Pseudomonas fluorescens-like bacteria from the stomach: A microbiological and molecular study

Table 1 Primers used to study Helicobacter pylori and Pseudomonas fluorescens isolates

Target gene	Primer name	Primer sequence (5’-3’)	PCR condition (number of cycles, size of product)
16S rRNA	16S F	TTGGAGAGTTTGATCCTGGCC	94 °C, 30 s; 59 °C, 30 s; 72 °C, 30 s (30, 1155 bp)
	16S R	ACGTCATCCCACCTTCTC
HSP60
Primary	HSP1	AAGGCATGCAATTTGATAGAGGCT	94 °C, 30 s; 56 °C, 30 s; 72 °C, 30 s (35, 594 bp)
	HSP2	CTTTTTTCTCTTTCATTTCCACTT
Nested	HSPN1	TTGATAGAGGCTACCTCTCC	94 °C, 30 s; 56 °C, 30 s; 72 °C, 30 s (35, 501 bp)
	HSPN2	TGTCATAATCGCTTGTCGTGC
Putative membrane-bound protein (PFMP)
Primary	PFMPF	TCTKRYCRMGAATCRARACWRYC	94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min (35, 704 bp)
	PFMPR	GKTWYTGCKCRWWKCSYTSMMC
Nested	PFMPNF	TGCGYWMMWCCYWRWCCWTGA	94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min (35, 613 bp)
	PFMPNR	AKCABGGTSCWGCMVRCCRBGC
mupV
Primary	mupVF	TGAGTTCGATGTGACCTGCCTG	94 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min (35 cycles, 722 bp)
	mupVR	AACTCGCCAGATTGTCGTACAC
Nested	mupVnF	CAGCATTATCCTGCCACTGAC	94 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min (35, 611 bp)
	mupVnR	ATGATGTCCTGGCACACCTGATC

PCR: Polymerase chain reaction.

Table 2 Comparative isolation rates and prevalence of Helicobacter pylori and Pseudomonas fluorescens against rapid urease test in antral biopsies by nested polymerase chain reaction targeting HSP60 gene and membrane bound protein n (%)

Diseases	Antral biopsies	RUT, positivity	H. pylori HSP60, positivity	P value1	P. fluorescens putative outer membrane protein, positivity	P value2	Isolation of different types of bacteria, positivity		P value3
							Group A	Group B
PUD	65	51 (78.5)	59 (90.8)	< 0.001	63 (96.9)	< 0.010	61 (93.8)	23 (35.4)	< 0.001
NUD	123	92 (74.8)	109 (88.6)	< 0.001	121 (98.4)	< 0.001	119 (96.7)	39 (31.7)	< 0.001
CA	49	23 (46.9)	24 (48.9)	< 0.050	46 (93.9)	< 0.001	43 (87.5)	12 (24.5)	< 0.001
Normal	21	13 (61.9)	19 (90.4)	< 0.001	20 (95.2)	0.001	17 (80.9)	6 (28.6)	< 0.001
Total	258	179 (69.4)	211 (81.8)	< 0.001	250 (96.9)	< 0.001	240 (93.0)	80 (31.0)	< 0.001

¹P < 0.001 between Helicobacter pylori (H. pylori) and nested polymerase chain reaction (PCR);

²P < 0.001 between H. pylori and Pseudomonas fluorescens (P. fluorescens);

³P < 0.001 between colonies appearing after overnight incubation group (group A) and colonies appearing after 3-7 d of incubation group (group B). Group A: Non-ulcer dyspepsia (NUD) vs gastric carcinoma (CA), P = 0.02; NUD vs normal, P < 0.02; H. pylori: Peptic ulcer diseases (PUD) vs CA, P < 0.001; NUD vs CA, P < 0.001; CA vs Normal, P = 0.001; Overall: Culture of P. fluorescens vs nested PCR, P < 0.001. Normal: Patients whose endoscopic findings were normal; RUT: Rapid urease test; RUT: Rapid urease test.