Copyright
©The Author(s) 2002.
World J Gastroenterol. Dec 15, 2002; 8(6): 1081-1087
Published online Dec 15, 2002. doi: 10.3748/wjg.v8.i6.1081
Published online Dec 15, 2002. doi: 10.3748/wjg.v8.i6.1081
Sample | Sex | Age (yrs) | Origin | Diagnosis | Regions for sequencing |
GD1 | F | 58 | Guangdong | non A-E hepatitis | 5’UTR |
GD3027 | M | 47 | Guangdong | hepatitis B | 5’UTR, NS5A |
GD3040 | M | 76 | Guangdong | hepatitis B | 5’UTR |
GD3064 | F | 20 | Guangdong | non A-E hepatitis | 5’UTR |
GDCA | M | 26 | Guangdong | hepatocellular carcinoma | 5’UTR |
YN1 | M | 26 | Yunnan | intravenous drug user | 5’UTR |
YN2 | M | 38 | Yunnan | intravenous drug user | 5’UTR |
YN3 | M | 45 | Yunnan | intravenous drug user | 5’UTR |
HKC9 | F | 42 | Hong Kong | hepatitis C | 5’UTR |
HKC16 | M | 38 | Hong Kong | hepatitis C | 5’UTR |
HK8 | M | 56 | Hong Kong | recipient of bone marrow | 5’UTR |
HK9 | M | 42 | Hong Kong | recipient of bone marrow | 5’UTR |
HK10 | M | 38 | Hong Kong | recipient of bone marrow | 5’UTR |
HK11 | M | 42 | Hong Kong | recipient of bone marrow | 5’UTR |
HK12 | M | 42 | Hong Kong | recipient of bone marrow | 5’UTR |
HK24 | F | 42 | Hong Kong | recipient of bone marrow | 5’UTR |
HK80 | M | 40 | Hong Kong | recipient of bone marrow | 5’UTR |
HK108 | M | 18 | Hong Kong | recipient of bone marrow | 5’UTR |
HK116 | M | 42 | Hong Kong | recipient of bone marrow | 5’UTR |
HK120 | M | 40 | Hong Kong | recipient of bone marrow | 5’UTR |
A132 | M | 20 | Hong Kong | blood donor | NS5A |
A711 | M | 25 | Hong Kong | blood donor | NS5A |
Primer | Polarity | Position | Nucleotide sequence |
G1 | + | 117-136 | 5’ ATGCGTGATGACAGGGTTGG 3’ |
G2 | - | 451-471 | 5’ TAGGTGGCCCCATGCATTTCC 3’ |
G3 | + | 161-180 | 5’ GGTAGCCACTATAGGTGGGT 3’ |
G4 | - | 379-398 | 5’ CACTGGTCCTTGTCAACTCG 3’ |
33 | + | 6672-6697 | 5’ GTTGAATTCGCGATGGAGCGCTACAC 3’ |
34 | - | 7267-7292 | 5’ CTGGGATCCGTATCATGTATGGTTCT 3’ |
35 | + | 6573-6592 | 5’ TCGATTGCTGTAGCTGAGCC 3’ |
36 | - | 7327-7346 | 5’ GGTAAGTTCATTGCCCACCA 3’ |
Group | cases | HGV RNA Positive cases(%) |
Bone marrow transplantation | 108 | 45(41.67) |
Haemodialysis | 92 | 13(14.13) |
Intravenous drug users | 84 | 15(17.86) |
Hepatocellular carcinoma | 161 | 22(13.66) |
Hepatitis B | 263 | 19(7.22) |
Hepatitis C | 55 | 7(12.73) |
Hepatitis B + Hepatitis A | 16 | 1(6.25) |
Hepatitis B + Hepatitis C | 6 | 1(16.67) |
Hepatitis B + Hepatitis E | 26 | 3(11.54) |
Hepatitis E | 29 | 2(6.90) |
Non A-E hepatitis | 83 | 21(25.30) |
Blood donors | 506 | 13(2.57) |
General population | 562 | 5(0.89) |
Total | 1991 |
- Citation: Li G, Ma HH, Lau GK, Leung YK, Yao CL, Chong YT, Tang WH, Yao JL. Prevalence of hepatitis G virus infection and homology of different viral strains in Southern China. World J Gastroenterol 2002; 8(6): 1081-1087
- URL: https://www.wjgnet.com/1007-9327/full/v8/i6/1081.htm
- DOI: https://dx.doi.org/10.3748/wjg.v8.i6.1081