Characterization of six tumor suppressor genes and microsatellite instability in hepatocellular carcinoma in southern African blacks

Table 1 PCR primers

Gene/Locus	Primer	Primer sequence	Amplicon	Amplicon length
p53	p53F3	5’GTTGGCTCTGACTGT-ACCAC	exon 7 spanning codon 249[6]	110 bp
	p53R3	5’CTGGAGTCTTCCAGT-GTGAT
p53	p53ivs1a	5’GCACTTTCCTCAACTCTACA	ALU sequence within intron 1	200 bp-300 bp
	p53ivs1b	5’AACAGCTCCTTTAATGGCAG	of p53 gene[43]
D13S120	1353L	5’ATGACCTAGAAATGATACTGGC	(AC)73 repeat at D13S120[44]	112 bp-136 bp
(BRCA2)	1353R	5’CAGACACCACAACACACATT
D17S846	FF	5’TGCATACCTGTACTACTTCAG	(GGAA)25 repeat at D17S846[45]	250 bp-300 bp
(BRCA1)	RF	5’TCCTTTGTTGCAGATTTCTTC
D17S855	FS	5’GGATGGCCTTTTAGAAAGTGG	AC repeat at D17S855[46]	145 bp
(BRCA1)	RS	5’ACACAGACTTGTCCTACTGCC
WT1	400	5’AATGAGACTTACTGGGTGAGG	AC repeat within 3’ untranslated	100 bp-200 bp
	401	5’TTACACAGTAATTTCAAGCAACGG	sequence of WT33[47]
RB1	B57	5’TGTATCGGCTAGCCTATCTC	[CTTT(T)]n (n = 14-26) repeat	400 bp-600 bp
	B103	5’AATTAACAAGGTGTGGTGGT	within intron 20 of RB gene[48,49]
D13S127	1341L	5’CAGATATGTACTCATGCACATG	(AC)35 repeat at D13S127[44]	130 bp-142 bp
(BRCA2/RB1)	1341R	5’AAACAAATGAGTTTGGCTGT
D13S137	F	5’TTTCCTCATTCTTTCCCAATTG	(GT)22 repeat at D13S137[50]	± 135 bp
(RB1)	R	5’CAGGAGGGATGGACTCACTTC
E-cadherin	E-cadF1	5’GATCCTAAGGACAAATGTAGATGCTCT	D16S301 locus polymorphic	146 bp
	E-cadF1	5’AGCCACTTCCCAGAACTTGGCTTCC	AC region[51]
E-cadherin	E-cadF2	5’GGTTGAGATGCTGACATGC	D16S260 locus polymorphic	± 234 bp
	E-cadR2	5’CAGGGTGGCTGTTATAATG	AC repeat region[52]

Note: WT1: Wilm’s tumor gene; RB1: Retinoblastoma gene; BRCA1: Brea st cancer susceptibility gene 1; BRCA2: Breast cancer susceptibility gene 2; bp: base pairs.

Table 2 LOH, SSCP and sequence analysis

Subject number	VNTRs										p53 codon 249		HBV status
	p53	WT1	RB1		BRCA2		BRCA1		E-cadherin
	(ALU)	(AC)	D13S137 (GT)22	RB1.20 [CTTT(T)]n	D13S120 (AC)73	D13S127 (AC)35	D17S855 (AC)	D17S846 (GGAA)25	D16S301 (AC)	D16S260 (AC)	T	NT
1	NI	NI	-	-	-	NI	-	-	-	NI	-/-	-/-	HBsAg+; HBeAg-
2	-	-	-	-	-	NI	-	-	-	NI	-/-	-/-	HBsAg+
3	-	-	-	-	-	-	-	-	NI	-	+/-	-/-	HBsAg+; HBeAg-
4	-	-	-	NI	-	-	?	NI	-	-	-/-	-/-	anti-HBc+; anti-HBs+
6	-	?	?	?	-	NI	?	-	?	-	+/-	-/-	HBsAg+; HBeAg-
7	?	?	?	?	-	-	?	?	-	-	-/-	-/-	anti-HBs+; anti-HBc+
8	↑	△	NI	+	↓	↓	△	△	↑	-	+/-	-/-	anti-HBs+; anti-HBc+
14	-	NI	?	NI	-	+	-	?	?	NI	-/-	-/-	anti-HBs+; anti-HBc+
16	?	?	△	?	+	+	?	?	△	↑	-/-	-/-	HBsAg+
18	↑	+	?	?	↑	-	?	?	?	↑	-/-	-/-	HBsAg+; HBeAg-
24	NI	-	NI	-	-	-	-	-	NI	-	-/-	+/-	anti-HBs+; anti-HBc+
39	-	NI	-	?	-	-	-	NI	?	-	-/-	-/-	HBsAg+; HBeAg-
40	NI	-	?	-	-	NI	-	-	?	-	-/-	-/-	anti-HBs+; anti-HBc+
48	NI	-	-	-	-	-	-	-	?	?	-/-	-/-	?
50	NI	-	-	NI	-	-	-	NI	-	NI	-/-	-/-	?
51	NI	-	?	NI	-	NI	-	-	-	-	-/-	-/-	?
52	NI	-	NI	-	-	NI	-	-	-	-	+/-	-/-	?
53	-	-	-	-	-	-	-	-	NI	-	-/-	-/-	?
54	-	?	-	-	-	-	-	-	-	NI	-/-	-/-	?
56	NI	-	-	NI	-	-	-	NI	NI	NI	-/-	-/-	?

Note: LOH: loss of heterozygosity; -: HBV status-negative for particular antigen/antibody, mutation studies-mutation absent; LOH studies: no LOH; →p53 codon 249 mutation analysis: G→T transversion absent; +: HBV status-positive for particular antigen/ antibody, mutation studies-mutation present, →LOH studies: LOH, →p53 codon 249 mutation analysis: G→T transversion present; ?: results not obtained because of unsuccessful PCR or HBV status unknown; △: a change in repeat number between tumor (T) and non-tumorous liver (NT) in both chromosomes; ↑/↓: an increase/decrease in repeat number between tumor (T) and non-tumorou s liver (NT) in one chromosome; NI: not informative; VNTRs: Variable number of tandem repeat sequences; HBV: Hepatitis B virus; WT1: Wilm’s tumor gene; RB1: Retinoblastoma gene; BRCA1: Breast cancer susceptibility gene 1; BRCA2: Breast cancer susceptibility gene 2; HBsAg: hepatitis B virus S antigen; HBeAg: hepatitis B virus E antigen; anti-HBs: antibody to hepatitis B virus S antigen; anti-HBc: antibody to hepatitis B virus C antigen