T(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas are heterogeneous with respect to the VH gene mutation status

Table 1 Clinical details of cases with t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas

Case	Age (yr)	Sex	Hp	Site	Stage	Therapy	Follow-up data
1	60	F	+	Stomach	IE	Surg	CR
2	40	M	+	Stomach	II	Surg + RT	CR
3	50	M	+	Stomach	II	Surg + RT	CR
4	52	M	+	Stomach	IE	Surg	CR
5	42	M	+	Stomach	IE	Surg	CR
6	46	M	+	Small intestine	IE	Surg	Relapse in stomach 1 year after initial diagnosis, with PR and SD after (recurrent) therapy (surg, RT, CT, Hp eradication)
7	52	M	-	Stomach	IE	Surg	Relapse in lung 8 years after initial diagnosis with CR after secondary treatment (CT)

Surg: Surgerical resection; RT: Radiotherapy; CT: Chemotherapy; CR: Complete response; PR: Partial response; SD: Stable disease; Hp: Helicobacter pylori.

Table 2 Panel of primary antibodies used in immunohistochemical techniques

Antibody	Clone	Company	Dilution	Specificity
CD20	L26	Dakocytomation, Denmark	1/100	pan-B cell marker
CD3	-	Dakocytomation, Denmark	1/50	pan-T cell marker
CD5	Leu1	Becton, Dickinson and Company, US	1/5	pan-T cell marker, some B cell lymphomas
CD10	56C6	Novocastra, UK	1/20	GC B cells, GC B cell lymphomas
CD23	1B12	Novocastra, UK	1/10	Mature B cells, dendritic cells
CD27	137B4	Novocastra, UK	1/50	T cells, activated B cells
IgM	R1/69	Dakocytomation, Denmark	1/5000	B cells
IgD	IgD26	Dakocytomation, Denmark	1/10	B cells
Kappa	163-42	Becton, Dickinson and Company, US	1/25	B cells
Lambda	1-155-2	Becton, Dickinson and Company, US	1/100	B cells

Table 3 Primer sequences

Primer	Sequence
VH1-FR1	5’CCTCAGTGAAGTCTCCTGCAAGG 3’
VH2-FR1	5’TCCTGCGCTGGTGAAAGCCACACA 3’
VH3-FR1	5’GGTCCCTGAGACTCTCCTGTGCA 3’
VH4-FR1	5’TCGGAGACCCTGTCCCTCACCTGCA 3’
VH5-FR1	5’GAAAAAGCCCGGGGAGTCTCTGGA 3’
VH6-FR1	5’CCTGTGCCATCTCCGGGGACAGTG 3’
JH	5’ACCTGAGGAGACGGTGACC 3’
IgH FR3	5’CTGTCGACACGGCCGTGTATTACTG 3’

Table 4 Immunohistochemical staining data

Case	CD20	CD3	CD5	CD10	CD23	CD27	IgM	IgD	Igκ/Igλ
1	+	-	-	-	-	-	+	-/+	Igκ
2	+	-	-	-	-	+	+	-	Igλ
3	+	-	-	-	-	++	+	-	Igκ
4	+	-	-	-	-	+	+	-	Igκ
5	+	-	-	-	-	++	+	-	Igλ
6	+	-	-	-	-	++	+	-	Igκ
7	+	-	-	-	-	++	+	-/+	Igκ

Table 5 Usage of the rearranged V_H, D_H and J_H gene segments and V_H mutation analysis of gastric MALT-type lymphoma, characterised by the presence or absence of the API2-MALT1 fusion abnormality

Case	API2-MALT1	Germline VH		Identity (%)	Obs R/S CDR	Obs R/S FR	Exp R/S CDR	Exp R/S FR	pCDR	pFR	DH	JH
		Locus	Name
1	+	VH3-30	DP-49	92.4	4/2	5/4	3/1	8/3	0.217	0.062	DH3-10	JH3
2	+	VH3	HHG4	97.7	1/2	0/1	1/0	2/1	0.421	-	NI	JH4
3	+	VH1-69	DP-10	85.3	11/3	11/4	7/2	15/5	0.030	0.040	DH1-1	JH5
4	+	VH4-34	DP-63	98.7	0/0	1/2	1/0	2/1	-	0.352	NI	JH6
5	+	VH4-39	DP-79	98.6	0/0	0/3	1/0	2/1	-	-	NI	JH4
61	+	VH3-33	DP-50	100	0/0	0/0	-	-	-	-	DH1-20	JH6
7	+	VH3-30	DP-49	95.1	5/0	2/2	2/1	5/2	0.030	0.048	DH3-10	JH4

¹Results obtained on the diagnostic intestinal biopsy as well as on a gastric biopsy after 54 mo follow-up; V_H genes: Immunoglobulin heavy chain variable gene; R: Replacement mutation; S: Silent mutation; CDR: Complementarity determining regions; FR: Framework regions; Obs R/S CDR and Obs R/S FR: Number of the observed R and S mutations in the CDR and FR, respectively; Exp R/S CDR and Exp R/S FR: Number of expected R and S mutations in the CDR and FR, respectively; pCDR and pFR: Probability that excess or scarcity of the R mutations in the V_H gene CDR or FR resulted from chance only; P values < 0.05 were considered statistical significant; NI: Not identified. V_H sequences were compared with germline V_H sequences included in the VBASE sequence directory.