Somatic mutation analysis of p53 and ST7 tumor suppressor genes in gastric carcinoma by DHPLC

Table 1 Primer sequences used in PCR reactions (shown in the 5’ to 3’ direction)

Primer name		Forward sequence	Reverse sequence	Size (bp)	Annealing temp. (°C)
P53	Exon2+3	ccaggtgacccagggttg	gcaagggggactgtagatgg	402	62
	Exon4	acctggtcctctgactgctc	gccaggcattgaagtctcat	363	60
	Exon5+6	ccgtgttccagttgctttat	ttaacccctcctcccaga	488	58
	Exon7	tgcttgccacaggtctcc	ccggaaatgtgatgagaggt	301	60
	Exon8+9	ttccttactgcctcttgctt	agaaaacggcattttgagtg	411	57
	Exon10	ctcaggtactgtgtatatac	ctatggctttccaacctagga	218	55
	Exon11	tcatctctcctccctgcttc	ccacaacaaaacaccagtgc	300	60
ST7	Exon3	gtagtgtcactgaacttacgc	gctctctgaaccagaccca	154	55
	Exon4	aggtcttgcttttctctctca	caaaaagccctcccattcag	213	55
	Exon5	tgtcctctactgagtctacc	gtatcctatcaatggcaactg	223	55
	Exon12	gtgtagatgcttccgggttg	taacgagttcctgtggggat	187	55

Table 2 p53 mutations in sporadic gastric carcinomas

Specimen No.	Pathology	Exon	Codon	Mutation	Effect	DHPLC (temp)	DHPLC gradient (B% in 4.5 min)
H3	Poorly diff.	6	188	CTG > CCG	Leu188Pro	63	60-66
54	Tubular	7	246	Del 24bpa	8 amino acid deletion	57,59,61	54-63
57	Tubular	6	215	AGT > GGT	Ser215Gly	62	57-66
64	Tubular	5	167	Ins 3bpa	Gln insertion	60	57-66
77	Tubular	7	235	Del 1bp(C)a	Framshift (246stop)	61	53-62
79	Papillary	8	301	CCA > CTA	Pro301Leu	60	54-63
86	Poorly diff.	5	161	GCC > GGC	Ala161Gly	61	53-62
133	Papillary	5	135	TGC > TGG	Cys135Trp	62	57-66
36		Intron 7		C > T, T > G		57	54-63

^aMutation that hasn’t been reported previously.