Basic Study
Copyright ©The Author(s) 2015.
World J Gastroenterol. Jun 21, 2015; 21(23): 7172-7180
Published online Jun 21, 2015. doi: 10.3748/wjg.v21.i23.7172
Table 1 Comparison of nutritional status, age and basal metabolic index between Hirschsprung’s disease and non-Hirschsprung’s disease subjects
ItemHSCR(n = 90)non-HSCR(n = 50)P value
Age (mo)7.2 ± 3.157.9 ± 2.07NS
Serum total protein (g/L)68.8 ± 5.1770.2 ± 4.29NS
Serum albumin (g/L)48.2 ± 7.6350.5 ± 6.19NS
Hemoglobin (g/L)129.1 ± 10.07131.9 ± 9.89NS
Blood urea nitrogen (mmol/L)3.23 ± 1.012.91 ± 1.27NS
Length (cm)66.2 ± 4.9467.9 ± 5.18NS
Weight (kg)7.8 ± 2.118.2 ± 2.75NS
Basal metabolic index8.6% ± 0.04%9.1% ± 0.05%NS
Table 2 Detailed information of antibodies and primers
AntigenPrimary antibodyDilutionApplications
Neuroligin-1Goat-anti-human polyclonal1/100Detect Nlgn-1 with immunofluorescence on LMMP
Neuroligin-1Goat-anti-human polyclonal1/50Detect Nlgn-1 with Immunohistochemistry on paraffin-embedded sections
Neuroligin-1Goat-anti-human polyclonal1/200Detect Nlgn-1 with Western-blot
GlutamateMouse-anti-human monoclonal1/200Detect Glu with immunofluorescence on LMMP
GlutamateMouse-anti-human monoclonal1/200Detect Glu with Immunohistochemistry on LMMP
GlutamateMouse-anti-human monoclonal1/400Detect Nlgn-1 with Western-blot
β-actinRat-anti-human polyclonal1/2000Western-blot internal reference
Secondary antibodyDilutionApplicationsSource
Donkey anti-goat Texas Red Secondary1/500Label Nlgn-1 with immunofluorescenceZSGB-BIO China
Goat anti-mouse FITC Secondary1/200Label Glu with immunofluorescenceZSGB-BIO China
Horseradish Peroxidase-conjugated goat-anti-rat IgG1/500Detect β-actin with Western-blotSANTA CRUZ United States
Horseradish Peroxidase-conjugated rabbit-anti-goat IgG1/1000Detect Nlgn-1 with Western-blotSANTA CRUZ United States
Horseradish Peroxidase-conjugated goat-anti-mouse IgG1/1000Detect Glu with Western-blotSANTA CRUZ United States
PrimerPrimer sequence (5’→3’)Annealing temperature (°C)Product size (bp)
Neuroligin-1F: GCAAGACCAGAGCAGAGACT59314
R: CACCACCAAAGAATCCAATGTT
β-actinF: AGCGAGCATCCCCCAAAGTT60285
R: GGGCACGAAGGCTCATCATT