BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2024. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastrointest Oncol. Dec 15, 2024; 16(12): 4685-4699
Published online Dec 15, 2024. doi: 10.4251/wjgo.v16.i12.4685
Vitamin D 1,25-Dihydroxyvitamin D3 reduces lipid accumulation in hepatocytes by inhibiting M1 macrophage polarization
Wen-Jing Luo, Xian-Wen Dong, Hua Ye, Qiao-Su Zhao, Qiu-Bo Zhang, Wen-Ying Guo, Hui-Wei Liu, Feng Xu, Department of Gastroenterology, Ningbo Medical Center Lihuili Hospital, Ningbo 315000, Zhejiang Province, China
ORCID number: Feng Xu (0000-0003-3962-2918).
Author contributions: Luo WJ, Dong XW and Ye H designed the research study; Zhao QS, Zhang QB and Guo WY performed the research; Liu HW and Xu F conducted experiments, analyzed the data; All authors contributed to editorial changes in the manuscript; All authors read and approved the final manuscript.
Supported by the Natural Science Foundation of Ningbo, No. 202003N4234; and Medical and Health Research Project of Zhejiang Province, No. 2024KY1477.
Institutional animal care and use committee statement: This study was approved by the Ningbo University Animal Care and Use Committee according to the criteria set by Ningbo Medical Center Lihuili Hospital, No. IACUC202013.
Conflict-of-interest statement: The authors declare that they have no competing interests
Data sharing statement: The datasets used and analysed during the current study are available from the corresponding author on reasonable request at xufeng200468@126.com.
ARRIVE guidelines statement: The authors have read the ARRIVE Guidelines, and the manuscript was prepared and revised according to the ARRIVE Guidelines.
Corresponding author: Feng Xu, MAMS, Chief Physician, Department of Gastroenterology, Ningbo Medical Center Lihuili Hospital, No. 57 Xingning Road, Ningbo 315000, Zhejiang Province, China. xufeng200468@126.com
Received: April 16, 2024
Revised: September 9, 2024
Accepted: October 8, 2024
Published online: December 15, 2024
Processing time: 210 Days and 3 Hours

Abstract
BACKGROUND

Non-alcoholic fatty liver disease (NAFLD), which is a significant liver condition associated with metabolic syndrome, is the leading cause of liver diseases globally and its prevalence is on the rise in most nations. The protective impact of vitamin D on NAFLD and its specific mechanism remains unclear.

AIM

To examine the role of vitamin D in NAFLD and how vitamin D affects the polarization of hepatic macrophages in NAFLD through the vitamin D receptor (VDR)-peroxisome proliferator activated receptor (PPAR)γ pathway.

METHODS

Wild-type C57BL/6 mice were provided with a high-fat diet to trigger NAFLD model and administered 1,25-dihydroxy-vitamin D [1,25(OH)2D3] supplementation. 1,25(OH)2D3 was given to RAW264.7 macrophages that had been treated with lipid, and a co-culture with AML12 hepatocytes was set up. Lipid accumulation, lipid metabolism enzymes, M1/M2 phenotype markers, proinflammatory cytokines and VDR-PPARγ pathway were determined.

RESULTS

Supplementation with 1,25(OH)2D3 relieved hepatic steatosis and decreased the proinflammatory M1 polarization of hepatic macrophages in NAFLD. Administration of 1,25(OH)2D3 suppressed the proinflammatory M1 polarization of macrophages induced by fatty acids, thereby directly relieving lipid accumulation and metabolism in hepatocytes. The VDR-PPARγ pathway had a notable impact on reversing lipid-induced proinflammatory M1 polarization of macrophages regulated by the administration of 1,25(OH)2D3.

CONCLUSION

Supplementation with 1,25(OH)2D3 improved hepatic steatosis and lipid metabolism in NAFLD, linked to its capacity to reverse the proinflammatory M1 polarization of hepatic macrophages, partially by regulating the VDR-PPARγ pathway. The involvement of 1,25(OH)2D3 in inhibiting fatty-acid-induced proinflammatory M1 polarization of macrophages played a direct role in relieving lipid accumulation and metabolism in hepatocytes.

Key Words: Non-alcoholic fatty liver disease; Hepatocytes; Macrophages; Polarization; Vitamin D receptor; Peroxisome proliferator activated receptor γ

Core Tip: Supplementation with 1,25-dihydroxy-vitamin D [1,25(OH)2D3] improved hepatic steatosis and lipid metabolism in nonalcoholic fatty liver disease, linked to its capacity to reverse the proinflammatory M1 polarization of hepatic macrophages, partially by regulating the vitamin D receptor-peroxisome proliferator activated receptor γ pathway. The involvement of 1,25(OH)2D3 in inhibiting fatty-acid-induced proinflammatory M1 polarization of macrophages played a direct role in relieving lipid accumulation and metabolism in hepatocytes.



INTRODUCTION

Nonalcoholic fatty liver disease (NAFLD) is a common chronic liver condition, affecting 25%-45% of the population worldwide[1,2]. It is a key manifestation of metabolic syndrome and progresses through stages, beginning with simple fat accumulation (steatosis), advancing to nonalcoholic steatohepatitis (NASH), fibrosis, and potentially leading to cirrhosis and liver cancer (hepatocellular carcinoma)[3]. The accumulation of excess fatty acids, driven by insulin resistance and increased fat production in the liver, is the primary trigger for NAFLD. This predisposes the liver to further damage, known as multiple-hit injuries. These include mitochondrial dysfunction, stress in the endoplasmic reticulum, inflammation from endotoxins, activation of inflammasomes, iron overload, and vitamin D deficiency[3-5].

Vitamin D, a steroid hormone, has various functions beyond regulating calcium, phosphate metabolism, and bone health. It also influences immune, inflammatory, and metabolic processes. The connection between its active form, 1,25-dihydroxy-vitamin D [1,25(OH)2D3], and the vitamin D receptor (VDR) has been widely recognized in relation to insulin resistance and related conditions[6-9]. Recent observational studies show a strong link between low vitamin D levels and NAFLD. Vitamin D deficiency has been associated with liver fat accumulation, inflammation, fibrosis, and disease progression. Another study found that healthy men with higher vitamin D levels had a reduced risk of developing NAFLD[10-12].

However, most clinical trials examining the effects of vitamin D supplementation on NAFLD patients, involving different stages of liver damage, have been underpowered. More research is needed to understand the underlying mechanisms between vitamin D and NAFLD development[13,14]. Kupffer cells, located in the liver's sinusoids and comprising 20%-25% of non-parenchymal liver cells, respond to various stimuli from the bloodstream. Macrophages, including Kupffer cells, are highly adaptable, changing their function and behavior based on environmental signals[15,16].

Macrophages typically undergo M1 activation when exposed to molecules like Toll-like receptor ligands, lipopolysaccharide (LPS), and interferon-γ, releasing proinflammatory substances. Alternatively, when stimulated by interleukins (IL-4/IL-13), they shift to the M2 state, producing anti-inflammatory factors, supporting tissue repair, and regulating immune responses[17,18]. Extensive evidence confirms the critical role of liver macrophages, particularly Kupffer cells, in the progression of NAFLD and NASH. Our previous research demonstrated that in mice with high-fat (HF) diet-induced NAFLD, Kupffer cells are predominantly polarized towards the M1 state[19]. Similarly, Maina and colleagues found that M1 macrophage activation correlates with the severity of NASH[20]. Modulating the M1/M2 balance may offer a new therapeutic approach for NAFLD.

The nuclear receptor peroxisome proliferator activated receptor (PPAR)γ, when activated by specific ligands, is known to drive macrophage polarization, encouraging the development of anti-inflammatory M2 macrophages. Disruption of PPARγ in myeloid cells impairs this alternative activation and increases vulnerability to obesity and insulin resistance caused by a HF diet[21-23]. In our earlier research, PPARγ activation reversed M1 polarization of Kupffer cells induced by a HF diet and improved liver fat accumulation in NAFLD[19]. Similarly, VDR, activated by 1,25(OH)2D3, is a transcription factor that, like PPARγ, plays a key role in regulating macrophage function[24,25].

The VDR and PPARγ pathways are interconnected and influence various cell functions, including growth, differentiation, and immune response. However, the exact mechanisms behind their interaction are unclear. A recent study found that active vitamin D promotes the conversion of M1 macrophages, induced by high glucose, into the M2 state via the VDR-PPARγ pathway[25-27]. This indicates that VDR-PPARγ signaling could be a target for vitamin D to shift macrophage polarization from the M1 to the M2 phenotype, potentially leading to new therapeutic approaches for NAFLD.

MATERIALS AND METHODS
Animal experiments

Male adult (aged 6-8 weeks) wild-type C57BL/6 mice were acquired from the Vital River Laboratory (China). Mice were fed either a regular normal control (NC) diet (15% kilocalories from fat) or a HF diet (60% kilocalories from fat) for a period of 16 weeks. For 1,25(OH)2D3 supplementation, HF diet-fed mice received 1,25(OH)2D3 (20 µg/kg, MedChemExpress, United States) or phosphate-buffered saline (PBS; Gibco, United States) by oral gavage every alternate day for 16 weeks. The dose of 1,25(OH)2D3 (20 µg/kg) used in this study was selected based on previous research demonstrating its efficacy in reducing liver fibrosis and inflammation in murine models of NASH. A study by Ma et al[28] utilized a similar dose of 1,25(OH)2D3 to reveal its antifibrotic properties in female mice fed a HF diet. This concentration has been shown to exert beneficial effects in liver pathology models, making it a suitable choice for our investigation. While we recognize the importance of assessing a range of concentrations, this dose was chosen for its established efficacy. Future studies could explore different dose gradients to further refine the therapeutic potential of 1,25(OH)2D3. All mice were kept in a temperature- and light-controlled facility and permitted to consume water and pellet chow ad libitum. After being fed diets for 16 weeks, the mice were either anesthetized for in situ perfusion or sacrificed to collect liver tissues through intraperitoneal injection of 0.3% pentobarbital sodium. The humane treatment of laboratory animals was ensured in all animal experiments, which were approved by the Ningbo University Animal Care and Use Committee according to the criteria set by Ningbo University.

Kupffer cell isolation

Hepatic macrophages, also known as Kupffer cells, were obtained by in situ liver perfusion as previously described. Following perfusion, cells were isolated via centrifugation using a Percoll density gradient (25% and 50% Percoll; GE Healthcare, United States) at 800 g for 15 minutes. The isolated cells were cultured in Dulbecco's modified Eagle’s medium (DMEM; Gibco), supplemented with 12% fetal bovine serum (FBS; Gibco), 100 U/mL penicillin G (Gibco), and 100 U/mL streptomycin sulfate (Gibco) at 37 °C with 5% CO2. After a 2-hour incubation period, non-adherent cells were removed, and Kupffer cells were collected. Cell viability was assessed using the trypan blue exclusion method, with viability exceeding 95%.

Identification of Kupffer cells

To verify that the isolated cells were Kupffer cells, immunohistochemical (IHC) staining was performed. Kupffer cells were identified by the expression of F4/80, a macrophage-specific marker. The isolated cells were fixed, blocked with normal serum, and incubated with anti-mouse F4/80 antibody (1:100; GeneTex, United States) overnight at 4 °C. After washing, secondary antibodies conjugated to horseradish peroxidase were applied. The detection was carried out using diaminobenzidine (DAB), followed by counterstaining with hematoxylin. Kupffer cells positive for F4/80 were observed in liver sections under an Olympus light microscope at a magnification of 200 ×. This staining confirms the identity of the Kupffer cells, reflecting the efficiency of the isolation process.

RAW264.7 macrophage culture and treatment

RAW264.7 murine macrophages (Cell Bank of the Chinese Academic of Sciences, China) were cultured in DMEM supplemented with 10% FBS, 100 U/mL penicillin G, and 100 U/mL streptomycin sulfate at a temperature of 37 °C in the presence of 5% CO2. All the treatments were performed on the third passage of cells. Palmitic acid (PA, 0.5 mmol/L; Sigma Aldrich, United States) was administered to RAW264.7 macrophages for a duration of 24 hours. To assess macrophage M1 or M2 polarization, LPS (100 ng/mL; Sigma-Aldrich) or IL-4 (5 ng/mL; PeproTech, United States) treatment was used as a positive control, respectively. DMEM was employed as the NC. To carry out the impact of 1,25(OH)2D3, RAW264.7 macrophages were incubated with 1,25(OH)2D3 (20 ng/mL) for an additional 24 hours in a sequential manner.

AML12 hepatocyte culture

AML12 murine hepatocytes (Cell Bank of the Chinese Academic of Sciences, China) were cultured in DMEM supplemented with 10% FBS, 100 U/mL penicillin G, and 100 U/mL streptomycin sulfate at a temperature of 37 °C in the presence of 5% CO2. All the treatments were performed on the third passage of cells.

RAW264.7 macrophage and AML12 hepatocyte coculture system

Impurities were removed from the collected culture supernatants of RAW264.7 macrophages through centrifugation and filtration. The AML12 hepatocytes were exposed to the prepared conditioned media (CMs) for 24 hours in order to establish the coculture system. The initial cell density for RAW264.7 macrophages was 1 × 106 cells/mL, and AML12 hepatocytes were seeded at a density of 5 × 105 cells/mL. The coculture duration was 24 hours for all experiments to allow sufficient time for interactions between the cells while maintaining cellular viability.

Liver histology, oil red o staining and immunohistochemistry analysis

To perform histological analysis, liver tissues were fixed in 10% formalin, then embedded in paraffin, and finally stained using hematoxylin and eosin (HE). To perform cytohistologic analysis, the AML12 hepatocytes were first fixed in 4% paraformaldehyde, and then stained with Oil Red O and subsequently counterstained with HE. To perform immunohistochemistry analysis, the liver sections were first blocked in normal serum, then incubated with anti-mouse F4/80 antibody (1:100; GeneTex, United States), anti-mouse CD11c antibody (1:50; OriGene, United States), and anti-mouse CD206 antibody (1:100; Abcam, United Kingdom) at a temperature of 4 °C overnight. Afterward, the sections were incubated with secondary antibodies conjugated with horseradish-peroxidase. Finally, the detection process involved the use of DAB and hematoxylin as the counter stain. Cells positive for F4/80, CD11c, and CD206 were quantified in three randomly selected fields under an Olympus light microscope at a magnification of 200 ×.

Total RNA isolation and real-time PCR

Total RNA was extracted from murine liver tissue, isolated Kupffer cells, RAW264.7 macrophages and AML12 hepatocytes using TRIzol reagent (Invitrogen, United States). cDNA was synthesized from 2 μg total RNA using Primescript RT Reagent kit (TaKaRa, Japan). In the real-time PCR assay, a 10 μL reaction mixture consisting of 10 ng template, each murine primer (shown in Table 1, provided by Sangong Biotech, China) and SYBR Green PCR Master Mix (TaKaRa, Japan) was used. The PCR thermocycling condition consisted of an initial denaturation step at 95 °C for 30 seconds, followed by 40 cycles of denaturation at 95 °C for 5 seconds and annealing at 60 °C for 30 seconds using the ABI Prism 7300 system (Applied Biosystems, United States). Each reaction was conducted three times. Quantification of the target genes' expression levels was performed using the double-delta method (2−ΔΔCt).

Table 1 Murine primers.
Primer
Forward (5′-3′)
Reverse (5′-3′)
iNOS2GTGTTCCACCAGGAGATGTTGCTCCTGCCCACTGAGTTCGTC
TNFαTCTTCTCATTCCTGCTTGTGGGGTCTGGGCCATAGAACTGA
IL-6GTTCTCTGGGAAATCGTGGAGGAAATTGGGGTAGGAAGGA
Arg1CTCCAAGCCAAAGTCCTTAGAGAGGAGCTGTCATTAGGGACATC
Mrc2TACAGCTCCACGCTATGGATTCACTCTCCCAGTTGAGGTACT
IL-10GTTACTTGGGTTGCCAAGTTGATCATCATGTATGCTTC
VDRGCTTCCACTTCAACGCTATACTCCTTCATCATGCCAAT
PPARγGCCCTTTACCACAGTTGATTTCTGTGATTTGTCCGTTGTCTTTCCT
IL-1βCCCAAGCAATACCCAAAGAATTGTGAGGTGCTGATGTACCA
SREBP1CACAGCAACCAGAAGCTCAAGTGCCCTCCATAGACACATCT
FASNTTGGGTGCTGACTACAACCTTGGATGATGTTGATGATGGA
ACOX1ACCAGCCCAACTGTGACTTCACAAAGGCATGTAACCCGTA
CPT1ACTTCCCATTTGACACCTTTGATACGTGAGGCAGAACTTGC
GAPDHCCTTCCGTGTTCCTACCCCAACCTGGTCCTCAGTGTAG
Western blotting

Protein from the murine liver tissues, RAW264.7 macrophages, and AML12 hepatocytes were resolved using 8% SDS-PAGE. The samples were transferred to polyvinylidene difluoride membranes (Bio-Rad, United States) and left to incubate overnight at 4 °C with antibodies against VDR (1:2000; Abcam), PPARγ (1:2000; Abcam), sterol-regulatory element binding protein (SREBP)1C (1:1000; Abcam), fatty acid synthase (FASN) (1:1000; Abcam), acyl-CoA oxidase (ACOX)1 (1:500; Abcam), carnitine palmitoyl transferase (CPT)1A (1:1000; Abcam), and the endogenous control GAPDH (1:3000; Bioworld, United States). The blots were then incubated with secondary antibodies conjugated with horseradish peroxidase at room temperature for 1 hour. The bands showing immunoreactivity were detected using the ECL Western Blotting Kit (Thermo Scientific Pierce, United States) and then exposed to films and developed. Image J software (National Institutes of Health, United States) was used to measure the density of the immunoblots, which was normalized using GAPDH.

ELISA

Tumor necrosis factor (TNF) α, IL-6, and IL-1β production were assessed by ELISA kit (eBioscience, United States) according to the manufacturer’s protocol with collecting and analyzing the cell culture supernatants from isolated Kupffer cells and RAW264.7 macrophages.

Statistical analysis

All statistical analyses were conducted using GraphPad Prism 9. The data were presented as mean ± SEM. Statistical differences were determined using Student’s t test. aP < 0.05 was considered statistically significant.

RESULTS
1,25(OH)2D3 supplementation improves hepatic steatosis and lipid metabolism in NAFLD

The link between vitamin D deficiency and the progression of NAFLD has become increasingly evident through observational studies. However, few studies have examined the effects and mechanisms of vitamin D supplementation on NAFLD. In a murine model of NAFLD, we found that supplementation with 1,25(OH)2D3 significantly improved hepatic steatosis induced by a HF diet, resulting in reduced liver and body weight. This treatment also markedly decreased the expression of proinflammatory cytokines in the liver (Figure 1A-D). Additionally, the mRNA and protein levels of enzymes involved in lipid synthesis (SREBP1C and FASN) and lipid breakdown (ACOX1 and CPT1A) were elevated in HF-fed mice, but these levels were significantly reduced in the 1,25(OH)2D3-treated group (Figure 1E and F). Overall, 1,25(OH)2D3 supplementation alleviated hepatic steatosis, reduced local inflammation, and improved hepatic lipid metabolism in NAFLD.

Figure 1
Figure 1 Supplementation with 1,25-dihydroxy-vitamin D improves hepatic steatosis and lipid metabolism in non-alcoholic fatty liver disease. Wild-type C57BL/6 mice were fed normal control diet or high-fat (HF) diet for 16 weeks, or HF diet plus 1,25-dihydroxy-vitamin D (20 µg/kg) by oral gavage every alternate day for 16 weeks. Phosphate-buffered saline by oral gavage served as a control (n = 10/group). A: Hepatic steatosis determined by hematoxylin & eosin staining (200 ×); B: Body weight of mice; C: Liver weight of mice; D: Hepatic proinflammatory cytokines expression; E: Hepatic lipid metabolism genes mRNA expression; F: Hepatic lipid metabolism enzymes protein expression. Values are mean ± SEM, aP < 0.05, bP < 0.01, n = 10 animals per group; NC: Normal control; HF: High-fat; VD3: 1,25-dihydroxy-vitamin D; TNFα: Tumor necrosis factor α; IL: Interleukin; SREBP1C: Sterol-regulatory element binding protein 1C; FASN: Fatty acid synthetase; ACOX1: Acyl-CoA oxidase 1; CPT1A: Carnitine palmitoyltransferase 1A.
1,25(OH)2D3 decreases proinflammatory M1 polarization of hepatic macrophages in NAFLD

Our previous work showed that hepatic macrophages in NAFLD mice on an HF diet predominantly exhibited an M1 proinflammatory phenotype[19]. In this study, we used a similar HF diet-induced NAFLD model supplemented with 1,25(OH)2D3. IHC analysis revealed a decrease in M1-polarized (F4/80+CD11c+) hepatic macrophages after 1,25(OH)2D3 supplementation (Figure 2A). Moreover, the expression of M1 markers, including inducible nitric oxide synthase (iNOS2), TNFα, and IL-6, was significantly reduced, while the M2 marker IL-10 also showed a moderate decrease (Figure 2B). In parallel, 1,25(OH)2D3 treatment significantly reduced the secretion of proinflammatory cytokines, such as TNFα, IL-6, and IL-1β, which were elevated in the HF-fed group (Figure 2C). These findings suggest that 1,25(OH)2D3 decreases the proinflammatory M1 polarization of hepatic macrophages in NAFLD.

Figure 2
Figure 2 Supplementation with 1,25-dihydroxy-vitamin D decreases the proinflammatory M1 polarization of hepatic macrophages in non-alcoholic fatty liver disease. Wild-type C57BL/6 mice were fed either normal control (NC) diet or high-fat (HF) diet for 16 weeks, or HF diet plus 1,25-dihydroxy-vitamin D [1,25(OH)2D3] (20 µg/kg) by oral gavage every alternate day for 16 weeks. Phosphate-buffered saline by oral gavage served as a control (n = 10/group). Hepatic macrophages were isolated from mice administered NC diet, HF diet alone or plus 1,25(OH)2D3. A: M1/M2 phenotype of hepatic macrophages determined by immunohistochemical staining (200 ×); B: M1/M2 gene marker expression on hepatic macrophages; C: Proinflammatory cytokine secretion from hepatic macrophages. Values are mean ± SEM, aP < 0.05, bP < 0.01, n = 10 animals per group; NC: Normal control; HF: High-fat; VD3: 1,25-dihydroxy-vitamin D; iNOS: Inducible NO synthase; TNFα: Tumor necrosis factor α; IL: Interleukin; Arg1 Arginine 1; Mrc2: Macrophage mannose receptor 2.
1,25(OH)2D3 inhibits fatty-acid-induced proinflammatory M1 polarization of macrophages

Lipid accumulation in NAFLD is largely driven by increased free fatty acids, a hallmark of disease progression[28,29]. In our previous research, we found that PA, a common saturated fatty acid, induces M1 polarization in Kupffer cells/macrophages[19]. Here, we showed that 1,25(OH)2D3 administration significantly reduced the expression of M1 markers (iNOS2, TNFα, and IL-6) and M2 marker IL-10, which were elevated in PA-treated macrophages (Figure 3A). Additionally, 1,25(OH)2D3 significantly decreased the secretion of proinflammatory cytokines (TNFα, IL-6, and IL-1β) that were induced by PA (Figure 3B). These results demonstrate that 1,25(OH)2D3 effectively inhibits fatty-acid-induced M1 polarization of macrophages in vitro.

Figure 3
Figure 3 Administration of 1,25-dihydroxy-vitamin D inhibits fatty-acid-induced proinflammatory M1 polarization of macrophages. RAW264.7 macrophages were incubated with palmitic acid (0.5 mmol/L) for 24 hours or Dulbecco's modified Eagle’s medium as a normal control. Lipopolysaccharide (100 ng/mL) or interleukin-4 (5 ng/mL) treatment served as positive controls for macrophage M1 or M2 polarization. For administration of 1,25-dihydroxy-vitamin D (1,25(OH)2D3), RAW264.7 macrophages were incubated with 1,25(OH)2D3 (VD3, 20 ng/mL) for a further 24 hours. A: M1/M2 gene marker expression on RAW264.7 macrophages; B: Proinflammatory cytokine secretion from RAW264.7 macrophages. Values are mean ± SEM, aP < 0.05, bP < 0.01, n = 3 experiments; NC: Normal control; PA; Palmitic acid; VD3: 1,25-dihydroxy-vitamin D; LPS: Lipopolysaccharide; IL: Interleukin; iNOS: Inducible NO synthase; TNFα: Tumor necrosis factor α; Arg1 Arginine 1; Mrc2: Macrophage mannose receptor 2.
The role of the VDR-PPARγ pathway in 1,25(OH)2D3-mediated modulation of macrophage polarization

Our study further explored the molecular mechanisms through which 1,25(OH)2D3 modulates macrophage polarization in the context of a HF diet or fatty-acid stimulation. We focused on the VDR and peroxisome proliferator-activated receptor gamma (PPARγ), both of which are nuclear receptors that influence macrophage polarization but with opposing effects[24-27]. In vivo, hepatic macrophages from HF-fed NAFLD mice showed increased expression of VDR and PPARγ at both mRNA and protein levels. In contrast, 1,25(OH)2D3 supplementation significantly decreased VDR expression but did not alter PPARγ expression (Figure 4A and B). In vitro, 1,25(OH)2D3 treatment reduced the expression of both VDR and PPARγ in PA-stimulated macrophages (Figure 4C and D). Thus, 1,25(OH)2D3 attenuated HF diet- and fatty-acid-induced proinflammatory M1 polarization of macrophages by inhibiting VDR and PPARγ. These findings suggest that the VDR-PPARγ pathway plays a crucial role in 1,25(OH)2D3-mediated regulation of macrophage polarization.

Figure 4
Figure 4 Effect of vitamin D receptor-peroxisome proliferator activated receptor γ pathway modulating 1,25-dihydroxy-vitamin D administration on high-fat diet/fatty acid-induced hepatic macrophage polarization. Wild-type C57BL/6 mice were fed either normal control (NC) diet or high-fat (HF) diet for 16 week, or HF diet plus 1,25-dihydroxy-vitamin D [1,25(OH)2D3] (20 µg/kg) by oral gavage every alternate day for 16 weeks. Phosphate-buffered saline by oral gavage served as a control (n = 10/group). Hepatic macrophages were isolated from mice administered NC diet, HF diet alone or plus 1,25(OH)2D3. RAW264.7 macrophages were incubated with palmitic acid (0.5 mmol/L) for 24 hours or Dulbecco's modified Eagle’s medium as a normal control. Lipopolysaccharide (100 ng/mL) or interleukin-4 (5 ng/mL) treatment served as positive controls for macrophage M1 or M2 polarization. For administration of 1,25(OH)2D3, RAW264.7 macrophages were incubated with 1,25(OH)2D3 (20 ng/mL) for a further 24 hours. A: MRNA expression of vitamin D receptor (VDR)-peroxisome proliferator activated receptor γ on hepatic macrophages; B: Protein expression of VDR and PPARγ on hepatic macrophages; C: MRNA expression of VDR and PPARγ on RAW264.7 macrophages; D: Protein expression of VDR and PPARγ on RAW264.7 macrophages. Values are mean ± SEM, aP < 0.05, bP < 0.01, n = 10 animals per group, n = 3 experiments; VDR: Vitamin D receptor; PPARγ: Peroxisome proliferator activated receptor γ; NC: Normal control; HF: High-fat; VD3: 1,25-dihydroxy-vitamin D; PA: Palmitic acid; LPS: Lipopolysaccharide; IL: Interleukin.
1,25(OH)2D3 inhibits proinflammatory macrophage polarization, improving hepatocyte lipid metabolism

Our in vivo data showed that 1,25(OH)2D3 reduced proinflammatory M1 polarization of hepatic macrophages and improved hepatic lipid metabolism in NAFLD. To determine whether 1,25(OH)2D3 directly affects hepatocyte lipid metabolism by inhibiting macrophage polarization, we used a co-culture system with RAW264.7 macrophages and AML12 hepatocytes. Oil Red O staining revealed increased lipid accumulation in hepatocytes incubated with CM from LPS- and PA-treated macrophages, which was significantly reduced following 1,25(OH)2D3 administration (Figure 5A). Additionally, 1,25(OH)2D3 treatment reduced the expression of proinflammatory cytokines in hepatocytes treated with CM from LPS- and PA-stimulated macrophages (Figure 5B). M1-polarized macrophage CM also increased the expression of lipid synthesis genes (FASN and SREBP1C), which were reduced after 1,25(OH)2D3 treatment (Figure 5C and D). Conversely, lipid breakdown genes (ACOX1 and CPT1A) were elevated in hepatocytes treated with CM from PA-stimulated macrophages but declined with 1,25(OH)2D3 treatment (Figure 5C and D). These findings indicate that 1,25(OH)2D3 improves hepatocyte lipid metabolism by inhibiting proinflammatory macrophage polarization.

Figure 5
Figure 5 Administration of 1,25-dihydroxy-vitamin D inhibiting fatty-acid-induced proinflammatory M1 polarization of macrophages directly relieves lipid accumulation and metabolism in hepatocytes. RAW264.7 macrophages were incubated with palmitic acid (0.5 mmol/L) for 24 hours or Dulbecco's modified Eagle’s medium as a normal control. Lipopolysaccharide (100 ng/mL) or interleukin-4 (5 ng/mL) treatment served as positive controls for macrophage M1 or M2 polarization. For administration of 1,25-dihydroxy-vitamin D [1,25(OH)2D3], RAW264.7 macrophages were incubated with 1,25(OH)2D3 (20 ng/mL) for a further 24 hours. The cell culture supernatants were collected and prepared for conditioned media (CMs). AML12 hepatocytes were treated with different CMs from RAW264.7 macrophages for 24 hours. A: Lipid accumulation in AML12 hepatocytes determined by Oil Red O staining (200 ×); B: Proinflammatory cytokines mRNA expression on AML12 hepatocytes; C: Lipid metabolism genes mRNA expression on AML12 hepatocytes; D: Lipid metabolism enzymes protein expression on AML12 hepatocytes. Values are mean ± SEM, aP < 0.05, bP < 0.01, n = 3 experiments; CM: Conditioned media; NC: Normal control; LPS: Lipopolysaccharide; IL: Interleukin; PA: Palmitic acid; VD3: 1,25-dihydroxy-vitamin D; TNFα: Tumor necrosis factor α; SREBP1C: Sterol-regulatory element binding protein 1C; FASN: Fatty acid synthetase; ACOX1: Acyl-CoA oxidase 1; CPT1A: Carnitine palmitoyltransferase 1A.
DISCUSSION

Insulin resistance significantly elevates the risk of NAFLD due to systemic low-grade inflammation[30]. Vitamin D is recognized for its anti-inflammatory, anti-proliferative, and anti-fibrotic effects, which may influence the development of NAFLD[31]. However, the precise role of vitamin D in NAFLD remains incompletely understood. Emerging evidence suggests that the proinflammatory activation of hepatic macrophages, particularly Kupffer cells, plays a pivotal role in the pathogenesis of NAFLD[32]. In this study, a murine model of NAFLD induced by a HF diet showed that supplementation with 1,25(OH)2D3 alleviated hepatic steatosis, likely by reducing proinflammatory M1 polarization of hepatic macrophages. Furthermore, our cell culture experiments demonstrated that 1,25(OH)2D3 suppressed fatty-acid-induced M1 polarization, which improved lipid metabolism and reduced lipid accumulation in hepatocytes. The ability of 1,25(OH)2D3 to shift macrophage polarization was linked to the VDR-PPARγ signaling pathway in both in vivo and in vitro settings.

Clinical studies increasingly indicate that vitamin D deficiency correlates with metabolic syndrome features, including NAFLD[11,33]. Approximately 55% of NAFLD patients exhibit vitamin D deficiency[34]. Despite this association, results from clinical trials evaluating the impact of vitamin D supplementation on NAFLD have been mixed[35-37]. In our study, 1,25(OH)2D3 supplementation in vivo was found to improve hepatic steatosis and reduce local inflammation. Since altered lipid homeostasis is a key characteristic of NAFLD[38], we investigated how 1,25(OH)2D3 affects enzymes involved in lipid synthesis and breakdown in the liver. Our findings indicate that 1,25(OH)2D3 improves both lipid anabolic and catabolic processes, potentially explaining the divergent results seen in previous clinical studies. These results highlight the potential of 1,25(OH)2D3 as a treatment option for NAFLD by simultaneously addressing hepatic steatosis and inflammation.

Macrophages exhibit two main phenotypes: The proinflammatory M1 and anti-inflammatory M2 states[17,18]. Prior research suggests that obesity, induced by HF diets, shifts macrophages in adipose tissue towards the M1 phenotype, promoting insulin resistance[39]. Our earlier work showed that HF diets increase M1 polarization of hepatic macrophages in NAFLD[19]. In this study, we demonstrated that 1,25(OH)2D3 significantly reduces M1 polarization in hepatic macrophages in vivo. This was further supported by our in vitro experiments, where 1,25(OH)2D3 inhibited fatty-acid-induced M1 polarization of macrophages. Lipid accumulation in the liver is recognized as an early and essential step in NAFLD[40], with free fatty acids accounting for a major portion of hepatic lipid buildup[28]. In previous studies, we found that saturated fatty acids promote M1 polarization in Kupffer cells[19]. In this study, we found that 1,25(OH)2D3 effectively suppressed this fatty-acid-induced M1 polarization, linking its effect on reducing hepatic steatosis to the inhibition of proinflammatory macrophage activity.

Both VDR and PPARγ, members of the nuclear receptor superfamily, are known to regulate lipid metabolism and macrophage polarization[24-27]. Studies have shown that VDR overexpression in adipose tissue leads to increased fat mass and elevated serum lipid levels, while VDR-knockout mice exhibit improved lipid profiles[41]. Consistent with these findings, our study revealed that VDR expression was upregulated in macrophages in response to an HF diet and fatty acids, but this upregulation was reversed by 1,25(OH)2D3 supplementation. Interestingly, although 1,25(OH)2D3 is the natural ligand for VDR, its supplementation led to a decrease in VDR expression, likely due to a feedback mechanism[42,43]. Deletion of macrophage VDR in mice has been shown to result in insulin resistance, partly by shifting macrophage polarization from M1 to M2[44]. Our data suggest that 1,25(OH)2D3 alleviates hepatic steatosis in NAFLD by inhibiting the proinflammatory M1 polarization of hepatic macrophages through the downregulation of VDR.

In addition, the HF diet increased PPARγ expression in hepatic macrophages, consistent with our previous findings[19]. However, supplementation with 1,25(OH)2D3 did not significantly alter PPARγ expression in vivo, potentially due to complex interactions between VDR and PPARγ[25,26]. In contrast, in vitro experiments demonstrated that 1,25(OH)2D3 suppressed PPARγ expression in macrophages in response to fatty acid stimulation. This suggests that VDR and PPARγ may operate in tandem during macrophage polarization under these conditions. Mechanistically, 1,25(OH)2D3 likely modulates PPARγ by directly interacting with VDR, which, in turn, influences macrophage polarization and lipid metabolism. This dual regulation of VDR and PPARγ may be critical for reducing inflammation and improving lipid homeostasis in NAFLD.

Earlier studies have shown that hepatic lipid accumulation in NAFLD is initiated by the production of proinflammatory cytokines from Kupffer cells[45-47]. Depletion of Kupffer cells in animal models reduced hepatic steatosis, suggesting that the inflammatory activation of Kupffer cells is key to disrupting hepatic lipid homeostasis. A critical question is whether polarized macrophages directly influence lipid metabolism in hepatocytes. Recent research indicates that lipid-induced M1 macrophages can promote lipid synthesis in hepatocytes[48,49]. In our study, we demonstrated that supplementation with 1,25(OH)2D3 improved hepatic steatosis and lipid metabolism in vivo, likely due to its ability to reverse M1 polarization in hepatic macrophages. Our in vitro co-culture experiments further supported these findings by showing that suppression of M1 polarization in macrophages, induced by fatty acids, directly reduced lipid accumulation and improved lipid metabolism in hepatocytes. This suggests that 1,25(OH)2D3 not only reduces hepatic inflammation but also exerts a beneficial effect on lipid metabolism, potentially making it a valuable therapeutic option for NAFLD.

Limitations and future perspectives

Conditioned medium limitation: While the use of conditioned medium from RAW264.7 macrophages in this study provided valuable insights into paracrine signaling mechanisms, it may not fully capture the complex in vivo interactions between macrophages and hepatocytes. Future studies should consider employing a direct co-culture system, with macrophages in the upper compartment and liver cells in the lower compartment, to better understand how fatty acids and inflammatory signals concurrently affect both cell types. This would provide a more complete picture of the metabolic changes occurring in hepatocytes.

Mechanistic studies: Future research should focus on delineating the precise molecular mechanisms by which 1,25(OH)2D3 regulates macrophage polarization through VDR-PPARγ signaling and its downstream effects on lipid metabolism. Dose-Response Exploration: Investigating the effects of different doses of 1,25(OH)2D3 on NAFLD will help determine the optimal therapeutic dosage while minimizing potential side effects, such as hypercalcemia.

Long-term effects: Longitudinal studies are needed to assess the long-term safety and efficacy of 1,25(OH)2D3, particularly with respect to chronic supplementation and the potential risk of hypercalcemia. Combination Therapies: Evaluating the potential of 1,25(OH)2D3 in combination with other pharmacological agents could enhance its therapeutic efficacy and offer novel treatment strategies for NAFLD.

CONCLUSION

This study demonstrates that 1,25(OH)2D3 supplementation can effectively reduce lipid accumulation in hepatocytes by inhibiting fatty-acid-induced proinflammatory M1 polarization of macrophages. These findings offer a promising theoretical basis for the therapeutic potential of vitamin D in managing NAFLD. However, further research is necessary to advance our understanding and application of 1,25(OH)2D3 in clinical settings.

References
1.  Rinella ME. Nonalcoholic fatty liver disease: a systematic review. JAMA. 2015;313:2263-2273.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2001]  [Cited by in RCA: 1833]  [Article Influence: 166.6]  [Reference Citation Analysis (5)]
2.  Neuschwander-Tetri BA. Non-alcoholic fatty liver disease. BMC Med. 2017;15:45.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 407]  [Cited by in RCA: 347]  [Article Influence: 38.6]  [Reference Citation Analysis (1)]
3.  Powell EE, Wong VW, Rinella M. Non-alcoholic fatty liver disease. Lancet. 2021;397:2212-2224.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2350]  [Cited by in RCA: 2140]  [Article Influence: 428.0]  [Reference Citation Analysis (4)]
4.  Bessone F, Razori MV, Roma MG. Molecular pathways of nonalcoholic fatty liver disease development and progression. Cell Mol Life Sci. 2019;76:99-128.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 522]  [Cited by in RCA: 500]  [Article Influence: 71.4]  [Reference Citation Analysis (4)]
5.  Buzzetti E, Pinzani M, Tsochatzis EA. The multiple-hit pathogenesis of non-alcoholic fatty liver disease (NAFLD). Metabolism. 2016;65:1038-1048.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2614]  [Cited by in RCA: 2416]  [Article Influence: 241.6]  [Reference Citation Analysis (26)]
6.  Charoenngam N, Holick MF. Immunologic Effects of Vitamin D on Human Health and Disease. Nutrients. 2020;12:2097.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 757]  [Cited by in RCA: 639]  [Article Influence: 106.5]  [Reference Citation Analysis (14)]
7.  Szymczak-Pajor I, Drzewoski J, Śliwińska A. The Molecular Mechanisms by Which Vitamin D Prevents Insulin Resistance and Associated Disorders. Int J Mol Sci. 2020;21:6644.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 171]  [Cited by in RCA: 149]  [Article Influence: 24.8]  [Reference Citation Analysis (1)]
8.  Barchetta I, Cimini FA, Cavallo MG. Vitamin D and Metabolic Dysfunction-Associated Fatty Liver Disease (MAFLD): An Update. Nutrients. 2020;12:3302.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 152]  [Cited by in RCA: 140]  [Article Influence: 23.3]  [Reference Citation Analysis (0)]
9.  Zhang H, Shen Z, Lin Y, Zhang J, Zhang Y, Liu P, Zeng H, Yu M, Chen X, Ning L, Mao X, Cen L, Yu C, Xu C. Vitamin D receptor targets hepatocyte nuclear factor 4α and mediates protective effects of vitamin D in nonalcoholic fatty liver disease. J Biol Chem. 2020;295:3891-3905.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 58]  [Cited by in RCA: 61]  [Article Influence: 10.2]  [Reference Citation Analysis (0)]
10.  Cimini FA, Barchetta I, Carotti S, Bertoccini L, Baroni MG, Vespasiani-Gentilucci U, Cavallo MG, Morini S. Relationship between adipose tissue dysfunction, vitamin D deficiency and the pathogenesis of non-alcoholic fatty liver disease. World J Gastroenterol. 2017;23:3407-3417.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 91]  [Cited by in RCA: 78]  [Article Influence: 8.7]  [Reference Citation Analysis (0)]
11.  Wang X, Li W, Zhang Y, Yang Y, Qin G. Association between vitamin D and non-alcoholic fatty liver disease/non-alcoholic steatohepatitis: results from a meta-analysis. Int J Clin Exp Med. 2015;8:17221-17234.  [PubMed]  [DOI]
12.  Rhee EJ, Kim MK, Park SE, Park CY, Baek KH, Lee WY, Kang MI, Park SW, Kim SW, Oh KW. High serum vitamin D levels reduce the risk for nonalcoholic fatty liver disease in healthy men independent of metabolic syndrome. Endocr J. 2013;60:743-752.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 74]  [Cited by in RCA: 64]  [Article Influence: 4.9]  [Reference Citation Analysis (1)]
13.  Sakpal M, Satsangi S, Mehta M, Duseja A, Bhadada S, Das A, Dhiman RK, Chawla YK. Vitamin D supplementation in patients with nonalcoholic fatty liver disease: A randomized controlled trial. JGH Open. 2017;1:62-67.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 33]  [Cited by in RCA: 33]  [Article Influence: 3.7]  [Reference Citation Analysis (2)]
14.  Kitson MT, Pham A, Gordon A, Kemp W, Roberts SK. High-dose vitamin D supplementation and liver histology in NASH. Gut. 2016;65:717-718.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 44]  [Cited by in RCA: 45]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
15.  Gao B, Jeong WI, Tian Z. Liver: An organ with predominant innate immunity. Hepatology. 2008;47:729-736.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 798]  [Cited by in RCA: 736]  [Article Influence: 40.9]  [Reference Citation Analysis (0)]
16.  Dixon LJ, Barnes M, Tang H, Pritchard MT, Nagy LE. Kupffer cells in the liver. Compr Physiol. 2013;3:785-797.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 408]  [Cited by in RCA: 476]  [Article Influence: 36.6]  [Reference Citation Analysis (10)]
17.  Sica A, Mantovani A. Macrophage plasticity and polarization: in vivo veritas. J Clin Invest. 2012;122:787-795.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5398]  [Cited by in RCA: 5049]  [Article Influence: 360.6]  [Reference Citation Analysis (5)]
18.  Murray PJ, Allen JE, Biswas SK, Fisher EA, Gilroy DW, Goerdt S, Gordon S, Hamilton JA, Ivashkiv LB, Lawrence T, Locati M, Mantovani A, Martinez FO, Mege JL, Mosser DM, Natoli G, Saeij JP, Schultze JL, Shirey KA, Sica A, Suttles J, Udalova I, van Ginderachter JA, Vogel SN, Wynn TA. Macrophage activation and polarization: nomenclature and experimental guidelines. Immunity. 2014;41:14-20.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5296]  [Cited by in RCA: 5010]  [Article Influence: 417.5]  [Reference Citation Analysis (5)]
19.  Luo W, Xu Q, Wang Q, Wu H, Hua J. Effect of modulation of PPAR-γ activity on Kupffer cells M1/M2 polarization in the development of non-alcoholic fatty liver disease. Sci Rep. 2017;7:44612.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 244]  [Cited by in RCA: 250]  [Article Influence: 27.8]  [Reference Citation Analysis (0)]
20.  Maina V, Sutti S, Locatelli I, Vidali M, Mombello C, Bozzola C, Albano E. Bias in macrophage activation pattern influences non-alcoholic steatohepatitis (NASH) in mice. Clin Sci (Lond). 2012;122:545-553.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 66]  [Article Influence: 4.7]  [Reference Citation Analysis (1)]
21.  Chinetti G, Fruchart JC, Staels B. Peroxisome proliferator-activated receptors: new targets for the pharmacological modulation of macrophage gene expression and function. Curr Opin Lipidol. 2003;14:459-468.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 90]  [Cited by in RCA: 82]  [Article Influence: 3.6]  [Reference Citation Analysis (2)]
22.  Bouhlel MA, Derudas B, Rigamonti E, Dièvart R, Brozek J, Haulon S, Zawadzki C, Jude B, Torpier G, Marx N, Staels B, Chinetti-Gbaguidi G. PPARgamma activation primes human monocytes into alternative M2 macrophages with anti-inflammatory properties. Cell Metab. 2007;6:137-143.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1158]  [Cited by in RCA: 1120]  [Article Influence: 58.9]  [Reference Citation Analysis (6)]
23.  Odegaard JI, Ricardo-Gonzalez RR, Goforth MH, Morel CR, Subramanian V, Mukundan L, Red Eagle A, Vats D, Brombacher F, Ferrante AW, Chawla A. Macrophage-specific PPARgamma controls alternative activation and improves insulin resistance. Nature. 2007;447:1116-1120.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1846]  [Cited by in RCA: 1769]  [Article Influence: 93.1]  [Reference Citation Analysis (4)]
24.  Di Rosa M, Malaguarnera G, De Gregorio C, Palumbo M, Nunnari G, Malaguarnera L. Immuno-modulatory effects of vitamin D3 in human monocyte and macrophages. Cell Immunol. 2012;280:36-43.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 135]  [Cited by in RCA: 113]  [Article Influence: 8.1]  [Reference Citation Analysis (1)]
25.  Alimirah F, Peng X, Yuan L, Mehta RR, von Knethen A, Choubey D, Mehta RG. Crosstalk between the peroxisome proliferator-activated receptor γ (PPARγ) and the vitamin D receptor (VDR) in human breast cancer cells: PPARγ binds to VDR and inhibits 1α,25-dihydroxyvitamin D3 mediated transactivation. Exp Cell Res. 2012;318:2490-2497.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 41]  [Cited by in RCA: 45]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
26.  Sertznig P, Seifert M, Tilgen W, Reichrath J. Peroxisome proliferator-activated receptor (PPAR) and vitamin D receptor (VDR) signaling pathways in melanoma cells: promising new therapeutic targets? J Steroid Biochem Mol Biol. 2010;121:383-386.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 13]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
27.  Zhang X, Zhou M, Guo Y, Song Z, Liu B. 1,25-Dihydroxyvitamin D₃ Promotes High Glucose-Induced M1 Macrophage Switching to M2 via the VDR-PPARγ Signaling Pathway. Biomed Res Int. 2015;2015:157834.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 47]  [Cited by in RCA: 73]  [Article Influence: 6.6]  [Reference Citation Analysis (0)]
28.  Ma L, Ishigami M, Honda T, Yokoyama S, Yamamoto K, Ishizu Y, Kuzuya T, Hayashi K, Hirooka Y, Goto H. Antifibrotic Effects of 1,25(OH)2D3 on Nonalcoholic Steatohepatitis in Female Mice. Dig Dis Sci. 2019;64:2581-2590.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 9]  [Article Influence: 1.3]  [Reference Citation Analysis (1)]
29.  Cusi K. Role of obesity and lipotoxicity in the development of nonalcoholic steatohepatitis: pathophysiology and clinical implications. Gastroenterology. 2012;142:711-725.e6.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 735]  [Cited by in RCA: 695]  [Article Influence: 49.6]  [Reference Citation Analysis (8)]
30.  Machado MV, Diehl AM. Pathogenesis of Nonalcoholic Steatohepatitis. Gastroenterology. 2016;150:1769-1777.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 450]  [Cited by in RCA: 427]  [Article Influence: 42.7]  [Reference Citation Analysis (3)]
31.  Pacifico L, Osborn JF, Bonci E, Pierimarchi P, Chiesa C. Association between Vitamin D Levels and Nonalcoholic Fatty Liver Disease: Potential Confounding Variables. Mini Rev Med Chem. 2019;19:310-332.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 40]  [Cited by in RCA: 30]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
32.  Friedman SL, Neuschwander-Tetri BA, Rinella M, Sanyal AJ. Mechanisms of NAFLD development and therapeutic strategies. Nat Med. 2018;24:908-922.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3652]  [Cited by in RCA: 3449]  [Article Influence: 431.1]  [Reference Citation Analysis (7)]
33.  Kim HS, Rotundo L, Kothari N, Kim SH, Pyrsopoulos N. Vitamin D Is Associated with Severity and Mortality of Non-alcoholic Fatty Liver Disease: A US Population-based Study. J Clin Transl Hepatol. 2017;5:185-192.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 22]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
34.  Barchetta I, Angelico F, Del Ben M, Baroni MG, Pozzilli P, Morini S, Cavallo MG. Strong association between non alcoholic fatty liver disease (NAFLD) and low 25(OH) vitamin D levels in an adult population with normal serum liver enzymes. BMC Med. 2011;9:85.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 257]  [Cited by in RCA: 253]  [Article Influence: 16.9]  [Reference Citation Analysis (6)]
35.  Wu C, Qiu S, Zhu X, Li L. Vitamin D supplementation and glycemic control in type 2 diabetes patients: A systematic review and meta-analysis. Metabolism. 2017;73:67-76.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 95]  [Cited by in RCA: 85]  [Article Influence: 9.4]  [Reference Citation Analysis (3)]
36.  Mousa A, Naderpoor N, de Courten MP, Teede H, Kellow N, Walker K, Scragg R, de Courten B. Vitamin D supplementation has no effect on insulin sensitivity or secretion in vitamin D-deficient, overweight or obese adults: a randomized placebo-controlled trial. Am J Clin Nutr. 2017;105:1372-1381.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 98]  [Cited by in RCA: 59]  [Article Influence: 6.6]  [Reference Citation Analysis (0)]
37.  Li X, Liu Y, Zheng Y, Wang P, Zhang Y. The Effect of Vitamin D Supplementation on Glycemic Control in Type 2 Diabetes Patients: A Systematic Review and Meta-Analysis. Nutrients. 2018;10:375.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 207]  [Cited by in RCA: 177]  [Article Influence: 22.1]  [Reference Citation Analysis (9)]
38.  Katsiki N, Mikhailidis DP, Mantzoros CS. Non-alcoholic fatty liver disease and dyslipidemia: An update. Metabolism. 2016;65:1109-1123.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 484]  [Cited by in RCA: 444]  [Article Influence: 44.4]  [Reference Citation Analysis (4)]
39.  Morris DL, Singer K, Lumeng CN. Adipose tissue macrophages: phenotypic plasticity and diversity in lean and obese states. Curr Opin Clin Nutr Metab Care. 2011;14:341-346.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 187]  [Cited by in RCA: 205]  [Article Influence: 13.7]  [Reference Citation Analysis (4)]
40.  Tilg H, Moschen AR. Insulin resistance, inflammation, and non-alcoholic fatty liver disease. Trends Endocrinol Metab. 2008;19:371-379.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 386]  [Cited by in RCA: 369]  [Article Influence: 20.5]  [Reference Citation Analysis (0)]
41.  Xu Y, Lou Y, Kong J. VDR regulates energy metabolism by modulating remodeling in adipose tissue. Eur J Pharmacol. 2019;865:172761.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 37]  [Article Influence: 5.3]  [Reference Citation Analysis (0)]
42.  Panda DK, Miao D, Bolivar I, Li J, Huo R, Hendy GN, Goltzman D. Inactivation of the 25-hydroxyvitamin D 1alpha-hydroxylase and vitamin D receptor demonstrates independent and interdependent effects of calcium and vitamin D on skeletal and mineral homeostasis. J Biol Chem. 2004;279:16754-16766.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 324]  [Cited by in RCA: 245]  [Article Influence: 11.1]  [Reference Citation Analysis (1)]
43.  Yuzbashian E, Asghari G, Hedayati M, Zarkesh M, Mirmiran P, Khalaj A. Determinants of vitamin D receptor gene expression in visceral and subcutaneous adipose tissue in non-obese, obese, and morbidly obese subjects. J Steroid Biochem Mol Biol. 2019;187:82-87.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 24]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
44.  Oh J, Riek AE, Darwech I, Funai K, Shao J, Chin K, Sierra OL, Carmeliet G, Ostlund RE Jr, Bernal-Mizrachi C. Deletion of macrophage Vitamin D receptor promotes insulin resistance and monocyte cholesterol transport to accelerate atherosclerosis in mice. Cell Rep. 2015;10:1872-1886.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 116]  [Cited by in RCA: 105]  [Article Influence: 9.5]  [Reference Citation Analysis (5)]
45.  Lanthier N, Molendi-Coste O, Horsmans Y, van Rooijen N, Cani PD, Leclercq IA. Kupffer cell activation is a causal factor for hepatic insulin resistance. Am J Physiol Gastrointest Liver Physiol. 2010;298:G107-G116.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 207]  [Cited by in RCA: 206]  [Article Influence: 12.9]  [Reference Citation Analysis (3)]
46.  Li P, He K, Li J, Liu Z, Gong J. The role of Kupffer cells in hepatic diseases. Mol Immunol. 2017;85:222-229.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 200]  [Cited by in RCA: 183]  [Article Influence: 20.3]  [Reference Citation Analysis (1)]
47.  Huang W, Metlakunta A, Dedousis N, Zhang P, Sipula I, Dube JJ, Scott DK, O'Doherty RM. Depletion of liver Kupffer cells prevents the development of diet-induced hepatic steatosis and insulin resistance. Diabetes. 2010;59:347-357.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 446]  [Cited by in RCA: 438]  [Article Influence: 27.4]  [Reference Citation Analysis (1)]
48.  Wu HM, Ni XX, Xu QY, Wang Q, Li XY, Hua J. Regulation of lipid-induced macrophage polarization through modulating peroxisome proliferator-activated receptor-gamma activity affects hepatic lipid metabolism via a Toll-like receptor 4/NF-κB signaling pathway. J Gastroenterol Hepatol. 2020;35:1998-2008.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 83]  [Cited by in RCA: 80]  [Article Influence: 13.3]  [Reference Citation Analysis (1)]
49.  Nakashima M, Suga N, Ikeda Y, Yoshikawa S, Matsuda S. Relevant MicroRNAs of MMPs and TIMPs with Certain Gut Microbiota Could Be Involved in the Invasiveness and Metastasis of Malignant Tumors. Innov Discov. 2024;1:10.  [PubMed]  [DOI]  [Full Text]
Footnotes

Open-Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Oncology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade B, Grade B, Grade B, Grade C

Novelty: Grade B, Grade B, Grade B, Grade B

Creativity or Innovation: Grade B, Grade B, Grade B, Grade B

Scientific Significance: Grade B, Grade B, Grade B, Grade C

P-Reviewer: Chen H; Wu JZ; Zongo E S-Editor: Li L L-Editor: A P-Editor: Xu ZH

Write to the Help Desk