Effect of compound rhodiola sachalinensis A Bor on CCl4-induced liver fibrosis in rats and its probable molecular mechanisms

Table 1 Primer sequences of α1(I), TGF-β1 and Na⁺/Ca²⁺ exchanger mRNA

mRNA	Upstream (5'→3')	Downstream (5'→3')
α1(I)	CACCCTCAAGAGCCTGAGTC	GTTCGGGCTGATGTACCAGT
TGF-β1	CTTTGTACAACAGCACCCGC	GTCAAAAGACAGCCACTCAGG
NCX	TATTGCCGAACCGGTTTATGT	CTCGTCTCTCCATCTGGGAC

Table 2 Liver fibrosis-associated enzymes and fibrosis markers in serum (¯x ± s)

Group	ALT (IU/L)	AST (IU/L)	β-NAG (μmol/L)	PC III (mg/L)	C IV (mg/L)	HA (mg/L)
Normal	87.93 ± 18.61a	104.3 ± 32.40a	189.00 ± 26.70a	89.99 ± 10.85a	35.69 ± 9.68a	112.41 ± 45.62a
Model	198.64 ± 71.02	514.59 ± 180.22	415.77 ± 133.37	265.54 ± 98.21	159.67 ± 29.64	455.79 ± 113.55
Treatment	114.17 ± 47.89a	291.62 ± 141.75a	244.67 ± 46.8a	164.25 ± 45.68a	96.73 ± 16.48a	289.35 ± 75.68a

^aP < 0.01 vs model group.

Table 3 Histopathological semiquantitative scores in the liver

Group	n	0	+1	+2	+3	+4	Staging scores
Normal	10	10	0	0	0	0	0a
Model	30	0	0	3	8	19	3.53 ± 0.68
Treatment	35	0	2	18	13	2	2.43 ± 0.47b

^aP < 0.01,

^bP < 0.05 vs model group.

Table 4 Expression of α1 (I) mRNA (semiquantitative scores and positive ratio)

Group	n	-	+	++	+++	Scores	Positive ratio (%)
Normal	9	2	4	3	0	1.11a	77.8b
Model	10	0	0	2	8	2.80	100.0
Treatment	8	1	2	4	1	1.63b	87.5b

^aP < 0.01,

^bP < 0.05 vs model group.

Table 5 Expression of TGF-β1mRNA (semiquantitative scores and positive ratio)

Group	n	-	+	++	+++	Scores	Positive ratio (%)
Normal	8	3	4	1	0	0.75a	62.5a
Model	10	1	1	1	7	2.40	90.0
Treatment	10	2	5	2	1	1.20b	80.0b

^aP < 0.01,

^bP < 0.05 vs model group.

Table 6 Expression of Na⁺/Ca²⁺ exchanger mRNA (semiquantitative scores and positive ratio)

Group	n	-	+	++	+++	Scores	Positive ratio (%)
Normal	10	9	1	0	0	0.10a	10.0a
Model	10	0	2	3	5	2.30	100.0
Treatment	10	2	3	3	2	1.50b	80.0b

^aP < 0.01,

^bP < 0.05 vs model group.