Published online Jul 15, 2024. doi: 10.4251/wjgo.v16.i7.3158
Revised: April 25, 2024
Accepted: May 17, 2024
Published online: July 15, 2024
Processing time: 210 Days and 13 Hours
Chronic atrophic gastritis (CAG) is a prevalent chronic gastritis usually accom
To investigate the pharmacological effects of Yiqi Jiedu Huayu decoction (YJHD) on precancerous lesions of CAG.
A CAG rat model was established by Helicobacter pylori bacteria solution combined with N-methyl-N’-nitro-N-nitrosoguanidine. Histopathological measurements were conducted by hematoxylin-eosin and alcian blue and periodic acid-Schiff staining. Serum levels of inflammatory factors and gastric mucosal-related factors were examined using enzyme-linked immunosorbent assay. Protein and mRNA levels were quantified via western blot and quantitative real-time polymerase chain reaction analysis, respectively. Molecular interaction was verified by chromatin immunoprecipitation (ChIP) assay.
YJHD greatly attenuated pathological changes in the gastric mucosa and precancerous lesions in CAG rats. Meanwhile, YJHD treatment reduced serum levels of inflammatory factors [interleukin (IL)-6, tumor necrosis factor-α and C-reactive protein] and increased serum levels of gastric mucosal-related factors (gastrin, pepsin, somatostatin and prostaglandin E2) in CAG rats. In addition, YJHD administration suppressed NLRP3 inflammasome-mediated cell pyroptosis, as well as the activation of TLR4/NF-κB and IL-6/STAT3 signaling pathways. Mechanically, ChIP experiments confirmed that NLRP3 transcription was regulated by TLR4/NF-κB and IL-6/STAT3 signaling.
Taken together, YJHD alleviated NLRP3 inflammasome formation and pyroptosis of epithelial cells in CAG, potentially through the inactivation of TLR4/NF-κB and IL-6/STAT3 pathways.
Core Tip: Yiqi Jiedu Huayu decoction (YJHD), an empirical formula comprising multiple traditional Chinese medicines, has demonstrated efficacy in preventing and treatment of human gastrointestinal tumors. However, its impact on precancerous lesion of gastric cancer (PLGC) remains poorly understood, making this study significant. Here, we found that YJHD treatment markedly inhibited PLGC. Additionally, our experiments indicated that YJHD inhibited NLRP3 inflammasome formation and pyroptosis of epithelial cells in chronic atrophic gastritis by deactivating the TLR4/NF-κB and IL-6/STAT3 pathways.
- Citation: Zhou P, Zheng ZH, Wan T, Liao CW, Wu J. Yiqi Jiedu Huayu decoction inhibits precancerous lesions of chronic atrophic gastritis by inhibiting NLRP3 inflammasome-mediated pyroptosis. World J Gastrointest Oncol 2024; 16(7): 3158-3168
- URL: https://www.wjgnet.com/1948-5204/full/v16/i7/3158.htm
- DOI: https://dx.doi.org/10.4251/wjgo.v16.i7.3158
Chronic atrophic gastritis (CAG) is a common and precancerous condition of digestive tract characterized by chronic inflammation, mucosal atrophy, and glandular depletion[1]. It is recognized as a precursor of gastric cancer (GC)[2]. The transition from CAG to GC is characterized by dysplasia of gastric mucosa and intestinal metaplasia, known as precancerous lesion of GC (PLGC)[3]. PLGC represents a crucial stage in the progression from inflammation to carcinoma in the stomach. Chronic infection with Helicobacter pylori (H. pylori) is a significant contributor to the development of GC through the progression of precancerous CAG[4], emphasizing its role in the inflammation-to-carcinoma transformation in the stomach. Understanding the molecular mechanism underlying H. pylori-induced gastric “inflammation-carcinoma transformation” is essential for identifying new therapeutic targets to effectively intervene in PLGC.
Pyroptosis, a form of programmed cell death often referred to as inflammatory necrosis, has gradually become a focus of research interest[5]. NLRP3 inflammasome, composed of regulatory subunit NLRP3, adaptor apoptosis-associated speck-like protein and effector caspase 1, plays a crucial role in innate immunity by mediating caspase-1 activation and the subsequent secretion of interleukin (IL)-1β/IL-18, leading to induce pyroptosis[6]. It has been reported that NLRP3 activation-mediated pyroptosis is involved in the procession of gastric mucosal “inflammation-carcinoma trans
Yiqi Jiedu Huayu decoction (YJHD), an empirical formula which consists of astragalus, codonopsis radix, Atractylodes and Panax notoginseng[9], has demonstrated diverse pharmacological effects in preclinical and clinical trials, including anti-inflammation, antioxidant, anticancer and oxidative stress[10,11]. Notably, YJHD has shown promise in the in prevention and treatment of human malignant tumors, including gastrointestinal tumors. As revealed by Zhuang et al[12], YJHD inhibited metastasis of colon adenocarcinoma by suppressing epithelial-mesenchymal transition and cellular plasticity. Likewise, YJHD administration inhibits GC cell invasion and metastasis and reduces the risk of postoperative recurrence and metastasis of GC[9,13]. Nevertheless, the specific roles and regulatory pathway of YJHD in CAG remain unknown, which deserves further research.
In the present work, we established a CAG rat model in vivo by H. pylori bacteria solution combined with N-methyl-N’-nitro-N-nitrosoguanidine (MNNG). Following YJHD administration, we evaluated histopathological changes, inflammatory response and NLRP3 inflammasome-mediated pyroptosis in gastric mucosa. Our findings uncovered that YJHD treatment greatly alleviated gastric mucosal glandular atrophy, intestinal metaplasia and inflammatory infiltration through repressing NLRP3-mediated pyroptosis and inflammatory signaling pathways. Our research sheds light on the potential of YJHD as a preventive measure against gastric inflammation-to-carcinoma transformation and elucidates its underlying mechanism of action.
SJA Laboratory Animal Co, Ltd. (Hunan, China) provided 30 SD rats aged 8 wk, weighting 200-250 g. The rats were kept in a SPF facility maintained at a temperature of 25 ± 0.5 °C, humidity of 55 ± 5%, and a 12-h light-dark cycle. They were provided with free access to food and water for 1 wk to acclimatize. Subsequently, all rats were randomly assigned into three groups: The control group, the model group and the model + YJHD group, each comprising ten animals. The CAG with precancerous lesion model was induced in rats using MNNG and H. pylori. In brief, rats in the model group and the model + YJHD group were given 2% NaHCO3 by gavage on the first day, followed by H. pylori solution (1 × 109 CFU in 1 mL per rat) 1 h later. On the second day, the rats were allowed free access to food and water, followed by fasting on the third day. This cycle was repeated four times. All rats underwent a 12-h fasting period without food and a 4-h fasting period without water before intragastric administration. After H. pylori inoculation, the rates were allowed to feed normally. Rats in the control group were given phosphate-buffered saline (1 mL) by gavage and provided free access to food and water. Afterwards, rats in the model group and the model + YJHD group were administrated with MNNG (600 μg/mL) every other day for 8 wk. The rats in the model + YJHD group were additionally treated with YJHD (16.07 g/kg) by gavage once a day for 4 consecutive weeks. Control group and Model group rats were gavage equal volume normal saline at the same frequency. Following the completion of the drug treatment regimen, the rats were sacrificed under anesthesia with isoflurane (Pfizer Japan, Tokyo, Japan), and gastric tissues and blood samples were collected. All tissues were stored at -80 °C. All operators are unaware of both the experimental grouping and the experimental procedure. The animal studies were approved by Jiangxi Provincial People's Hospital (APPROVAL NUMBER: No. KT086, 30 October 2023).
The gastric tissue block was fixed overnight in 4% paraformaldehyde. Following fixation, the tissue block was embedded in paraffin and sectioned to a thickness of 4 μm. The sections underwent dehydration by immersion in various concentrations of ethanol. Subsequently, the sections were stained with hematoxylin-eosin (HE) (Sigma-Aldrich, MO, United States). The histopathological changes in gastric mucosal injury were then observed and photographed using an Olympus microscope (Tokyo, Japan).
The paraffin sections of gastric tissues with a thickness of 4 μm were prepared. These specimens were stained with Alcian blue and periodic acid-Schiff (AB-PAS) (BASO, Guangdong, China). The gastrointestinal metaplasia was detected and photographed under an Olympus microscope.
The paraffin-embedded sections (4 μm) were dried at 62 °C, for 30 min and then deparaffinized by increasing concentrations of ethanol. Following deparaffinization and antigen retrieval (Dako, CA, United States), the sections were then blocked and incubated with antibodies against Ki67 (Abcam, Cambridge, United Kingdom, ab16667) and NLRP3 (Abcam, ab263899) overnight followed by a 1-hour incubation with the secondary antibody (Abcam, 1:500, ab150077). DAB was used to stain the sections, which were subsequently counterstained with hematoxylin before being dehydrated and mounted. The photographs were obtained with an Olympus microscope.
The levels of C-reactive protein (CRP), tumor necrosis factor-α (TNF-α), IL-1β, IL-6 and IL-18 were examined by enzyme-linked immunosorbent assay (ELISA) kits purchased from Beyotime (Shanghai, China). The levels of gastrin (GAS), somatostatin (SS), prostaglandin E2 (PGE2) and pepsin (PP) were examined by ELISA kits purchased from Yaji Biotechnology Co., Ltd (Shanghai, China). All experimental steps were carried out in accordance with the corresponding manufacturer’s protocol. The optical density value was measured and recorded by a microplate spectrophotometer (Bioteke, Beijing, China).
Total RNA was extracted from the samples using the TRIzol reagent (ThermoFisher Scientific, MA, United States), and then was reverse-transcribed to cDNA via the Reverse Transcription Kit (Toyobo, Tokyo, Japan). Quantitative real-time polymerase chain reaction (qRT-PCR) was conducted using SYBR (ThermoFisher Scientific). The housekeeping gene GAPDH was employed as the reference gene. The data were analyzed using 2−ΔΔCT method. The primers used in the study were listed in Table 1.
| Gene | Forward (5‘-3’) | Reverse (5‘-3’) |
| NLRP3 | GTAGGTGTGGAAGCAGGACT | CTTGCTGACTGAGGACCTGA |
| IL-18 | ATGCCTGATATCGACCGAAC | TGGCACACGTTTCTGAAAGA |
| IL-1β | ACAGCAATGGTCGGGACATA | TGAGAGACCTGACTTGGCAG |
| GAPDH | GCAAGTTCAACGGCACAG | GCCAGTAGACTCCACGACAT |
The total proteins were isolated with RIPA buffer (Beyotime) and quantified using a BCA kit (Beyotime). The proteins (20 μg) were subsequently separated by 10% SDS-PAGE and transferred onto a PVDF membrane (Millipore, MA, United States). The membranes were then blocked and incubated overnight with antibodies against TLR4 (Abcam, ab22048), p65 (Cell Signaling Technology, MA, United States, 8242), p-p65 (Abcam, ab76302), STAT3 (Abcam, ab68153), p-STAT3 (Abcam, ab76315) and β-actin (Abcam, ab8226). Following primary antibody incubation, the membranes were hybridized with the secondary antibody (Abcam, 1:5000, ab7090) for 60 min. The protein bands were developed by ECL and then visualized by a GEL imaging system (Bio-Rad, CA, United States) and subsequently analyzed with ImageJ software.
ATCC (VA, United States) provided the human gastric epithelial cells (GES-1 cells). All cells were grown in DMEM (Gibco, MD, United States) containing 10% FBS (Gibco) at 37 °C in a humidified atmosphere with 5% CO2.
Cells were fixed and quenched, and DNA was fragmented by sonication. The cell lysates were then treated overnight at 4 °C with specific antibodies such as anti-H3K9ac (Abcam, ab177177), anti-p-STAT3 (Abcam, ab32143), anti-p-p65 (Abcam, ab76302) or anti-IgG (Abcam, ab172730). Protein A/G PLUS Agarose (Santa Cruz, TX, United States) was used to isolate chromatin-antibody complexes. DNA fragments was purified and analyzed using qRT-PCR.
The experimental data obtained from rats were derived from three independent experiments, while data at the cellular level were repeated three times. Data were expressed as mean ± SD, and statistical analysis was conducted using SPSS 19.0. Shapiro-Wilk test was conducted for the normality assumption test. When the data is normally distributed, the differences between the two groups were accessed using student’s t-tests. One-way ANOVA followed by Tukey’s post hoc was performed to compare differences among multiple groups. If not, Kruskal-Wallis H test was used. Statistical significance was defined as P < 0.05.
To assess the potential of YJHD in regulating precancerous lesions associated with CAG, we established a rat model of CAG with precancerous lesion by oral administration of MNNG and H. pylori bacterial solution. As shown in Figure 1A and B, the model rats exhibited a significant reduction in body weight and daily food intake compared to the control rats. However, these changes were effectively reversed following YJHD treatment. HE staining clearly revealed various pathological alterations in gastric mucosa of model rats, including glandular atrophy, sparse and disordered glandular arrangement, reduced gland numbers, structural destruction to submucosal layer, intrinsic muscle layer, and serosal layer of the gastric wall, and significant infiltration of inflammatory cells in all components of the gastric wall. Remarkably, these histopathologic manifestations of model rats were markedly alleviated in rats treated with YJHD (Figure 1C). Furthermore, AB-PAS staining indicated the presence of gastric intestinal metaplasia in the pylorus of model rats, which was reversed upon YJHD treatment (Figure 1D). Additionally, immunohistochemical analysis suggested a significant increase in Ki67 expression in the gastric mucosa of model rats, indicative of increased cellular proliferation. However, YJHD administration resulted in a reduction in Ki67 expression (Figure 1E). Collectively, YJHD treatment effectively ameliorated gastric mucosal pathology and inflammatory injury of CAG rats with precancerous lesions.
To further elucidate the curative role of YJHD on CAG rats, we accessed the gastric mucosa secreted cytokines and pro-inflammatory factors. As shown in Figure 2A-C, the serum levels of inflammatory factors such as IL-6, TNF-α and CRP were markedly increased in model rats compared to control rats. However, YJHD treatment effectively attenuated these increases, bringing the levels back to near-control values. Moreover, compared to the control group, the serum levels of gastric mucosal-related factors like GAS, PP, SS and PGE2 were significantly decreased in model rats. Notably, YJHD administration resulted in a substantial elevation of these factors, indicating a restoration of gastric mucosal homeostasis (Figure 2D-G).
To elucidate the effects of YJHD on NLRP3 inflammasome activation and pyroptosis, we conducted further investigations. Firstly, analysis of pyroptosis-related inflammatory factors including IL-18 and IL-1β revealed a significant elevation in their levels in model rats compared with those in the control rats (Figure 3A and B). However, YJHD administration greatly impeded these cytokines levels (Figure 3A and B), indicating a suppression of pyroptosis. Subsequent immunohistochemistry (IHC) detection revealed that NLRP3 level in gastric mucosa in model group rats was markedly increased compared to the control group. Notably, YJHD administration remarkably reduced NLRP3 expression (Figure 3C), indicating inhibition of NLRP3 inflammasome activation. Consistently, qRT-PCR assay showed that the mRNA expressions of NLRP3, IL-18 and IL-1β in gastric mucosa tissues of model rats were higher than those in control group. Importantly, YJHD administration effectively reversed these alterations (Figure 3D-F). All these results suggested that YJHD treatment reduced NLRP3 activation and pyroptosis in CAG rats.
To explore the potential mechanism underlying the regulatory effects of YJHD on NLRP3 inflammasome activation, we investigated its impact on TLR4/NF-κB and IL-6/STAT3 pathways, which were confirmed to activate NLRP3 inflammasome formation[14]. Herein, we firstly examined expressions of TLR4/NF-κB and IL-6/STAT3 signaling-associated proteins before and after YJHD treatment. Our results uncovered that TLR4, p-p65 and p-STAT3 protein levels in gastric mucosa tissues of model rats were significantly increased compared to control rats. Remarkably, YJHD administration strikingly suppressed the expression of these proteins (Figure 4A). In addition, chromatin immunoprecipitation assay demonstrated that H3K9ac, p-STAT3 and p-p65 were significantly enriched in the NLRP3 promoter region compared to the IgG control group (Figure 4B-D). Thus, YJHD suppressed NLRP3 inflammasome activation by inactivating TLR4/NF-κB and IL-6/STAT3 pathways.
CAG, a prevalent chronic digestive system disease, is characterized by gland loss[3]. Its well-established association with gastric mucosal atrophy and intestinal metaplasia significantly increase the risk of GC[15]. Timely intervention to address PLGC holds promise for GC prevention[16]. Traditional Chinese medicine has gained traction as a viable approach to managing PLGC[17]. Weiqi Decoction administration could relieve the atrophy and intestinal metaplasia as well as the microcirculation disturbance in gastric mucosa of CAG rats[3]. Additionally, Lin et al[18] reported that Xiangsha Liujunzi decoction had remarkable efficacy in mitigating inflammatory infiltration and pathological changes in gastric mucosa by inactivating TLR-related signaling. YJHD, has been used clinically utilized in treating conditions like diabetic nephropathy[19]. Further evidence revealed that YJHD’s protective role against lipopolysaccharide-triggered acute respiratory distress syndrome through suppressing pro-inflammatory cytokines secretion such as IL-1β, NF-κB, IL-18 as well as NLRP3 inflammasomes activation[10,20]. Of particular note, YJHD also exhibited efficiency in curbing metastasis and postoperative recurrence of GC[13]. These highlights collectively indicate YJHD’s potential as a therapeutic agent for CAG. Herein, in the CAG rat model generated by combining H. pylori bacterial solution and MNNG induction, YJHD treatment exhibited therapeutic prowess in alleviating gastric mucosa atrophy, inflammatory infiltration, and enhancing gastric mucosal function.
Chronic inflammation is a recognized contributor to the pathogenesis of various cancers, with GC being particularly pertinent[21]. Gastritis is intrinsically linked to the progression of the pre-neoplastic cascade[22]. Long-term inflammation of gastric mucosa can instigate the development of typical precancerous lesions such as intestinal metaplasia, thus facilitating the process of gastric mucosa "inflammation-cancer transformation"[22]. Gastric mucosal epithelial cells, constituting the gastric mucosa, play pivotal roles in maintaining mucosal stability against the constant threat of inflammatory insults. Gastric mucosa continuously synthesizes and release a spectrum of cytokines, including GAS, PP, SS and PGE2, crucial for maintaining gastrointestinal epithelial barrier function and thwarting external inflammatory damage[23,24]. GAS enhances gastric mucosal cell proliferation and boost gastric acid and pepsinogen secretion, while PP adds in food digestion, and SS exerts a significant inhibitory effect on gastric acid secretion. Furthermore, PGE2 regulates blood vessel relaxation and contraction and safeguards gastric mucosal cells[25-27]. In the present work, our results revealed that YJHD ameliorated gastric intestinal metaplasia in the pylorus of CAG rats and reduced the levels of inflammatory factors (IL-6, TNF-α and CRP), as well as increased the contents of GAS, PP, SS and PGE2 in CAG rats with PLGC. These findings provide further support for the therapeutic potential of YJHD administration in suppressing gastric mucosa "inflammation-carcinoma transformation".
The mechanisms underlying the therapeutic effect of YJHD in treating PLGC of CAG were subsequently investigated. NLRP3 serves as a crucial mediator in initiating inflammatory response upon external stimulation[28]. Once activated, the NLRP3 inflammasome promotes the maturation and secretion of pro-inflammatory cytokines such as IL-1β and IL-18, and triggers pyroptosis, an inflammatory form of programmed cell death[28]. As revealed by Pachathundikandi et al[7], deregulation of the NLRP3 inflammasome and subsequent pyroptosis during H. pylori infection play a pivotal role in inflammation-induced GC. Notably, inhibition of NLRP3 inflammasome has been shown to curb H. pylori -induced IL-1β production in dendritic cells, thereby mitigating the risk of GC[8]. In our study, we demonstrated that YJHD administration effectively attenuated NLRP3 inflammation and pyroptosis in CAG rats. However, given the complexity of prescription’s ingredients and targets, elucidating the precise mechanism by which YJHD regulates NLRP3 inflammation and pyroptosis remains a crucial area warranting further investigation.
Numerous studies uncovered that H. pylori induction triggers the activation of TLR4/NF-κB and STAT3 signaling pathway, contributing to the onset of CAG occurrence and gastric carcinogenesis[29,30]. TLR4, a key receptor in gastrointestinal innate immunity, activates NF-κB signal transduction, thereby instigating inflammatory responses that are implicated in the development of CAG[31]. Meanwhile, the IL-6/STAT3 signaling pathway serves as a critical upstream regulator of inflammatory responses[32], with its activation playing an important role in gastric carcinogenesis and metastasis[33]. Existing evidence supports that STAT3 activates NLRP3 transcription by promoting H3K9ac enrichment in the NLRP3 promoter region[34]. Moreover, p65 directly binds to the NLRP3 promoter region and competitively regulates the function of NLRP3 in inflammations[35]. These findings further implied the mechanism underlying NLRP3 inflammasome activation and pyroptosis in CAG rats. Consistent with the previous studies, our findings also highlight the binding relationship between NLRP3 promoter and H3K9ac, p-STAT3, or p65 in GES-1 cells. More importantly, we observed that YJHD administration greatly inhibited the activation of TLR4/ NF-κB and IL-6/STAT3 pathways in CAG rats. Thus, it could be inferred that the inhibitory effects of YJHD on NLRP3 inflammasomes and pyroptosis are closely associated with the regulation of TLR4/NF-κB and IL-6/STAT3 pathways.
In summary, our experimental findings provide compelling evidence that YJHD exerts inhibitory effects on NLRP3 inflammasome-mediated pyroptosis, thereby suppressing the progression of gastric mucosa "inflammation-carcinoma transformation". This suppression is achieved through the inactivation of TLR4/NF-κB and IL-6/STAT3 signaling pathways. Our findings underscore the potential of YJHD as a promising candidate for clinical treatment of CAG. Nonetheless, it is pertinent to acknowledge that inherent variations among individual animals, coupled with their differential responses to treatment, necessitate further validation of the present study's findings in larger sample sizes or across a broader array of animal models. We will strive to maintain this direction in our future work.
The authors thank SJA LABORATORY Animal Co, Ltd. for providing high-quality animals.
| 1. | Zhang Y, Li C, Sun S, Cao Z, Chen J, Xiang H, Song L. Screening and Identification of Molecular Targets Involved in Preventing Gastric Precancerous Lesions in Chronic Atrophic Gastritis by Qilianshupi Decoction. Evid Based Complement Alternat Med. 2019;2019:5804710. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 6] [Cited by in RCA: 9] [Article Influence: 1.3] [Reference Citation Analysis (0)] |
| 2. | Park YH, Kim N. Review of atrophic gastritis and intestinal metaplasia as a premalignant lesion of gastric cancer. J Cancer Prev. 2015;20:25-40. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 261] [Cited by in RCA: 233] [Article Influence: 21.2] [Reference Citation Analysis (6)] |
| 3. | Yin J, Yi J, Yang C, Xu B, Lin J, Hu H, Wu X, Shi H, Fei X. Weiqi Decoction Attenuated Chronic Atrophic Gastritis with Precancerous Lesion through Regulating Microcirculation Disturbance and HIF-1α Signaling Pathway. Evid Based Complement Alternat Med. 2019;2019:2651037. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 23] [Cited by in RCA: 18] [Article Influence: 2.6] [Reference Citation Analysis (1)] |
| 4. | Park JM, Han YM, Hahm KB. Rejuvenation of Helicobacter pylori-Associated Atrophic Gastritis Through Concerted Actions of Placenta-Derived Mesenchymal Stem Cells Prevented Gastric Cancer. Front Pharmacol. 2021;12:675443. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 14] [Cited by in RCA: 14] [Article Influence: 2.8] [Reference Citation Analysis (0)] |
| 5. | Chen X, Liu G, Yuan Y, Wu G, Wang S, Yuan L. NEK7 interacts with NLRP3 to modulate the pyroptosis in inflammatory bowel disease via NF-κB signaling. Cell Death Dis. 2019;10:906. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 342] [Cited by in RCA: 325] [Article Influence: 46.4] [Reference Citation Analysis (0)] |
| 6. | Kelley N, Jeltema D, Duan Y, He Y. The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int J Mol Sci. 2019;20. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 3034] [Cited by in RCA: 2821] [Article Influence: 403.0] [Reference Citation Analysis (7)] |
| 7. | Pachathundikandi SK, Blaser N, Bruns H, Backert S. Helicobacter pylori Avoids the Critical Activation of NLRP3 Inflammasome-Mediated Production of Oncogenic Mature IL-1β in Human Immune Cells. Cancers (Basel). 2020;12. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 43] [Cited by in RCA: 43] [Article Influence: 7.2] [Reference Citation Analysis (4)] |
| 8. | Kim JE, Lee JY, Kang MJ, Jeong YJ, Choi JA, Oh SM, Lee KB, Park JH. Withaferin A Inhibits Helicobacter pylori-induced Production of IL-1β in Dendritic Cells by Regulating NF-κB and NLRP3 Inflammasome Activation. Immune Netw. 2015;15:269-277. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 42] [Cited by in RCA: 38] [Article Influence: 3.5] [Reference Citation Analysis (0)] |
| 9. | Wu TT, Lu J, Zheng PQ, Liu SL, Wu J, Sun W, Sun QM, Ma NX, Ding XL, Chen M, Zou X. Yiqi Huayu Jiedu Decoction Inhibits the Invasion and Metastasis of Gastric Cancer Cells through TGF-β/Smad Pathway. Evid Based Complement Alternat Med. 2017;2017:1871298. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 13] [Cited by in RCA: 16] [Article Influence: 1.8] [Reference Citation Analysis (0)] |
| 10. | Liang X, Luo C, Li Y, Li X, Wang Q, Zhang S, Sun Q, Ma Y, Xiong C, Zeng Y. Study on Intervention Mechanism of Yiqi Huayu Jiedu Decoction on ARDS Based on Network Pharmacology. Evid Based Complement Alternat Med. 2020;2020:4782470. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 8] [Cited by in RCA: 7] [Article Influence: 1.2] [Reference Citation Analysis (0)] |
| 11. | Shu P, Tang H, Zhou B, Wang R, Xu Y, Shao J, Qi M, Xia Y, Huang W, Liu S. Effect of Yiqi Huayu Jiedu decoction on stages II and III gastric cancer: A multicenter, prospective, cohort study. Medicine (Baltimore). 2019;98:e17875. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 26] [Cited by in RCA: 25] [Article Influence: 3.6] [Reference Citation Analysis (1)] |
| 12. | Zhuang Y, Zhou J, Liu S, Wang Q, Qian J, Zou X, Peng H, Xue T, Jin Z, Wu C. Yiqi Jianpi Huayu Jiedu Decoction Inhibits Metastasis of Colon Adenocarcinoma by Reversing Hsa-miR-374a-3p/Wnt3/β-Catenin-Mediated Epithelial-Mesenchymal Transition and Cellular Plasticity. Front Oncol. 2022;12:904911. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 7] [Cited by in RCA: 7] [Article Influence: 1.8] [Reference Citation Analysis (0)] |
| 13. | Wu CE, Xue WW, Zhuang YW, Ding DW, Zhou JY, Liu SL, Wang RP, Shu P. A clinical study on the efficacy of Yiqi Huayu Jiedu decoction for reducing the risk of postoperative recurrence and metastasis of gastric cancer: Protocol for a multicenter, randomized, double-blind, placebo-controlled trial. Medicine (Baltimore). 2020;99:e23417. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 10] [Cited by in RCA: 9] [Article Influence: 1.5] [Reference Citation Analysis (0)] |
| 14. | Hassanein EHM, Ali FEM, Kozman MR, Abd El-Ghafar OAM. Umbelliferone attenuates gentamicin-induced renal toxicity by suppression of TLR-4/NF-κB-p65/NLRP-3 and JAK1/STAT-3 signaling pathways. Environ Sci Pollut Res Int. 2021;28:11558-11571. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 44] [Cited by in RCA: 42] [Article Influence: 8.4] [Reference Citation Analysis (0)] |
| 15. | Adamu MA, Weck MN, Gao L, Brenner H. Incidence of chronic atrophic gastritis: systematic review and meta-analysis of follow-up studies. Eur J Epidemiol. 2010;25:439-448. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 109] [Cited by in RCA: 97] [Article Influence: 6.1] [Reference Citation Analysis (6)] |
| 16. | Spence AD, Cardwell CR, McMenamin ÚC, Hicks BM, Johnston BT, Murray LJ, Coleman HG. Adenocarcinoma risk in gastric atrophy and intestinal metaplasia: a systematic review. BMC Gastroenterol. 2017;17:157. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 85] [Cited by in RCA: 77] [Article Influence: 8.6] [Reference Citation Analysis (4)] |
| 17. | Fang WJ, Zhang XY, Yang B, Sui SJ, Chen M, Pan WH, Liao WQ, Zhong M, Wang QC. CHINESE HERBAL DECOCTION AS A COMPLEMENTARY THERAPY FOR ATROPHIC GASTRITIS: A SYSTEMATIC REVIEW AND META-ANALYSIS. Afr J Tradit Complement Altern Med. 2017;14:297-319. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 10] [Cited by in RCA: 7] [Article Influence: 0.8] [Reference Citation Analysis (0)] |
| 18. | Lin ZQ, Wang DX, Hong SS, Fu XY. [Effects of Xiangsha Liujunzi decoction on TLR signal pathway in gastric mucosa tissues of rats with Helicobacter pylori-induced chronic atrophic gastritis]. Zhongguo Zhong Yao Za Zhi. 2016;41:3078-3083. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 13] [Cited by in RCA: 14] [Article Influence: 1.4] [Reference Citation Analysis (0)] |
| 19. | Xuan C, Xi YM, Zhang YD, Tao CH, Zhang LY, Cao WF. Yiqi Jiedu Huayu Decoction Alleviates Renal Injury in Rats With Diabetic Nephropathy by Promoting Autophagy. Front Pharmacol. 2021;12:624404. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 35] [Cited by in RCA: 34] [Article Influence: 6.8] [Reference Citation Analysis (0)] |
| 20. | Ma Y, Chen Y, Li Y, Liu Y, Kong Y, Zou Q, Guo Z, Li X, Chu Y, Wang Q. A Probe into the Intervention Mechanism of Yiqi Huayu Jiedu Decoction on TLR4/NLRP3 Signal Pathway in Lipopolysaccharide-Induced Acute Respiratory Distress Syndrome (ARDS) Rats. Evid Based Complement Alternat Med. 2022;2022:3051797. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 2] [Cited by in RCA: 2] [Article Influence: 0.5] [Reference Citation Analysis (0)] |
| 21. | Wang F, Meng W, Wang B, Qiao L. Helicobacter pylori-induced gastric inflammation and gastric cancer. Cancer Lett. 2014;345:196-202. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 676] [Cited by in RCA: 624] [Article Influence: 52.0] [Reference Citation Analysis (5)] |
| 22. | Díaz P, Valenzuela Valderrama M, Bravo J, Quest AFG. Helicobacter pylori and Gastric Cancer: Adaptive Cellular Mechanisms Involved in Disease Progression. Front Microbiol. 2018;9:5. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 187] [Cited by in RCA: 170] [Article Influence: 21.3] [Reference Citation Analysis (7)] |
| 23. | Nakanishi M, Rosenberg DW. Multifaceted roles of PGE2 in inflammation and cancer. Semin Immunopathol. 2013;35:123-137. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 519] [Cited by in RCA: 478] [Article Influence: 36.8] [Reference Citation Analysis (0)] |
| 24. | Yan Z, Xu T, Xu Y, Chen W, An Z, Zhu F. Jianpiyiqi formula ameliorates chronic atrophic gastritis in rats by modulating the Wnt/β-catenin signaling pathway. Exp Ther Med. 2021;22:878. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 21] [Cited by in RCA: 20] [Article Influence: 4.0] [Reference Citation Analysis (0)] |
| 25. | Waldum HL, Rehfeld JF. Gastric cancer and gastrin: on the interaction of Helicobacter pylori gastritis and acid inhibitory induced hypergastrinemia. Scand J Gastroenterol. 2019;54:1118-1123. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 34] [Cited by in RCA: 31] [Article Influence: 4.4] [Reference Citation Analysis (3)] |
| 26. | Schubert ML. Functional anatomy and physiology of gastric secretion. Curr Opin Gastroenterol. 2015;31:479-485. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 44] [Cited by in RCA: 34] [Article Influence: 3.1] [Reference Citation Analysis (0)] |
| 27. | Takeuchi K, Amagase K. Roles of Cyclooxygenase, Prostaglandin E2 and EP Receptors in Mucosal Protection and Ulcer Healing in the Gastrointestinal Tract. Curr Pharm Des. 2018;24:2002-2011. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 157] [Cited by in RCA: 131] [Article Influence: 16.4] [Reference Citation Analysis (0)] |
| 28. | Li N, Zhou H, Wu H, Wu Q, Duan M, Deng W, Tang Q. STING-IRF3 contributes to lipopolysaccharide-induced cardiac dysfunction, inflammation, apoptosis and pyroptosis by activating NLRP3. Redox Biol. 2019;24:101215. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 509] [Cited by in RCA: 521] [Article Influence: 74.4] [Reference Citation Analysis (0)] |
| 29. | Cha B, Lim JW, Kim H. Jak1/Stat3 is an upstream signaling of NF-κB activation in Helicobacter pylori-induced IL-8 production in gastric epithelial AGS cells. Yonsei Med J. 2015;56:862-866. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 37] [Cited by in RCA: 35] [Article Influence: 3.2] [Reference Citation Analysis (0)] |
| 30. | Park B, Lim JW, Kim H. Lycopene treatment inhibits activation of Jak1/Stat3 and Wnt/β-catenin signaling and attenuates hyperproliferation in gastric epithelial cells. Nutr Res. 2019;70:70-81. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 43] [Cited by in RCA: 38] [Article Influence: 5.4] [Reference Citation Analysis (0)] |
| 31. | Jiang JY, Liu DJ, Liu MX. The protective effect of NF-κB signaling pathway inhibitor PDTC on mice with chronic atrophic gastritis. Scand J Gastroenterol. 2021;56:1131-1139. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 22] [Cited by in RCA: 22] [Article Influence: 4.4] [Reference Citation Analysis (0)] |
| 32. | Banerjee S, Biehl A, Gadina M, Hasni S, Schwartz DM. JAK-STAT Signaling as a Target for Inflammatory and Autoimmune Diseases: Current and Future Prospects. Drugs. 2017;77:521-546. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1032] [Cited by in RCA: 946] [Article Influence: 105.1] [Reference Citation Analysis (5)] |
| 33. | Zhang JG, Zhao J, Xin Y. Significance and relationship between Cripto-1 and p-STAT3 expression in gastric cancer and precancerous lesions. World J Gastroenterol. 2010;16:571-577. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in CrossRef: 19] [Cited by in RCA: 20] [Article Influence: 1.3] [Reference Citation Analysis (0)] |
| 34. | Jiang Q, Tang G, Zhong XM, Ding DR, Wang H, Li JN. Role of Stat3 in NLRP3/caspase-1-mediated hippocampal neuronal pyroptosis in epileptic mice. Synapse. 2021;75:e22221. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 39] [Cited by in RCA: 33] [Article Influence: 6.6] [Reference Citation Analysis (0)] |
| 35. | Chen S, Tang C, Ding H, Wang Z, Liu X, Chai Y, Jiang W, Han Y, Zeng H. Maf1 Ameliorates Sepsis-Associated Encephalopathy by Suppressing the NF-kB/NLRP3 Inflammasome Signaling Pathway. Front Immunol. 2020;11:594071. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 120] [Cited by in RCA: 120] [Article Influence: 20.0] [Reference Citation Analysis (0)] |
Open-Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/