated with Helicobacter pylori infection in blood donors in Salvador, Northeast-Brazil. Braz J Infect Dis. 2003;7:339-345.  [PubMed]  [DOI]
31.  Alvarenga EC, Montes CG, Guerrazzi F, Zeitune JM, Grotto HZ. Helicobacter pylori infection and the severity of gastritis are not associated with iron deficiency in a group of Brazilian patients. Clin Chem Lab Med. 2010;48:1809-1812.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 5]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
32.  Calamita Z, Da Silva LA, França ACV, Dias SMZ, Payão SLM, Sperança MA. Comparative clinical study of Helicobacter pylori seroprevalence in patients with chronic urticaria from Marlia - So Paulo (Brazil). Revista Brasileira de Alergia e Imunopatologia. 2003;26:146-151.  [PubMed]  [DOI]
33.  Rotimi O, Cairns A, Gray S, Moayyedi P, Dixon MF. Histological identification of Helicobacter pylori: comparison of staining methods. J Clin Pathol. 2000;53:756-759.  [PubMed]  [DOI]
34.  van Doorn LJ, Figueiredo C, Sanna R, Pena S, Midolo P, Ng EK, Atherton JC, Blaser MJ, Quint WG. Expanding allelic diversity of Helicobacter pylori vacA. J Clin Microbiol. 1998;36:2597-2603.  [PubMed]  [DOI]
35.  Pezzullo J Logistic Regression. 2012; Available from: http: //statpages.org/logistic.html.  [PubMed]  [DOI]
36.  Saul C, Teixeira CR, Pereira-Lima JC, Torresini RJ. [Prevalence reduction of duodenal ulcer: a Brazilian study. (retrospective analysis in the last decade: 1996-2005)]. Arq Gastroenterol. 2007;44:320-324.  [PubMed]  [DOI]
37.  Marques SB, Mattar R, Artifon EL, Sakai P, Carrilho FJ. High prevalence of duodenal ulcer in a tertiary care hospital in the city of São Paulo, SP, Brazil. Arq Gastroenterol. 2011;48:171-174.  [PubMed]  [DOI]
38.  Mattar R, dos Santos AF, Eisig JN, Rodrigues TN, Silva FM, Lupinacci RM, Iriya K, Carrilho FJ. No correlation of babA2 with vacA and cagA genotypes of Helicobacter pylori and grading of gastritis from peptic ulcer disease patients in Brazil. Helicobacter. 2005;10:601-608.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 41]  [Cited by in RCA: 43]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
39.  Rosenstock S, Jørgensen T, Bonnevie O, Andersen L. Risk factors for peptic ulcer disease: a population based prospective cohort study comprising 2416 Danish adults. Gut. 2003;52:186-193.  [PubMed]  [DOI]
40.  Leodolter A, Kulig M, Brasch H, Meyer-Sabellek W, Willich SN, Malfertheiner P. A meta-analysis comparing eradication, healing and relapse rates in patients with Helicobacter pylori-associated gastric or duodenal ulcer. Aliment Pharmacol Ther. 2001;15:1949-1958.  [PubMed]  [DOI]
41.  Moss S, Calam J. Helicobacter pylori and peptic ulcers: the present position. Gut. 1992;33:289-292.  [PubMed]  [DOI]
42.  al-Assi MT, Genta RM, Karttunen TJ, Graham DY. Ulcer site and complications: relation to Helicobacter pylori infection and NSAID use. Endoscopy. 1996;28:229-233.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 31]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
43.  Hansson LE, Nyrén O, Hsing AW, Bergström R, Josefsson S, Chow WH, Fraumeni JF, Adami HO. The risk of stomach cancer in patients with gastric or duodenal ulcer disease. N Engl J Med. 1996;335:242-249.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 483]  [Cited by in RCA: 420]  [Article Influence: 14.0]  [Reference Citation Analysis (1)]
44.  Malfertheiner P. The intriguing relationship of Helicobacter pylori infection and acid secretion in peptic ulcer disease and gastric cancer. Dig Dis. 2011;29:459-464.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 67]  [Cited by in RCA: 65]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
45.  Korman MG, Hansky J, Strickland RG. Progressive increase in the functional G cell mass with age in atrophic gastritis. Gut. 1973;14:549-551.  [PubMed]  [DOI]
46.  Kim HJ, Choi BY, Byun TJ, Eun CS, Song KS, Kim YS, Han DS. [The prevalence of atrophic gastritis and intestinal metaplasia according to gender, age and Helicobacter pylori infection in a rural population]. J Prev Med Public Health. 2008;41:373-379.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 21]  [Cited by in RCA: 21]  [Article Influence: 1.2]  [Reference Citation Analysis (6)]
47.  Kohli Y, Kato T, Suzuki K, Tada T, Fujiki N. Incidence of atrophic gastritis with age in Japan and Canada. Jpn J Med. 1987;26:158-161.  [PubMed]  [DOI]
48.  Sasidharan S, Lachumy SJ, Ravichandran M, Latha LY, Gegu SR. Epidemiology of Helicobacter pylori among multiracial community in Northern Peninsular, Malaysia: effect of age across race and gender. Asian Pac J Trop Med. 2011;4:72-75.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 17]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
49.  Hackelsberger A, Günther T, Schultze V, Peitz U, Malfertheiner P. Role of aging in the expression of Helicobacter pylori gastritis in the antrum, corpus, and cardia. Scand J Gastroenterol. 1999;34:138-143.  [PubMed]  [DOI]
50.  Ji X, Fernandez T, Burroni D, Pagliaccia C, Atherton JC, Reyrat JM, Rappuoli R, Telford JL. Cell specificity of Helicobacter pylori cytotoxin is determined by a short region in the polymorphic midregion. Infect Immun. 2000;68:3754-3757.  [PubMed]  [DOI]
51.  Amieva MR, El-Omar EM. Host-bacterial interactions in Helicobacter pylori infection. Gastroenterology. 2008;134:306-323.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 436]  [Cited by in RCA: 389]  [Article Influence: 21.6]  [Reference Citation Analysis (1)]
52.  Pagliaccia C, de Bernard M, Lupetti P, Ji X, Burroni D, Cover TL, Papini E, Rappuoli R, Telford JL, Reyrat JM. The m2 form of the Helicobacter pylori cytotoxin has cell type-specific vacuolating activity. Proc Natl Acad Sci USA. 1998;95:10212-10217.  [PubMed]  [DOI]
53.  Yamaoka Y, Reddy R, Graham DY. Helicobacter pylori virulence factor genotypes in children in the United States: clues about genotype and outcome relationships. J Clin Microbiol. 2010;48:2550-2551.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 21]  [Cited by in RCA: 26]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
54.  Banić M, Malfertheiner P, Babić Z, Ostojić R, Kujundzic M, Fatović-Ferenčić S, Plesko S, Petričušić L. Historical impact to drive research in peptic ulcer disease. Dig Dis. 2011;29:444-453.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 8]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
Footnotes

Peer reviewer: Mitsuo Shimada, Professor, Department of Digestive and Pediatric Surgery, Tokushima University, Kuramoto 3-18-15, Tokushima 770-8503, Japan

S- Editor Gou SX L- Editor Kerr C E- Editor Lu YJ

Write to the Help Desk