Uridine diphosphate glucuronosyltransferase 1A1 prevents the progression of liver injury

Table 1 Sequences of single guide ribonucleic acids used in the mouse experiments

sgRNA	sgRNA sequence (5' to 3')
Ugt1a1 sgRNA1	CACTAACAGCCTCCCAGCGT
Ugt1a1 sgRNA2	CACTAACAGCCTCCCAGCGT
Ugt1a1 sgRNA3	GCTGCACAATGCCGAGTTTA
Control sgRNA	AATCAACCGTGATAGTCTCG

sgRNA: Single guide ribonucleic acid; Ugt1a1: Uridine diphosphate glucuronosyltransferase 1A1.

Table 2 Information about primary antibodies

Antibody	Source	Lot number	Manufacturer	Reactivity
GAPDH	Mouse mAb	sc-365062	Santa Cruz Biotechnology, Dallas, TX, United States	Mouse, human
Cleaved caspase-3	Rabbit mAb	9664	Cell Signaling Technology, Danvers, MA, United States	Mouse, human
GRP78	Rabbit mAb	ab108615	Abcam, Cambridge, MA, United States	Mouse, human
MTP	Mouse mAb	sc-515742	Santa Cruz Biotechnology, Dallas, TX, United States	Mouse, human
UCP2	Mouse mAb	sc-390189	Santa Cruz Biotechnology, Dallas, TX, United States	Mouse, human
p-MLKL	Rabbit mAb	37333S	Cell Signaling Technology, Danvers, MA, United States	Mouse, human
MCAD	Mouse mAb	sc-365109	Santa Cruz Biotechnology, Dallas, TX, United States	Mouse, human
MLKL	Rabbit mAb	PA5-34733	Thermo Fisher Scientific, Waltham, MA, United States	Mouse, human
SREBP1c	Mouse mAb	MA5-16124	Thermo Fisher Scientific, Waltham, MA, United States	Mouse, human
ACSL4	Mouse mAb	sc-365230	Santa Cruz Biotechnology, Dallas, TX, United States	Mouse, human

ACSL4: Acyl-CoA synthetase long chain family member 4; GAPDH: Glyceraldehyde 3 phosphate dehydrogenase; GRP78: 78-kDa glucose-regulated protein; MTP: Microsomal triglyceride transfer protein; MCAD: Medium chain acyl-CoA dehydrogenase; MLKL: Mixed lineage kinase domain-like pseudokinase; SREBP1c: Cleaved sterol regulatory element-binding protein 1; UCP2: Uncoupling protein-2; p-MLKL: Phosphorylated mixed lineage kinase domain-like pseudokinase; mAb: Monoclonal antibody.

Table 3 Markers of liver function in patients with uridine diphosphate glucuronosyltransferase 1A1 gene mutations

Patient	Gender	Age	ALT, U/L	AST, U/L	TBil, μmol/L	DBil, μmol/L	IBil, μmol/L	TBA, U/L
			Ref: 0-40	Ref: 0-34	Ref: 5.1-19.0	Ref: 1.7-6.8	Ref: 1.7-13.2	Ref: 0-50
1	Male	34	76↑	323↑	565.4↑	269.3↑	296.1↑	225.10↑
2	Male	43	26	28	184.2↑	24.8↑	155.8↑	160.00↑
3	Male	54	289↑	134↑	78.4↑	23.5↑	54.9↑	48.40↑
4	Female	25	22	28	368.7↑	186.6↑	182.1↑	242.54↑
5	Female	27	6	13	43.3↑	7.5↑	35.8↑	43.33↑
6	Male	21	6	15	50.2↑	10.0↑	40.2↑	38.93↑
7	Female	48	34	39↑	42.2↑	7.2↑	34.8↑	14.94↑

ALT: Alanine transaminase; AST: Aspartate aminotransferase; DBil: Direct bilirubin; IBil: Indirect bilirubin; TBil: Total bilirubin; TBA: Total bile acids.