BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Clin Oncol. Jun 24, 2026; 17(6): 120188
Published online Jun 24, 2026. doi: 10.5306/wjco.120188
Compound Muji Granules enhances cisplatin efficacy against alpha-fetoprotein-producing gastric cancer by suppressing epidermal growth factor receptor signaling
Hui Li, Affiliated Tumor Hospital of Xinjiang Medical University, Urumqi 830000, Xinjiang Uygur Autonomous Region, China
Li Wang, Sen Zuo, Fourth Clinical Medical College of Xinjiang Medical University, Urumqi 830099, Xinjiang Uygur Autonomous Region, China
Wen-Ting He, Department of Oncology, Traditional Chinese Medicine Hospital of Xinjiang Uygur Autonomous Region, Urumqi 830000, Xinjiang Uygur Autonomous Region, China
Tong Zhang, Department of Oncology, Xiyuan Hospital of China Academy of Chinese Medical Sciences, Beijing 100091, China
ORCID number: Wen-Ting He (0000-0003-2160-1529); Tong Zhang (0009-0003-8964-8945).
Co-corresponding authors: Wen-Ting He and Tong Zhang.
Author contributions: Li H contributed to conceptualization, methodology, investigation, writing original draft; Wang L contributed to software, validation, formal analysis, writing review and editing; Zuo S contributed to software, data curation, visualization, writing review and editing; He WT contributed to writing review and editing, supervision, project administration, funding acquisition; Zhang T contributed to resources, writing review and editing, supervision, project administration; He WT and Zhang T contributed equally to this work as co-corresponding authors; all authors have read and approved the final manuscript and agree to be accountable for all aspects of the work.
AI contribution statement: The authors declare that no AI tools were used in the preparation of this manuscript or in the response to reviewers’ comments.
Supported by the Natural Science Foundation of Xinjiang Uygur Autonomous Region, No. 2022D01C561.
Institutional animal care and use committee statement: No human participants, identifiable human data, primary human tissues, or animals were involved in this study. No animals were involved; therefore, animal ethics approval were not required.
Conflict-of-interest statement: The authors declare that they have no conflict of interest.
Data sharing statement: The datasets generated and analyzed during the current study are available from the corresponding author on reasonable request.
Corresponding author: Tong Zhang, MD, Doctor, Department of Oncology, Xiyuan Hospital of China Academy of Chinese Medical Sciences, No. 1 Xiyuan Playground, Haidian District, Beijing 100091, China. ashtray45671@outlook.com
Received: February 24, 2026
Revised: April 22, 2026
Accepted: May 27, 2026
Published online: June 24, 2026
Processing time: 120 Days and 4.4 Hours

Abstract
BACKGROUND

Alpha-fetoprotein-producing gastric cancer (AFPGC) is an aggressive subtype with frequent liver and nodal metastases and poor outcomes. Resistance to standard chemotherapy is common. Compound Muji Granules (CMG), a traditional multi-component herbal formulation reported to reduce serum alpha-fetoprotein, has shown antitumor activity in solid tumors.

AIM

To evaluate the effects of CMG combined with cisplatin in AFPGC cells and investigated the role of the epidermal growth factor receptor (EGFR)-phosphatidylinositol 3-kinase (PI3K)-protein kinase B (AKT)-mammalian target of rapamycin (mTOR) pathway.

METHODS

The human AFPGC cell line FU97 was treated with CMG, cisplatin, or both. Proliferation (cell counting kit-8), alpha-fetoprotein secretion, cell-cycle distribution and apoptosis (flow cytometry), and migration and invasion (Transwell assays) were assessed. Expression of EGFR, PI3K, AKT, and mTOR was measured by quantitative real-time-polymerase chain reaction and Western blotting. Network pharmacology and molecular docking were used to identify putative CMG targets. An EGFR-overexpressing FU97 model was generated to test pathway dependence.

RESULTS

CMG reduced FU97 cell proliferation, migration, and invasion; lowered alpha-fetoprotein secretion; and induced G0-G1 arrest and apoptosis as compared with control. The combination of CMG and cisplatin produced greater growth inhibition and apoptosis than either agent alone (P < 0.05). Combination therapy down-regulated EGFR, PI3K, AKT, and mTOR at the transcript and protein levels, consistent with suppression of the EGFR-PI3K-AKT-mTOR pathway. In EGFR-overexpressing FU97 cells, CMG plus cisplatin retained antiproliferative and proapoptotic activity, indicating efficacy in an EGFR-driven context.

CONCLUSION

CMG suppresses AFPGC cell growth, induces cell-cycle arrest and apoptosis, enhances cisplatin activity, and inhibits the EGFR-PI3K-AKT-mTOR pathway, supporting further evaluation of CMG combined with chemotherapy in AFPGC.

Key Words: Compound Muji Granules; Alpha-fetoprotein-producing gastric cancer; Cisplatin; Epidermal growth factor receptor-phosphatidylinositol 3-kinase-protein kinase B-mammalian target of rapamycin pathway; FU97 cells

Core Tip: Compound Muji Granules (CMG) markedly inhibited proliferation, migration, and invasion of alpha-fetoprotein (AFP)-producing gastric cancer FU97 cells, reduced AFP secretion, and induced G0/G1 arrest and apoptosis. Notably, CMG combined with cisplatin produced stronger growth inhibition and pro-apoptotic effects than either agent alone. Network pharmacology and molecular docking identified epidermal growth factor receptor (EGFR) as a key CMG target, and quantitative real-time polymerase chain reaction/western blotting confirmed that the combination suppresses the EGFR-phosphatidylinositol 3-kinase-protein kinase B-mammalian target of rapamycin pathway at both messenger RNA and protein levels. Importantly, the antitumor activity of CMG plus cisplatin persisted in an EGFR-driven FU97 model, supporting CMG as a potential chemosensitizer for AFP-producing gastric cancer.



INTRODUCTION

Alpha-fetoprotein-producing gastric cancer (AFPGC) refers to gastric cancer with a serum alpha-fetoprotein (AFP) level ≥ 20 ng/mL or positive AFP immunohistochemistry. It is a special subtype with an extremely poor prognosis and high malignancy, accounting for 1.3%-15% of gastric cancers worldwide[1-3]. It exhibits aggressive biological behavior, is prone to liver and lymph node metastasis, and is easily confused with hepatocellular carcinoma, leading to misdiagnosis and mistreatment. Currently, there is a lack of effective treatment methods[4-6]. AFPGC has unique genomic features, such as higher mutation frequencies of TP53, ARID1A, KRAS, and a higher proportion of chromosomal instability[7], which are associated with a poor prognosis. The expression of protein markers vascular endothelial growth factor and c-Met is significantly higher than in ordinary gastric cancer, which is related to angiogenesis and liver metastasis[8]. The positive rate of thymidylate synthase is higher, suggesting resistance to fluorouracil-based chemotherapy[9], and even general resistance to commonly used chemotherapy drugs[10].

Studies have found that the median overall survival of AFPGC patients is only one-third of that of ordinary gastric cancer patients (hazard ratio = 3.00, P < 0.001); the higher the baseline AFP, the worse the patient’s survival. The 2024 Chinese Society of Clinical Oncology Gastric Cancer Guidelines list AFPGC separately for first-line treatment but only provide a class II recommendation for the SOX regimen combined with camrelizumab/apatinib. The class I recommendation remains blank, lacking guidelines and expert consensus[11]. AFPGC is currently considered a refractory gastric cancer. Therefore, Western medicine currently lacks effective treatment methods. AFP is both a tumor marker and an oncogene; inhibiting AFP may be key to controlling AFP-producing solid tumors. Compound Muji Granules (CMG) have a good effect on reducing AFP. CMG are derived from “Muji Tang” and are included in the ministerial standard “Chinese Patent Medicine Preparations”. The formula consists of Coriolus versicolor extract, Cuscuta chinensis, Sophora tonkinensis, and Juglans mandshurica cortex. Coriolus versicolor extract nourishes the liver, disperses nodules, strengthens the spleen, and removes dampness, serving as the “monarch” drug. Juglans mandshurica cortex clears heat and detoxifies, acting as the “minister” drug. Cuscuta chinensis and Sophora tonkinensis are bitter and cold, serving as “adjuvant and envoy” drugs. The entire formula softens the liver, strengthens the spleen, resolves dampness, and disperses nodules, achieving the effect of “supporting the righteous Qi without retaining evil, and eliminating evil without harming the righteous Qi”. It has been approved for use in various solid tumors such as digestive tract tumors, breast cancer, and lung cancer, with definite therapeutic effects[12-14], but its mechanism of action is still unclear.

This experiment will explore the anti-tumor mechanism of CMG combined with cisplatin (DDP) at the cellular level, specifically its effects on the proliferation and apoptosis of AFPGC FU97 cells, to investigate the effects of CMG combined with DDP on AFPGC and its molecular mechanism, in order to provide new ideas and experimental evidence for the treatment of AFPGC.

MATERIALS AND METHODS
Cell culture

Human AFPGC FU97 gastric cancer cells were obtained from Yaji Biological Co., Ltd. (Shanghai, China). The identity of the cell line was authenticated by short tandem repeat (STR) profiling using a 21-locus STR panel, and the profile showed a complete match with the FU97 reference profile in the Deutsche Sammlung von Mikroorganismen und Zellkulturen database. The STR authentication report is provided in the Supplementary material. Cells were routinely tested and confirmed to be mycoplasma-free before experiments. The cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37 °C in a humidified incubator containing 5% carbon dioxide.

Reagents and sources

CMG were supplied by Dandong Pharmaceutical Group Co., Ltd. (Dandong, Liaoning Province, China). DDP was purchased from Yunnan Plant Pharmaceutical Co., Ltd. (Yunnan Province, China). All reagents were used within their stated shelf life and prepared according to the manufacturers’ instructions.

Cell viability and half-maximal inhibitory concentration determination by cell counting kit-8 assay

FU97 cells were seeded in 96-well plates at a density of 5 × 104 cells/mL (100 μL/well). After adhering for 24 hours at 37 °C and 5% carbon dioxide, the culture medium was discarded. To determine the half-maximal inhibitory concentration (IC50), cells were treated with a concentration gradient of CMG (0 mg/mL, 1 mg/mL, 2 mg/mL, 4 mg/mL, 8 mg/mL, and 16 mg/mL) or DDP (0 μg/mL, 2 μg/mL, 4 μg/mL, 8 μg/mL, 16 μg/mL, and 32 μg/mL) for 48 hours. Cell viability was then measured using the cell counting kit-8 (CCK-8) assay, and IC50 values were calculated from dose-response curves using GraphPad Prism 8.0 software.

Based on the calculated IC50 values, subsequent experiments were performed using concentrations of approximately 1/2 × IC50 for CMG and DDP. Cells were divided into four groups: Control, CMG (2.0 mg/mL), DDP (4.0 μg/mL), and CMG + DDP (2.0 mg/mL CMG + 4.0 μg/mL DDP). The CMG and DDP groups were treated with their respective concentrations alone. The concentrations used in the combination treatment were selected based on approximately one-half of the IC50 values for each agent, maintaining a fixed ratio relative to their individual IC50 levels to evaluate potential synergistic effects. Each group had five replicates. After treatment, the medium was replaced with 100 μL of 10% CCK-8 solution and incubated for 1 hour. The optical density value at 450 nm was measured using a microplate reader.

Cell cycle and apoptosis analysis

Treated FU97 cells were collected, washed twice with pre-chilled phosphate-buffered saline (PBS), and the supernatant was discarded. The cells were resuspended in 500 μL of 1 × binding buffer and passed through a 200-mesh sieve to create a single-cell suspension. To each tube, 5 μL of Annexin V-phycoerythrin and 10 μL of 7-Aminoactinomycin D were added, mixed gently, and incubated at 4 °C in the dark for 10 minutes. Detection was performed using a flow cytometer within 30 minutes. Each group was repeated 3 times.

Transwell assay

Cells were washed sequentially with PBS and serum-free medium, then resuspended in serum-free medium and adjusted to an appropriate density. For the invasion assay, Matrigel was thawed at 4 °C in advance, diluted to 1 mg/mL with pre-chilled serum-free medium on ice. Then, 100 μL was added to the Transwell insert and incubated at 37 °C for 5 hours to allow it to gel. For the migration assay, inserts without Matrigel were used directly. 600 μL of complete medium was added to the lower chamber (bottom of the 24-well plate), and 100 μL of cell suspension was added to the upper chamber. Each group had 3 replicates and was incubated for 5 hours. After incubation, the inserts were carefully removed with forceps, washed twice with PBS, fixed with 4% formaldehyde at room temperature for 20 minutes, and washed twice again with PBS. The inserts were moved to a well containing 400 μL of Giemsa stain solution A and stained at room temperature for 1 minute, then 800 μL of solution B was added to continue staining for 5 minutes. After staining, the inserts were washed twice with PBS. Non-migrated/invaded cells on the upper surface were gently wiped away with a wet cotton swab, and the bottom surface was air-dried facing up. The inserts were placed on a glass slide, and the penetrated cells were observed and counted under a microscope.

Enzyme-linked immunosorbent assay

The expression of AFP in the supernatant of each group of cells was assessed using the corresponding enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer’s instructions.

Quantitative real-time polymerase chain reaction

Total RNA was extracted from each group of cells using Trizol. Complementary DNA was reverse-transcribed using the 5X All-In-One RT MasterMix kit. The relative messenger RNA expression of epidermal growth factor receptor (EGFR), PIK3R1, AKT1, and mammalian target of rapamycin (mTOR) was detected using the EvaGreen Express 2 × quantitative polymerase chain reaction (qPCR) MasterMix-Low Rox kit. qPCR was performed on a PCR detection system with the following conditions: Pre-denaturation at 95 °C for 3 minutes (1 cycle); Followed by 40 cycles of denaturation at 95 °C for 15 seconds and annealing at 60 °C for 1 minute. Finally, with glyceraldehyde-3-phosphate dehydrogenase as the internal control, the relative expression levels were calculated using the 2-ΔΔCt method (Table 1).

Table 1 Primer information for quantitative real-time polymerase chain reaction.
Primer name
Sequence (5’ to 3’)
EGFR-FAGGTGAAAACAGCTGCAAGG
EGFR-RCACAAACTCCCTTGGCTCAC
PIK3R1-FCGAGTGGTTGGGCAATGAAA
PIK3R1-RTTACTGCTCTCCCGGACAAG
AKT1-FCTGCCCTTCTACAACCAGGA
AKT1-RATGATCTCCTTGGCGTCCTC
mTOR-FGCAGCATTTTGTCCAGACCA
mTOR-RGTGCTCTCATTGATGCCCTG
hsa GAPDH-FTGTTGCCATCAATGACCCCTT
hsa GAPDH-RCTCCACGACGTACTCAGCG
Western blotting for protein expression

Cells were lysed using radio immunoprecipitation assay buffer containing complete protease and phosphatase inhibitors. The lysate was transferred to a 1.5 mL centrifuge tube and heat-denatured in 2 × Laemmli sample buffer. To concentrate the supernatant for western blotting, an equal volume of methanol and a quarter volume of chloroform were added, followed by centrifugation at 12000 rpm for 5 minutes at room temperature. After discarding the supernatant, the pellet was resuspended in an equal volume of methanol, centrifuged again, and dried at 55 °C for 5 minutes. The remaining pellet was resuspended in 1 × loading buffer and heated at 95 °C for 10 minutes. Samples were stored at -80 °C until use. Equal amounts of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane. The membrane was incubated with a primary antibody overnight at 4 °C, followed by incubation with a secondary antibody at room temperature. Immunoreactive bands were developed using an electrochemiluminescence substrate on an Azure Biosystems c500 imaging system. β-actin served as the loading control. FU97 cells were seeded in 6-well plates at a density of 1 × 105 cells/mL and cultured overnight. Each group received its respective intervention. After the intervention, cells were collected, washed once with PBS, and then collected. Total protein was extracted, and the expression of EGFR, PIK3R1, phosphorylated (p)-PIK3R1, AKT1, p-AKT1, mTOR, and p-mTOR proteins was detected by western blotting.

Statistical analysis

All experiments were performed at least three times independently. Data are expressed as mean ± SD. Statistical analyses were performed using SPSS 19.0. Differences among multiple groups were analyzed using one-way analysis of variance, followed by Tukey’s post hoc test for pairwise comparisons. A P value < 0.05 was considered statistically significant.

RESULTS
Regulation of FU97 cell phenotype by CMG combined with DDP

In the in vitro model constructed with FU97 cells, the CCK-8 assay revealed that after intervention with CMG, the proliferation viability of FU97 cells was significantly reduced compared to the control group (Figure 1A). The inhibition of cell proliferation was particularly evident after combination with DDP, with an inhibition rate reaching 0.583 ± 0.047 (P < 0.05). ELISA results showed that after combination with DDP, the secretion of AFP in the supernatant decreased to 1.175 ± 0.245 ng/mL, which was a significant reduction compared to the other three groups (Figure 1B, P < 0.05). Transwell assays showed that cell migration and invasion count in the CMG group were 62.000 ± 15.875 and 47.000 ± 1.000, respectively. In the control group, they were 108.000 ± 21.517 and 95.667 ± 10.504. In the DDP group, they were 32.333 ± 3.512 and 55.000 ± 8.718. In the CMG + DDP group, they were 25.000 ± 1.000 and 27.667 ± 4.041 (Figure 1C and D). In cell migration, the combination group showed a statistically significant difference compared to the control and CMG groups (Figure 1C, P < 0.05). The inhibition of cell invasion was most significant in the combination group, with statistical significance compared to the other three groups (Figure 1D, P < 0.05). These results indicate that CMG combined with DDP can significantly inhibit the migration and invasion of FU97 cells. After CMG intervention, the proportion of cells in the G0/G1 phase showed an upward trend to 50.77% (vs control group 49.80%, P > 0.05, Figure 1E). The combination with DDP arrested more FU97 cells in the G0/G1 phase, which was statistically significant compared to the other three groups (Figure 1E). Regarding apoptosis, CMG promoted the apoptosis of FU97 cells, increasing the apoptosis rate from 4.85% to 23.92% (Figure 1F, P < 0.05). This phenomenon was further enhanced when combined with DDP, showing a statistically significant difference between the two groups.

Figure 1
Figure 1 Effects of Compound Muji Granules combined with cisplatin on the phenotype of alpha-fetoprotein-producing gastric cancer FU97 cells. A: Cell proliferation; B: Alpha-fetoprotein secretion; C: Cell migration (representative images and quantification); D: Cell invasion (representative images and quantification); E: Cell cycle distribution; F: Cell apoptosis. aP < 0.05. bP < 0.01. cP < 0.001. OD: Optical density; AFP: Alpha-fetoprotein; CMG: Compound Muji Granules; DPP: Cisplatin; RMSD: Root mean square deviation; CV: Coefficient of variation; PE-A: Phycoerythrin-are.
Network pharmacology prediction of intervention pathways and regulation of AFPGC by CMG

The active ingredients and targets of CMG were extracted from the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform database. After matching the 935 targets of AFPGC with the 370 targets of CMG, an intersection of 137 potential targets for CMG in the treatment of AFPGC was obtained (Figure 2A). The 137 potential targets of CMG for AFPGC treatment were imported into the STRING database platform. After removing 13 proteins with no interactions, a protein-protein interaction network consisting of 124 nodes and 613 edges was obtained (Figure 2), where nodes represent potential targets. Cytoscape 3.8.2 was further used to calculate the topological parameters of the network nodes and screen for core targets. The average values for degree, cellular components (CC), and betweenness centrality (BC) were 9.89, 0.45, and 0.02, respectively. A first screening was performed based on the average of these three parameters, setting the criteria as degree ≥ 9.89, CC ≥ 0.45, and BC ≥ 0.02, resulting in 23 nodes above the average. Subsequently, a second screening was performed based on the average of these three parameters with thresholds set at degree ≥ 23.22, CC ≥ 0.48, and BC ≥ 0.05. This yielded 8 core targets, including TP53, AKT1, HSP90AA1, JUN, ESR1 HRAS, EGFR, and MAPK1 (Figure 2B). Enrichment analysis using R-cluster Profiler on the 137 intersection targets of CMG and AFPGC showed (P < 0.05): In Gene Ontology analysis, biological processes were mainly enriched in response to hypoxia, cellular response to environmental stimulus, etc.; CC were concentrated in structures like membrane microdomains and secretory granule lumen; Molecular functions were significantly enriched in kinase regulator activity, ubiquitin ligase binding, etc. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis revealed that key pathways included cancer-related pathways such as prostate cancer, hepatitis B, liver cancer, non-small cell lung cancer, as well as lipid metabolism and viral infection pathways[15,16]. These results suggest that CMG may intervene in AFPGC by regulating stress responses in the tumor microenvironment and cancer-related pathways (Figure 2C and D).

Figure 2
Figure 2 Network pharmacology analysis results. A: Venn diagram; B: Protein-protein interaction network; C: Gene Ontology enrichment analysis; D: Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. AFPGC: Alpha-fetoprotein-producing gastric cancer; CMG: Compound Muji Granules; AGE-RAGE: Advanced glycation end products-receptor advanced glycation end products; EGFR: Epidermal growth factor receptor; PI3K: Phosphatidylinositol 3-kinase; AKT: Protein kinase B.

Based on network pharmacology research, the EGFR/phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signal transduction pathway plays a crucial regulatory role in the malignant biological behavior of AFPGC cells, and abnormal activation of this pathway can significantly enhance the proliferation and invasion potential of tumor cells. To explore the interventional effect of CMG on tumor signaling pathways, this study systematically evaluated the transcriptional level changes of key nodes in the EGFR/PI3K/AKT signaling pathway in the FU97 cell line using quantitative real-time PCR (qRT-PCR), seen in Figure 3A. Western blot analysis further confirmed the inhibitory effect of CMG combined with DDP on the EGFR-PI3K-AKT-mTOR signaling pathway. As shown in Figure 3B and C, the protein expression levels of EGFR, PIK3R1, p-PIK3R1, AKT1, p-AKT1, mTOR, and p-mTOR were significantly decreased in the CMG + DDP group compared with the control, CMG, and DDP groups (P < 0.05). These results were consistent with the qRT-PCR findings.

Figure 3
Figure 3 Gene expression results. A: Relative expression levels detected by quantitative real-time reverse transcription polymerase chain reaction; B: Quantitative analysis of protein expression levels based on densitometric analysis of western blot bands; C: Representative western blot bands. aP < 0.05. bP < 0.01. cP < 0.001. CMG: Compound Muji Granules; DPP: Cisplatin; EGFR: Epidermal growth factor receptor; mTOR: Mammalian target of rapamycin; p-AKT1: Phosphorylated-AKT1; p-mTOR: Phosphorylated-mammalian target of rapamycin; p-PIK3R1: Phosphorylated-PIK3R1.
Molecular docking predicts potential targets of CMG in inhibiting AFPGC

Based on the results of network pharmacology analysis and molecular docking studies, it was shown that 33 out of the 34 active ingredients in CMG could form stable bonds with EGFR (Figure 4). Molecular docking binding energy analysis indicated that the a forementioned components have a significant binding affinity with EGFR (binding energy affinity < -8 kcal/mol) (Figure 5). Further mechanistic studies revealed that key active ingredients such as luteolin and kaempferol can effectively block the activation of downstream signaling pathways by competitively inhibiting EGFR kinase activity. This research result clarifies the material basis and mechanism of action of CMG in regulating the EGFR signaling pathway at the molecular level.

Figure 4
Figure 4 Heatmap of affinity values from molecular docking between active components of Compound Muji Granules and epidermal growth factor receptor. EGFR: Epidermal growth factor receptor.
Figure 5
Figure 5 Binding models of Compound Muji Granules active components with epidermal growth factor receptor showing docking affinity values < -8.
Verification of the regulatory effect of CMG combined with DDP on AFPGC through EGFR gain-of-function experiments

To further clarify the mechanism of CMG targeting EGFR, this study constructed an EGFR-overexpressing cell model using an EGFR-specific agonist. Experimental data showed a significant synergistic anti-tumor effect of CMG combined with DDP in FU97 cells. Cell function experiments showed that the combination therapy group exhibited stronger proliferation inhibition (35.4% vs 17.9%/22.0%), a higher rate of apoptosis induction (30.0% vs 17.2%/19.8%), and more significant G0/G1 phase arrest (66.7%) compared to the single-drug groups (CMG group, DDP group). In addition, the Transwell assay confirmed that the combination treatment significantly inhibited cell migration (72.7%) and invasion (71.0%) (P < 0.05). Western blot verification showed that the combined intervention of CMG and DDP effectively downregulated the expression of key proteins in the EGFR/PI3K/AKT/mTOR signaling pathway (EGFR, p-PIK3R1, p-AKT1, p-mTOR). These results suggest that CMG may enhance the therapeutic effect of DDP on AFPGC by targeting and inhibiting EGFR and its downstream signaling pathways, providing an experimental basis for clinical combination therapy.

DISCUSSION

AFPGC is a special type of gastric cancer with high invasiveness[17] and an extremely poor prognosis. Currently, there is no authoritative treatment method for AFPGC[18,19], and the guidelines only provide a single class II recommended therapy. To explore new treatment strategies for AFPGC, we, for the first time, reported the synergistic inhibitory effect of CMG combined with DDP on AFPGC FU97 cells through in vitro experiments, network pharmacology, and molecular docking techniques, revealing the potential mechanism of action. The results showed that, in terms of cell phenotype, CMG alone can inhibit the proliferation, migration, and invasion of FU97 cells, induce apoptosis, and arrest the cell cycle in the G0/G1 phase. When combined with DDP, the inhibitory effect on the cells was significantly enhanced. Mechanistic studies found that CMG may exert its anti-tumor effects by targeting EGFR and downstream genes to regulate the EGFR/PI3K/AKT/mTOR signaling pathway, providing a theoretical basis for the clinical treatment of AFPGC.

The inhibitory effect was further enhanced when CMG was used in combination with DDP. This result is consistent with previous research reports that traditional Chinese medicine formulas can enhance the sensitivity of chemotherapy drugs through multi-target effects and can act as potential sensitizers for chemotherapy in the treatment of malignant tumors[20]. At the same time, CMG combined with DDP can significantly increase the proportion of cells in the G0/G1 phase, exhibiting stronger cell cycle arrest than single drugs. However, cell cycle arrest is one of the main reasons for inhibiting cell proliferation[21,22].

AFP is both a tumor marker and an oncogene. Therefore, for AFPGC, AFP has both diagnostic and prognostic value. Studies have confirmed that the higher the baseline AFP level, the worse the prognosis. Conversely, the greater the decrease in AFP levels after treatment, the better the patient’s prognosis. It has been confirmed that the group with AFP > 1000 ng/mL has the strongest invasiveness, low long-term survival rate, a 5-year survival rate of 0, and a higher recurrence rate[23]. Comparing post-treatment AFP reduction of ≥ 50% vs < 50%, a more significant downward trend is associated with higher objective response rates and disease control rates in patients, with a significant statistical difference. In addition, high serum AFP levels are also related to a higher incidence of liver metastasis[24,25]. In a chemotherapy drug sensitivity test, it was found that AFPGC tumor cells with high AFP expression have significantly enhanced resistance to chemotherapy drugs such as DDP and 5-fluorouracil[20]. Drug resistance is also a major factor leading to poor prognosis. Therefore, reducing AFP levels is an effective means of treating AFPGC. This experiment found that after combining CMG with DDP, AFP levels decreased significantly compared to the single-drug groups. This study confirms that we expect that by reducing AFP levels, we can ultimately improve the prognosis of AFPGC patients and provide a theoretical basis for changing the diagnosis and treatment strategies for AFPGC.

Apoptosis is a form of programmed cell death that eliminates unwanted cells by fragmenting genomic DNA[26] and is fatal to cell survival. This study found that CMG treatment alone can induce apoptosis, and the apoptosis rate is further increased when combined with DDP. This pro-apoptotic effect may be related to the regulation of apoptosis-related proteins such as the Bax/Bcl-2 ratio and Caspase-3 activation. At the same time, these results suggest that CMG can enhance the chemosensitivity of DDP to AFPGC through a dual mechanism (pro-apoptosis + cycle arrest), which is consistent with previous research[26] where traditional Chinese medicine formulas could promote the apoptosis of ovarian malignant tumor cells through multiple targets.

To elucidate the multi-component, multi-target, multi-pathway mechanism of CMG, we used network pharmacology analysis to screen out 8 core targets (such as TP53, AKT1, EGFR, MAPK1, etc.), which are closely related to tumor proliferation, apoptosis, and drug resistance. KEGG pathway enrichment analysis showed that CMG may exert its anti-tumor effects by regulating the EGFR/PI3K/AKT/mTOR signaling pathway. This pathway has been shown to be abnormally activated in a variety of malignant tumors and plays an important promoting role in the occurrence and development of AFPGC[27,28]. It may also be involved in the chemotherapy resistance of AFPGC[29,30], thus becoming a potential therapeutic target. Studies have found that Bax is a pro-apoptotic gene in cells, while Bcl-2 is an anti-apoptotic gene. Abnormal activation of the PI3K/mTOR pathway can promote the expression of Bcl-2, inhibit the expression of Bax, and promote cell proliferation. Inhibiting the PI3K/AKT/mTOR pathway can promote the expression of Bax, inhibit the expression of Bcl-2, and promote apoptosis[31,32]. Yang et al[33] verified through flow cytometry, Western blotting, and other methods that inhibiting the expression of proteins such as PI3K, AKT, and mTOR in the PI3K/AKT/mTOR signaling pathway in gastric cancer cells can inhibit the proliferation of gastric cancer cells and improve patient prognosis. In this experiment, qRT-PCR and Western blot verification found that CMG + DDP can significantly downregulate the expression of EGFR and its downstream genes p-PIK3R1, p-AKT1, and p-mTOR in the EGFR/PI3K/mTOR signaling pathway, thereby providing a basis for the treatment of AFPGC patients.

To further verify the role of CMG in the context of high EGFR expression, we constructed an EGFR-overexpressing FU97 cell model. The results showed that even with upregulated EGFR expression, CMG + DDP could still significantly inhibit cell proliferation, migration, and invasion, and induce apoptosis and cycle arrest. Western blot analysis indicated that CMG can effectively inhibit the activation of the EGFR/PI3K/mTOR pathway, suggesting its broad-spectrum inhibitory effect on EGFR-driven tumors. This finding is particularly applicable to AFPGC patients with EGFR amplification and provides an experimental basis for personalized treatment.

There are some limitations in this study. Although network pharmacology identified several potential core targets such as TP53 and MAPK1, the present study mainly focused on validating the EGFR-related signaling pathway based on its central role in AFPGC progression. Future studies will further investigate other predicted targets to comprehensively elucidate the molecular mechanisms of CMG. And then, the current findings are based on in vitro experiments using a single cell line. Future studies including animal models and clinical investigations will be conducted to further validate the therapeutic potential of CMG.

CONCLUSION

By integrating molecular experiments with network pharmacology, this study systematically elucidates that CMG combined with DDP synergistically inhibits the proliferation and migration of AFPGC FU97 cells and induces their apoptosis by suppressing the EGFR/PI3K/mTOR pathway. Its traditional Chinese medicine theory of “strengthening the body’s resistance and eliminating pathogenic factors” aligns with the dual regulatory mechanism of immune modulation and signal pathway regulation, providing a new strategy for the integrated Chinese and Western medicine treatment of AFPGC. Its translational value needs to be further verified in future animal models and clinical trials.

References
1.  He L, Ye F, Qu L, Wang D, Cui M, Wei C, Xing Y, Lee P, Suo J, Zhang DY. Protein profiling of alpha-fetoprotein producing gastric adenocarcinoma. Oncotarget. 2016;7:28448-28459.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 17]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
2.  Wang D, Li C, Xu Y, Xing Y, Qu L, Guo Y, Zhang Y, Sun X, Suo J. Clinicopathological characteristics and prognosis of alpha-fetoprotein positive gastric cancer in Chinese patients. Int J Clin Exp Pathol. 2015;8:6345-6355.  [PubMed]  [DOI]
3.  Su JS, Chen YT, Wang RC, Wu CY, Lee SW, Lee TY. Clinicopathological characteristics in the differential diagnosis of hepatoid adenocarcinoma: a literature review. World J Gastroenterol. 2013;19:321-327.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 170]  [Cited by in RCA: 145]  [Article Influence: 11.2]  [Reference Citation Analysis (0)]
4.  Bourreille J, Metayer P, Sauger F, Matray F, Fondimare A. [Existence of alpha feto protein during gastric-origin secondary cancer of the liver]. Presse Med (1893). 1970;78:1277-1278.  [PubMed]  [DOI]
5.  Zhang YL, Yao Q, Deng JL, Zhou Y, Tang YH, Jin J. [Clinical features and prognosis of serum α-fetoprotein positive advanced gastric cancer]. Shijie Huaren Xiaohua Zazhi. 2016;24:2708-2712.  [PubMed]  [DOI]  [Full Text]
6.  Adachi Y, Tsuchihashi J, Shiraishi N, Yasuda K, Etoh T, Kitano S. AFP-producing gastric carcinoma: multivariate analysis of prognostic factors in 270 patients. Oncology. 2003;65:95-101.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 110]  [Cited by in RCA: 104]  [Article Influence: 4.5]  [Reference Citation Analysis (1)]
7.  Tian LT, Yao K, Wu A, Li L, Zhang ZC, Pei TM, Liu LX. [Retrospective Analysis of 32 Cases of Gastric Cancer with Alpha-Fetoprotein]. Zhongguo Xiandai Putong Waike Jinzhan. 2011;14:441-445, 453.  [PubMed]  [DOI]  [Full Text]
8.  Liu D, Li B, Yan B, Liu L, Jia Y, Wang Y, Ma X, Yang F. The clinicopathological features and prognosis of serum AFP positive gastric cancer: a report of 16 cases. Int J Clin Exp Pathol. 2020;13:2439-2446.  [PubMed]  [DOI]
9.  Nagai E, Ueyama T, Yao T, Tsuneyoshi M. Hepatoid adenocarcinoma of the stomach. A clinicopathologic and immunohistochemical analysis. Cancer. 1993;72:1827-1835.  [PubMed]  [DOI]  [Full Text]
10.  Giustozzi G, Goracci G, Bufalari A, Lauro A, Cirocchi R, Boselli C, Bartoli A, Monacelli M, Giansanti M, Moggi L. Hepatoid carcinoma of the stomach: is it still an unusual anatomo-clinical entity? Six cases-report. J Exp Clin Cancer Res. 1999;18:571-573.  [PubMed]  [DOI]
11.  Chang YC, Nagasue N, Abe S, Kohno H, Kumar DD, Nakamura T. alpha Fetoprotein producing early gastric cancer with liver metastasis: report of three cases. Gut. 1991;32:542-545.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 46]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
12.  Duan R, Hou Y, Wang Y. [Clinical Analysis of 364 Cases of Advanced Malignant Tumors Treated with Compound Muji Mixture]. Zhongguo Zhongyiyao Xinxi Zazhi. 2006;13:54.  [PubMed]  [DOI]  [Full Text]
13.  Hao X, Sun J. [Inhibitory effect of Muji Chongji on growth of carcinoma cell lines]. Zhongguo Xiandai Yaowu Yingyong. 2008;2:13-15.  [PubMed]  [DOI]  [Full Text]
14.  Yu X, Wang Y, Wan S, Liu H, Zhang X, Xing R. [Inhibitory Effect of Compound Muji Granules on Human Colon Cancer Cells with Different p53 Genotypes]. Zhongguo Bingli Shengli Zazhi. 2015;31:1846.  [PubMed]  [DOI]  [Full Text]
15.  Kanehisa M. Toward understanding the origin and evolution of cellular organisms. Protein Sci. 2019;28:1947-1951.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 986]  [Cited by in RCA: 3703]  [Article Influence: 529.0]  [Reference Citation Analysis (3)]
16.  Kanehisa M, Furumichi M, Sato Y, Matsuura Y, Ishiguro-Watanabe M. KEGG: biological systems database as a model of the real world. Nucleic Acids Res. 2025;53:D672-D677.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 1811]  [Article Influence: 1811.0]  [Reference Citation Analysis (1)]
17.  Luo B, Wu Z, Hu C, Xie W, He J, Liu H, Cao D, Liu Y, Zhong Y, Gong W. Alpha fetoprotein (AFP)-producing gastric cancer: clinicopathological features and treatment strategies. Cell Biosci. 2025;15:82.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5]  [Cited by in RCA: 8]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
18.  Zan L, Zhang X, Shen L, Zhao Q, Tan D, Peng X, Jia Y, Li J, Liu J, Zhao J, Gao N, Bu P, Xi Y. Genomic landscape and potential therapeutic targets in alpha-fetoprotein-producing gastric cancer. Gastric Cancer. 2025;28:372-383.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 8]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
19.  Ota T, Sakashita K, Sawada R, Seki K, Maeda H, Tanaka N, Tsujinaka T. Long-term survival with nivolumab followed by irinotecan after total gastrectomy in alpha-fetoprotein-producing gastric cancer: a case report and review of the literature. Surg Case Rep. 2023;9:71.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 6]  [Reference Citation Analysis (0)]
20.  Mei Y, Li M, Wen J, Li J, Kong X. [Regulatory mechanism of alpha fetoprotein expression in alpha-fetoprotein-producing gastric cancer and its relationship with malignant phenotype]. Shiyong Zhongliu Zazhi. 2023;38:528-536.  [PubMed]  [DOI]  [Full Text]
21.  Iida K, Naiki T, Naiki-Ito A, Suzuki S, Kato H, Nozaki S, Nagai T, Etani T, Nagayasu Y, Ando R, Kawai N, Yasui T, Takahashi S. Luteolin suppresses bladder cancer growth via regulation of mechanistic target of rapamycin pathway. Cancer Sci. 2020;111:1165-1179.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 33]  [Cited by in RCA: 79]  [Article Influence: 13.2]  [Reference Citation Analysis (0)]
22.  Ma J, Chen X, Zhu X, Pan Z, Hao W, Li D, Zheng Q, Tang X. Luteolin potentiates low-dose oxaliplatin-induced inhibitory effects on cell proliferation in gastric cancer by inducing G(2)/M cell cycle arrest and apoptosis. Oncol Lett. 2022;23:16.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 17]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
23.  Zhan Z, Chen B, Yu J, Zheng J, Zeng Y, Sun M, Peng L, Guo Z, Wang X. Elevated Serum Alpha-Fetoprotein Is a Significant Prognostic Factor for Patients with Gastric Cancer: Results Based on a Large-Scale Retrospective Study. Front Oncol. 2022;12:901061.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 19]  [Reference Citation Analysis (0)]
24.  Wang R, Li J, Xu D, Li R, Gong P. Dynamic Change in Serum Alpha-fetoprotein Level Predicts Treatment Response and Prognosis of Alpha-fetoprotein-producing Gastric Cancer. Medicine (Baltimore). 2020;99:e23326.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 13]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
25.  Takayama-Isagawa Y, Kanetaka K, Kobayashi S, Yoneda A, Ito S, Eguchi S. High serum alpha-fetoprotein and positive immunohistochemistry of alpha-fetoprotein are related to poor prognosis of gastric cancer with liver metastasis. Sci Rep. 2024;14:3695.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 11]  [Reference Citation Analysis (0)]
26.  Peng C, Wang Y, Guo Y, Li J, Liu F, Fu Y, Yu Y, Zhang C, Fu J, Han F. A literature review on signaling pathways of cervical cancer cell death-apoptosis induced by Traditional Chinese Medicine. J Ethnopharmacol. 2024;334:118491.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 10]  [Reference Citation Analysis (0)]
27.  Röcken C. Predictive biomarkers in gastric cancer. J Cancer Res Clin Oncol. 2023;149:467-481.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 150]  [Cited by in RCA: 134]  [Article Influence: 44.7]  [Reference Citation Analysis (13)]
28.  Liang J, Chen J, Hua S, Qin Z, Lu J, Lan C. Bioinformatics analysis of the key genes in osteosarcoma metastasis and immune invasion. Transl Pediatr. 2022;11:1656-1670.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 12]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
29.  Ashrafizadeh M, Mohan CD, Rangappa S, Zarrabi A, Hushmandi K, Kumar AP, Sethi G, Rangappa KS. Noncoding RNAs as regulators of STAT3 pathway in gastrointestinal cancers: Roles in cancer progression and therapeutic response. Med Res Rev. 2023;43:1263-1321.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 10]  [Cited by in RCA: 72]  [Article Influence: 24.0]  [Reference Citation Analysis (1)]
30.  Kamata S, Kishimoto T, Kobayashi S, Miyazaki M, Ishikura H. Possible involvement of persistent activity of the mammalian target of rapamycin pathway in the cisplatin resistance of AFP-producing gastric cancer cells. Cancer Biol Ther. 2007;6:1036-1043.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 21]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
31.  Kim SJ, Lee HW, Baek JH, Cho YH, Kang HG, Jeong JS, Song J, Park HS, Chun KH. Activation of nuclear PTEN by inhibition of Notch signaling induces G2/M cell cycle arrest in gastric cancer. Oncogene. 2016;35:251-260.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 51]  [Cited by in RCA: 85]  [Article Influence: 7.7]  [Reference Citation Analysis (0)]
32.  Tao T, Yang X, Zheng J, Feng D, Qin Q, Shi X, Wang Q, Zhao C, Peng Z, Liu H, Jiang WG, He J. PDZK1 inhibits the development and progression of renal cell carcinoma by suppression of SHP-1 phosphorylation. Oncogene. 2017;36:6119-6131.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 35]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
33.  Yang J, Ma J, Yan J. [Effects of tripterine on the proliferation and apoptosis of gastric cancer MFC cells by regulating PI3K/AKT/mTOR signaling pathway]. Xiandai Yaowu Yu Linchuang. 2020;35:1517-1523.  [PubMed]  [DOI]  [Full Text]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade B, Grade B

Novelty: Grade B, Grade C

Creativity or innovation: Grade C, Grade C

Scientific significance: Grade B, Grade C

P-Reviewer: Li LB, Professor, China; Yayla M, PhD, Associate Professor, Türkiye S-Editor: Fan M L-Editor: A P-Editor: Yang YQ

Write to the Help Desk