Identification of miR-802-5p and its involvement in type 2 diabetes mellitus

Table 1 Represents the characteristics of mature miR- 802-5p

Source miRNA	Source organism	PL	MFE ∆ G	MS	Strand	A + U, %
hsa-miR-802	Homo sapiens	94	-22.90	CAGUAACAAAGAUUCAUCCUUGU	3’	70

PL: Pre-miRNA length; MFE: Minimal free energy; MS: Mature sequence.

Table 2 Represents the targets of hsa-miR-802-5p based on target scan analysis

SI. No.	Target gene	Representative transcript	Gene name	Representative miRNA
1	TMED9	ENST00000332598.6	Transmembrane emp24 transport domain containing 9	hsa-miR-802
2	PCNP	ENST00000296024.5	PEST proteolytic signal containing nuclear protein	hsa-miR-802
3	C3orf58	ENST00000441925.2	Chromosome 3 open reading frame 58	hsa-miR-802
4	NUS1	ENST00000368494.3	Nuclear undecaprenyl pyrophosphate synthase 1 homolog	hsa-miR-802
5	ZNF597	ENST00000301744.4	Zinc finger protein 597	hsa-miR-802

PEST: Proline (P), glutamic acid (E), aspartic acid (D) and serine (S)/threonine (T).