Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

Table 1 Standard strains used in the present study

Genus or species	Standard strain(s)1
Salmonella	50 001, 50 004, 50 009, 50 013, 50 014, 50 018, 50 019, 50 020, 50 021, 50 023, 50 029, 50 041, 50 042, 50 043, 50 047, 50 051, 50 073, 50 082, 50 083, 50 086, 50 093, 50 096, 50 098, 50 099, 50 100, 50 104, 50 105, 50 106, 50 109, 50 112, 50 115, 50 120, 50 124, 50 128, 50 145, 50 191, 50 200, 50 201, 50 220, 50 304, 50 306, 50 307, 50 309, 50 310, 50 313, 50 315, 50 320, 50 321, 50 322, 50 326, 50 327, 50 333, 50 335, 50 337, 50 338, 50 354, 50 355, 50 358, 50 360, 50 362, 50 402, 50 707, 50 708, 50 709, 50 710, 50 711, 50 712, 50 718, 50 719, 50 730, 50 731, 50 732, 50 733, 50 735, 50 736, 50 739, 50 746, 50 761, 50 774, 50 783, 50 825, 50 835, 50 846, 50 853, 50 854, 50 864, 50 913
Shigella	51 081, 51 100, 51 207, 51 227, 51 233, 51 252, 51 253, 51 255, 51 258, 51 259, 51 262, 51 307, 51 315, 51 334, 51 335, 51 336, 51 424, 51 464, 51 570, 51 571, 51 572, 51 573, 51 575, 51 582, 51 583, 51 584, 51 585, 51 610
Escherichia coli	44 102, 44 105, 44 109, 44 110, 44 113, 44 126, 44 127, 44 149, 44 155, 44 156, 44 186, 44 216, 44 336, 44 338, 44 344, 44 505, 44 710, 44 719, 44 752, 44 813, 44 824, 44 825
Proteus	49 027, 49 101, 49 102, 49 103
Staphylococcus	26 001, 26 003, 26 005, 26 101, 26 111, 26 113, 26 517
Yersinia enterocolitica	52 202, 52 203, 52 206, 52 207, 52 211, 52 215, 52 217, 52 219, 52 302
Listeria monocytogenes	54 003, 54 005, 54 006, 54 007
Vibrio	20 502, 20 506, 20 507, 20 511, 02-12
Enterococcus faecalis	32 221, 32 223
Campylobacter jejuni	26 277
Bacillus cereus	63 301

¹Except that one strain of Vibrio sp. was obtained from the Beijing Institute of Microbiology and Epidemiology, all other strains used in the present study were purchased from the National Center for Medical Culture Collection.

Table 2 Oligonucleotide probes used in the present study

No.	Sequence (5' to 3')	Target
1	gtacaaggcccgggaacgtattcacc	All known eubacteria (universal bacterial probe)
2	gacataaggggcatgatgatttgacgt	All Gram-positive bacteria
3	gtcgtaagggccatgatgacttgacgt	All Gram-negative bacteria
4	gtcatgaatcacaaagtggtaagcgc	All enteric bacterial
5	acgacgcactttatgaggtccgcttg	Escherichia coli, Shigella sp. and Salmonella sp.
6	gctcctaaaaggttactccaccggct	Staphylococcus aureus
7	cgacggctagctccaaatggttactg	Coagulase-negative Staphylococcus
9	tcacggtcttgcgtcttattgtacctac	Clostridium botulinum
11	gaactgagactggtttttaagtttggct	Clostridium perfringens
15	cgaactgggacatattttatagatttgc	Campylobacter jejuni
16	aggtcgccccttcgccgccctctgtatc	Legionella pneumophila
17	cgatccgaactgagaccggcttttaagg	Mycobacterium tuberculosis
18	tactcgtaagggccatgatacgacttaa	Proteus sp.
19	cgcggcttggcaaccctttgtaccgacc	Pseudomonas aeruginosa
20	actgagaatagttttatgggattagg	Listeria monocytogenes
21	gctccaccttcgcggtattcgctgccct	Vibrio cholerae
22	tcactttcgcaagttggccgccctctgt	Vibrio fluvialis
23	tggtaagcgtccccccgtagttgaaac	Vibrio parahaemolyticus
24	tacgacagactttatgtggtccgcttgc	Yersinia enterocolitica
25	cctcgcggtctagcagctcgttgtgctt	Enterococcus faecalis
26	ggattcgctcactatcgctagcttgcag	Aeromonas hydrophila
27	ccgacttcgggtgttacaaactctcg	Bacillus cereus, P.
28	gcttcatgcactcgagttgcagagtg	cocovenenans subsp. farinofermentans
30	atccccaccttcctccagtt	Positive control
31	cccccagaggcagagattgca	virA gene of Shigella sp.
32	cgccaataacgaattgcccga	invA gene of Salmonella sp.

Table 3 Comparison of identifications based on hybridization assay and conventional methods for 26 cultures

No.	Hybridization assay	Conventional methods	Consistency
1	Staphylococcus aureus	Staphylococcus aureus	Y1
2	Coagulase-negative Staphylococcus	Staphylococcus epidermidis	Y
3	Staphylococcus aureus	Staphylococcus aureus	Y
4	Staphylococcus aureus	Staphylococcus aureus	Y
5	Staphylococcus aureus	Staphylococcus aureus	Y
6	Pseudomonas aeruginosa	Pseudomonas aeruginosa	Y
7	-3	Salmonella typhimurium	-2
8	Escherichia coli	Escherichia coli	Y
9	Staphylococcus aureus	Staphylococcus aureus	Y
10	Pseudomonas aeruginosa	Pseudomonas aeruginosa	Y
11	Shigella sp.	Shigella flexneri	Y
12	Shigella sp.	Shigella flexneri	Y
13	Shigella sp.	Shigella flexneri	Y
14	Shigella sp.	Shigella flexneri	Y
15	Vibrio parahaemolyticus	Vibrio parahaemolyticus	Y
16	Yersinia enterocolitica	Yersinia enterocolitica	Y
17	Pseudomonas aeruginosa	Pseudomonas aeruginosa	Y
18	Shigella sp.	Shigella flexneri	Y
19	Shigella sp.	Shigella flexneri	Y
20	Vibrio parahaemolyticus	Vibrio parahaemolyticus	Y
21	Escherichia coli	Escherichia coli	Y
22	Escherichia coli	Escherichia coli	Y
23	Salmonella sp.	Salmonella typhimurium	Y
24	Campylobacter jejuni	Campylobacter jejuni	Y
25	Salmonella sp.	Salmonella typhimurium	Y
26	Salmonella sp.	Salmonella typhimurium	Y

¹The results from hybridization assay and conventional methods are consistent.

²The results are inconsistent.

³No signal was detected.