BPG is committed to discovery and dissemination of knowledge
Research Report Open Access
©2014 Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Nov 14, 2014; 20(42): 15727-15735
Published online Nov 14, 2014. doi: 10.3748/wjg.v20.i42.15727
GW4064, a farnesoid X receptor agonist, upregulates adipokine expression in preadipocytes and HepG2 cells
Xiao-Min Xin, Mu-Xiao Zhong, Gong-Li Yang, Yao Peng, Ya-Li Zhang, Wei Zhu, Guangdong Provincial Key Laboratory of Gastroenterology, Department of Gastroenterology, Nanfang Hospital, Southern Medical University, Guangzhou 510515, Guangdong Province, China
Xiao-Min Xin, Department of Gastroenterology, Anyang People’s Hospital, Anyang 455000, Henan Province, China
Gong-Li Yang, Department of Gastroenterology, Taihe Hospital, Hubei University of Medicine, Shiyan 442000, Hubei Province, China
Author contributions: Xin XM, Zhong MX and Yang GL contributed equally to this work; Xin XM, Zhu W and Zhang YL designed the research; Xin XM, Zhong MX, Yang GL and Peng Y performed the research; Xin XM, Zhu W and Zhang YL analyzed the data; and Xin XM, Zhong MX and Yang GL wrote the paper.
Supported by Guangdong Provincial Science and Technology Projects, No. 2011B050400009; and Scientific Research Projects of Hubei Province Education Department, No. B2014055
Correspondence to: Wei Zhu, PhD, Guangdong Provincial Key Laboratory of Gastroenterology, Department of Gastroenterology, Nanfang Hospital, Southern Medical University, 1838 Guangzhou North Avenue, Baiyun District, Guangzhou 510515, Guangdong Province, China. chnz_w@126.com
Telephone: +86-20-61641533 Fax: +86-20-87280770
Received: March 14, 2014
Revised: June 13, 2014
Accepted: July 11, 2014
Published online: November 14, 2014
Processing time: 247 Days and 20.4 Hours

Abstract

AIM: To investigate the effect of GW4064 on the expression of adipokines and their receptors during differentiation of 3T3-L1 preadipocytes and in HepG2 cells.

METHODS: The mRNA expression of farnesoid X receptor (FXR), peroxisome proliferator-activated receptor-gamma 2 (PPAR-γ2), adiponectin, leptin, resistin, adiponectin receptor 1 (AdipoR1), adiponectin receptor 2 (AdipoR2), and the long isoform of leptin receptor (OB-Rb) and protein levels of adiponectin, leptin, and resistin were determined using fluorescent real-time PCR and enzyme linked immunosorbent assay, respectively, on days 0, 2, 4, 6, and 8 during the differentiation of 3T3-L1 preadipocytes exposed to GW4064. Moreover, mRNA expression of AdipoR2 and OB-Rb was also examined using fluorescent real-time PCR at 0, 12, 24, and 48 h in HepG2 cells treated with GW4064.

RESULTS: The mRNA expression of FXR, PPAR-γ2, adiponectin, leptin, resistin, AdipoR1, AdipoR2, and OB-Rb and protein levels of adiponectin, leptin, and resistin increased along with differentiation of 3T3-L1 preadipocytes (P < 0.05 for all). The mRNA expression of FXR, PPAR-γ2, adiponectin, leptin, and AdipoR2 in 3T3-L1 preadipocytes, and AdipoR2 and OB-Rb in HepG2 cells was significantly increased after treatment with GW4064, when compared with the control group (P < 0.05 for all). A similar trend was observed for protein levels of adipokines (including adiponectin, leptin and resistin). However, the expression of resistin, AdipoR1, and OB-Rb in 3T3-L1 cells did not change after treatment with GW4064.

CONCLUSION: The FXR agonist through regulating, at least partially, the expression of adipokines and their receptors could offer an innovative way for counteracting the progress of metabolic diseases such as nonalcoholic fatty liver disease.

Key Words: Farnesoid X receptor; Adipokines; Adipokine receptors; 3T3-L1 cells; HepG2 cells; Nonalcoholic fatty liver disease

Core tip: Our study emphasizes for the first time the effect of GW4064, a synthetic farnesoid X receptor (FXR) agonist, on the expression of adipokines and their receptors, and indicates that the way FXR agonist may act in the progress of nonalcoholic fatty liver disease (NAFLD) is at least partially through regulating the expression of adipokines and their receptors. Therefore, our data provide a further theoretical basis for using an FXR agonist in the therapeutic approach of NAFLD.



Core tip: Our study emphasizes for the first time the effect of GW4064, a synthetic farnesoid X receptor (FXR) agonist, on the expression of adipokines and their receptors, and indicates that the way FXR agonist may act in the progress of nonalcoholic fatty liver disease (NAFLD) is at least partially through regulating the expression of adipokines and their receptors. Therefore, our data provide a further theoretical basis for using an FXR agonist in the therapeutic approach of NAFLD.


INTRODUCTION

In light of the rapidly increasing incidence of obesity, nonalcoholic fatty liver disease (NAFLD) is becoming one of the most common chronic liver diseases worldwide[1], affecting 20%-40% of the general population in industrialized countries[2]. NAFLD encompasses the entire spectrum of fatty liver disease in individuals without significant alcohol consumption, ranging from hepatic steatosis to more severe situations like nonalcoholic steatohepatitis (NASH) and cirrhosis. NAFLD begins with hepatic steatosis, and in 12%-40% can progress to NASH[3]. NASH is characterized by the presence of hepatocyte ballooning and apoptosis, inflammation and pericellular fibrosis. NASH may further progress to liver cirrhosis, eventually leading to hepatocellular carcinoma and liver failure. In late stages of NASH liver transplantation may be needed[4,5]. Pathogenesis of NAFLD remains poorly understood[6]. Presently, the predominant treatment for NAFLD consists of weight loss with lifestyle modifications[7] because no drugs have yet been approved by international agencies. There is an urgent need to develop novel therapeutics for treatment of this common and potentially severe disease.

Farnesoid X receptor (FXR), a member of the nuclear receptor superfamily of ligand activated receptors, is mainly expressed in the liver, intestine, kidneys and adrenal glands, with less expression in the adipose tissue and heart[8-10]. Initially, FXR was thought to have an important role in regulating bile acid metabolism[11]. A number of studies have since proved that FXR has many other functions, especially for regulating metabolic homeostasis. Numerous studies have demonstrated that activation of FXR by its selective agonist can reverse biochemical and hormonal dysfunction of NAFLD. Firstly, FXR is able to improve peripheral insulin sensitivity in striated muscle and adipose tissue, and control glucose homeostasis through regulation of gluconeogenesis and glycogenolysis in the liver[12-15]. Secondly, FXR is a key regulator of lipid metabolism. Several studies agree that FXR activation can alleviate accumulation of triglycerides, oxidative stress and lipid peroxidation in the liver by reducing serum lipid levels[16-19]. Lastly, inflammation and fibrosis in the liver are the main histopathological features of NASH, and several studies have demonstrated that FXR agonists can antagonize hepatic inflammatory processes and exert protective effects against liver fibrosis[20-22]. Li et al[23] also demonstrated that GW4064 could inhibit ET-1-mediated activation of the Rho/Rho-associated kinase (ROCK) pathway in activated hepatic stellate cells (HSCs), which could represent a new mechanism contributing to the anti-cirrhotic effects of FXR ligands. It is noteworthy that hepatic FXR expression declines in patients with NAFLD[24]. All these data suggest that FXR could represent an interesting therapeutic approach for NAFLD.

Adipokines, secreted by the white adipose tissue, which is an important endocrine organ, take part in the regulation of insulin resistance, energy metabolism and metabolic syndromes. They are also thought to play an important role in the pathogenesis of NAFLD[25,26]. Rizzo et al[15] demonstrated that FXR was expressed in the adipose tissue, where its activation promoted the process of adipocyte differentiation. However, the effects of FXR activation on the adipokines and their receptors are not yet fully understood. In the present study, we investigated whether FXR controls the expression of adipokines and their receptors directly or indirectly. We studied the effects of GW4064, an FXR selective agonist, on adipokines (including adiponectin, leptin and resistin) and their receptors [including adiponectin receptor 1 (AdipoR1), adiponectin receptor 2 (AdipoR2) and the long isoform of leptin receptor OB-Rb] during the differentiation of 3T3-L1 preadipocytes, and on AdipoR2 and OB-Rb in HepG2 cells.

MATERIALS AND METHODS
Materials

Dulbecco’s modified Eagle’s medium (DMEM), trypsin and fetal bovine serum (FBS) were acquired from Hyclone (Waltham, MA, United States). GW4064 was obtained from Tocris Bioscience (Bristol, United Kingdom). Dimethylsulfoxide (DMSO), oil red O staining, insulin, dexamethasone, and 1-methyl-3-isobutyl-xanthin (IBMX) were purchased from Sigma (Saint Louis, MO, United States). RNAiso Reagent, PrimeScript RT reagent kit with gDNA eraser and SYBRPremix Ex Taq™ Kit were acquired from TAKARA (Dalian, China). Florescent real-time quantitative RT-PCR was performed using a Roche LightCycler480 (Roche Diagnostics Ltd, Lewes, United Kingdom), and PCR primers were designed by Invitrogen (Shanghai, China). Mouse resistin, adiponectin and leptin enzyme linked immunosorbent assay (ELISA) kits were purchased from Yajikit (Shanghai, China) and the microplate reader was a TECAN F50 (Männedorf, Switzerland).

Cell culture and differentiation

3T3-L1 preadipocytes and HepG2 cells (The Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China) were cultured in DMEM supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in a 5% CO2 humidified atmosphere.

3T3-L1 preadipocytes were differentiated two days after inducing confluence by exposing them to a differentiation mixture (DIM) containing 5 μg/mL insulin, 0.5 mmol/L IBMX, and 1 μmol/L dexamethazone in 10% FBS-supplemented DMEM for 48 h. On day 2, cells were cultured in DMEM containing 10% FBS and 5 μg/mL insulin for 48 h. On day 4 and thereafter, DMEM containing 10% FBS only was subsequently replaced every 48 h. In general, by day 8, 80%-90% of preadipocytes differentiated into adipocytes as determined by lipid accumulation visualized by Oil Red O staining.

In the 3T3-L1 adipocytes, the treatment group received 5 μmol/L of GW4064 on day 0 as the differentiation was beginning; the control group received an equal volume of DMSO at the same time. In the HepG2 cells, the treatment group received 5 μmol/L of GW4064 for 0, 12, 24, or 48 h after the cells had been serum-deprived for 24 h; the control group received an equal volume of DMSO at the same time.

RNA extraction and cDNA synthesis

Total RNA was isolated from 3T3-L1 cells in both the treatment and control groups using RNAiso Reagent on 0, 2, 4, 6, and 8 d after the start of the differentiation process; total RNA was isolated from HepG2 cells at 0, 12, 24, 48 h after addition of GW4064. cDNA was synthesized from 1 μg of total RNA using PrimeScript RT reagent kit with gDNA eraser.

Real-time PCR

For real-time PCR, 100 ng of template was used in a 20 μL reaction system containing 0.2 μmol/L of each primer and 10 μL of 2 × SYBRPremix Ex Taq™. Samples were incubated in the LightCycler for an initial denaturation at 95 °C for 30 s, followed by 40 PCR cycles, each consisting of 95 °C for 5 s and 50 °C for 20 s. The oligonucleotide primers for the study are shown in Table 1. Melting curve profiles, which depict cooling of the sample to 65 °C for 15 s and heating slowly to 95 °C with continuous measurement of fluorescence, were produced at the end of each PCR to confirm amplification of specific transcripts. The mean value of the duplicates for each sample was calculated and expressed as the cycle threshold (CT). The amount of mRNA was normalized according to that of the endogenous control (GAPDH). The ΔCt values were calculated in every sample for the target gene as follows: Cttarget gene - Ctreference gene with GAPDH as the reference gene. Relative expression (ΔΔCt) was calculated as ΔCt of the test group minus ΔCt of the control group and then presented as 2-ΔΔCt.

Table 1 Sequences of primers for reverse transcription and real-time polymerase chain reaction amplification.
SpeciesGeneForward primerReverse primerAmplification (bp)
RatFXRGCTGTGTGTTGTCTGTGGAGAGGCGTTCTTGGTAATGCTTC103
PPARγ2AGCTCTACAACAGGCCTCATTTGTGGATCCGGCAGTTAAG190
AdiponectinCCTGGCCACTTTCTCCTCATACGTCATCTTCGGCATGACT132
leptinCCTGTGGCTTTGGTCCTATCATACCGACTGCGTGTGTGAA128
resistinAGCTGTGGGACAGGAGCTAAGGAGGGGAAATGAAAGGTTC96
AdipoR1TCCACACAGAGACTGGCAACTTGGTCTCAGCATCGTCAAG87
AdipoR2TGTTTGCCACCCCTCAGTATAGCCAGCCTATCTGCCCTAT139
OB-RbAGCTAGGTGTAAACTGGGACAGCAGAGGCGAATCATCTATGAC159
GAPDHACCCCCAATGTGTCCGTCGTAGCCCAAGATGCCCTTCAGTGG118
HumanAdipoR2TGTTTGCCACCCCTCAGTATCAGCCTATCTGCCCTATGGT136
OB-RbTACTTTGGAAGCCCCTGATGAAGCACTGAGTGACTGCACG246
GAPDHGCACCGTCAAGGCTGAGAACTGGTGAAGACGCCAGTGGA145
ELISA

To evaluate the protein levels of adipokines, we used ELISA kits to detect the supernatant collected during the differentiation of 3T3-L1 cells and measured the concentrations of adiponecin, leptin and resistin. ELISA was performed according to the manufacturer’s instructions. Standard curves and sample concentrations were calculated based on absorbance (OD) values at 450 nm, as measured using a microplate reader.

Statistical analysis

All data are expressed as mean ± SD. Student’s t test or one-way ANOVA was used to determine significant differences between groups. In all statistical comparisons, a P value less than 0.05 was considered statistically significant. All experiments were conducted at least three times. All analyses were performed using SPSS version 13.0.

RESULTS
Expression of FXR and PPARγ2 mRNAs during differentiation of 3T3-L1 adipocytes after GW4064 treatment

FXR mRNA expression increased 2.17-fold by the second day, reached the peak on the fourth day (2.66-fold), and was 2.31-fold greater than in preadipocytes on the eighth day (F = 22.238, P < 0.001) (Figure 1A). PPARγ2 mRNA level gradually increased along with maturation and was 2.96-fold greater than in preadipocytes on the eighth day (F = 128.900, P < 0.001) (Figure 1B).

Figure 1
Figure 1 GW4064 (5 μmol/L) stimulates farnesoid X receptor (A) and peroxisome proliferator-activated receptor-gamma 2 (B) mRNA expression during the differentiation of 3T3-L1 preadipocytes. GW4064 was added on day 0. Total RNA was extracted and subjected to fluorescent real-time PCR as described in Section 2. FXR and PPAR-γ2 mRNA levels were determined according to normalized GAPDH expression and compared to untreated control cells (100%). Data represent mean ± SD of three independent experiments. aP < 0.05 vs the control group. Error bars = mean ± SD. FXR: Farnesoid X receptor; PPAR-γ2: Peroxisome proliferator-activated receptor-gamma 2.

Subsequently, our experiment focused on the effect of FXR agonist on the process of adipocyte differentiation: the 3T3-L1 cells were treated with 5 μmol/L GW4064, since when they were preadipocytes. We found that FXR expression was maximal on the eighth day (1.40-fold greater than in the control group, P < 0.05) (Figure 1A). Finally, we observed that GW4064 increased PPARγ2 mRNA expression at the maturation of preadipocytes (1.32-fold greater than in the control group, P < 0.01) (Figure 1B).

Protein and mRNA levels of each adipokine and their corresponding receptor increase during the differentiation of 3T3-L1 adipocytes after GW4064 treatment

Gene expression of adipokines (including adiponectin, leptin and resistin) and their corresponding receptors (including AdipoR1, AdipoR2 and OB-Rb) increased along with the differentiation process (P < 0.05 for all), and all, except adiponectin, could be detected in the 3T3-L1 preadipocytes before the differentiation (Figure 2). Quantitative real-time PCR analysis revealed that GW4064 treatment prompted 1.27-, 1.19-, and 1.45-fold increases in mRNA expression of adiponectin, leptin and AdipoR2, respectively (P < 0.01) (Figure 2A, B, E). However, there were no changes in the expression of resistin, AdipoR1 or OB-Rb (Figure 2C, D, F). Furthermore, protein levels of adiponectin, leptin and resistin followed the same trend as their gene expression. We also observed that the levels of adiponectin and resistin secretion were greater than that of leptin (Table 2).

Table 2 Protein levels of adiponectin, leptin and resistin as detected by enzyme linked immunosorbent assay (mean ± SD).
AdipokinesGroupDifferentiation time (d)
02468
Adiponectin (μg/L)Control0073.16 ± 1.1475.13 ± 0.7980.12 ± 3.88
GW40640074.98 ± 1.1494.64 ± 4.54a96.30 ± 1.72a
Leptin (pg/mL)Control527.75 ± 7.30579.22 ± 2.62601.92 ± 11.65647.34 ± 3.47652.63 ± 4.73
GW4064527.75 ± 7.30590.57 ± 11.65629.93 ± 7.97a686.69 ± 7.30a741.19 ± 3.47a
Resistin (μg/L)Control58.97 ± 0.2164.20 ± 0.2572.10 ± 0.4782.36 ± 0.8394.31 ± 2.31
GW406458.97 ± 0.2164.06 ± 0.0872.18 ± 0.3184.26 ± 2.1992.41 ± 0.13
Figure 2
Figure 2 GW4064 (5 μmol/L) stimulates adiponectin (A), leptin (B), adiponectin receptor 2 (E) mRNA expression, but did not change expression of resistin (C), adiponectin receptor 1 (D), or long form of the leptin receptor (F) during the differentiation of 3T3-L1 preadipocytes. GW4064 was added on day 0. Total RNA was extracted and subjected to fluorescent real-time PCR as described in Section 2. The mRNA levels of target genes were normalized to GAPDH expression and compared with untreated control cells (100%). Data represent mean ± SD of three independent experiments. aP < 0.05 vs the control group. Error bars = mean ± SD. AdipoR1: Adiponectin receptor 1; AdipoR2: Adiponectin receptor 2; OB-Rb: Long form of the leptin receptor; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.
GW4064 raises AdipoR2 and OB-Rb gene expression in a time-dependent manner in HepG2 cells

We further tested whether GW4064 could affect the adipokine receptors in a targeted organ such as the liver. For this purpose, we detected mRNA expression of AdipoR2 and OB-Rb in the HepG2 cells treated with GW4064 (5 μmol/L) for 0, 12, 24, or 48 h. We considered only AdipoR2 in our study because it is mainly expressed in the liver, whereas AdipoR1 is mainly expressed in skeletal muscles. After 48 h of GW4064 treatment, AdipoR2 and OB-Rb mRNA expression increased 1.62- and 1.36-fold, respectively, and the increase was time-dependent (P < 0.001) (Figure 3A, B).

Figure 3
Figure 3 GW4064 (5 μmol/L) stimulates adiponectin receptor 2 (A) and long form of the leptin receptor (B) mRNA expression in HepG2 cells in a time-dependent manner. HepG2 cells were serum-deprived 24 h before GW4064 was added. Total RNA was extracted and subjected to fluorescent real-time PCR as described in Section 2. AdipoR2 and OB-Rb mRNA levels were normalized to GAPDH expression and compared to cells at 0 h (100%). Data represent mean ± SD of three independent experiments. aP < 0.05 vs the cells at 0 h. Error bars = mean ± SD. AdipoR2: Adiponectin receptor 2; OB-Rb: Long form of the leptin receptor; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.
DISCUSSION

Adiponectin is an insulin-sensitizing hormone, which is almost exclusively secreted by the adipose tissue. Adiponectin is the only adipokine whose serum level is inversely correlated with body mass index (BMI) and adipose tissue volume. Adiponectin exhibits anti-atherogenic, anti-diabetic and anti-inflammatory properties, and plays a key role in slowing down the progression of NAFLD[27-29]. Adiponectin achieves these effects through two distinct receptors, AdipoR1 and AdipoR2, which play different biological roles[30,31]. AdipoR1, which is ubiquitously expressed and mostly abundant in the skeletal muscle, regulates de novo lipogenesis and fatty acid (FA) oxidation through the activation of AMP-activated protein kinase (AMPK). AdipoR2, which is mainly expressed in the liver, suppresses inflammation and oxidative stress through a peroxisome proliferator activated receptor[32,33]. It is noteworthy that decreasing levels of plasma adiponectin and hepatic AdipoR2, not AdipoR1, were found in patients with NAFLD or NASH[34,35]. Low adiponectin levels are correlated with insulin resistance and liver steatosis[36]. Moreover, impaired expression of adiponectin receptors may be associated with adiponectin resistance. Thus, we hypothesized that both plasma adiponectin levels and hepatic expression of adiponectin receptors might play roles in the development of NAFLD. In the present study, real-time PCR and ELISA analysis revealed that GW4064, a highly selective FXR agonist, increased gene expression and secretion of adiponectin in 3T3-L1 cells in vitro. The mRNA expression of hepatic AdipoR2 was also elevated in a time-dependent manner. Therefore, the activation of FXR could improve NAFLD by directly increasing serum adiponectin levels and enhancing the effects of adiponectin on the targeted organ by indirectly increasing hepatic AdipoR2 expression. Furthermore, our study showed that the mRNA expression of AdipoR2, but not AdipoR1, increased after GW4064 treatment in 3T3-L1 adipocytes. Previous reports have shown that adiponectin also exerts autocrine or paracrine effects on adipocytes themselves. Overexpression of adiponectin accelerates adipogenesis and generates more numerous and larger lipid droplets in differentiated adipocytes[37]. Therefore, GW4064 could also augment the autocrine and paracrine effects of adiponectin by elevating the expression of AdipoR2 in 3T3-L1 cells, leading to acceleration of 3T3-L1 fibroblast differentiation and increased adiponectin secretion.

Leptin is a product of the OB gene and is mainly released by the white adipose tissue in a mass-dependent manner. Leptin represses food intake, promoting energy expenditure by acting at the hypothalamus level, and stimulating the anorexigenic pathways[38,39]. Leptin activates its receptors at the cell membrane level in order to exert its properties. Leptin receptors (OB-R) are subdivided into long, short, and soluble isoforms, and can be found throughout the body, but are especially abundant in the brain and liver[40,41]. The short isoform (OB-Ra) has limited signaling activity, whereas the long isoform (OB-Rb) mediates almost all of the biological effects of leptin by activating the JAK2/STAT3 protein kinase signal transduction cascade[42]. The role of leptin in NAFLD patients is still debated because of conflicting results. Some reports indicate that leptin participates in the pathogenesis of NAFLD by amplifying inflammation and fibrogenesis through upregulation of pro-inflammatory and profibrogenic cytokines[43]. Leptin also inhibits insulin activities[44]. Serum leptin levels are also higher in patients with NAFLD than in healthy subjects[45,46] and are positively correlated with NAFLD severity. As a result, these patients develop leptin resistance. In contrary, some reports hold the opposite idea that leptin is a protective factor for NAFLD. Schwartz et al[47] demonstrated that leptin, which has important effects on glucose homeostasis, could reverse hyperglycaemia in ob/ob mice before body weight is corrected. Leptin supplementation appears to be an effective therapy, which significantly reduces hepatic steatosis, cell injury, metabolic profile, and transaminase activity in hypoleptinemic lipodystrophic patients with NASH[48]. In our study, similar to adiponectin, the gene and protein levels of leptin in mature 3T3-L1 adipocytes increased significantly after GW4064 treatment. This result may be due to the fact that the FXR agonist promotes the differentiation of adipocytes and is consistent with the positive correlation between leptin levels and fat cell volume[15]. Interestingly, the mRNA expression of OB-Rb in the HepG2 cells increased in a time-dependent manner after GW4064 therapy. Recent studies have demonstrated that the expression of OB-Rb in the liver of NAFLD patients is lower than normal, resulting in leptin resistance[49,50]. In addition, our study showed that OB-Rb had a low basal expression in the 3T3-L1 cells and increased its expression during cell differentiation, which indicates that leptin could act on adipocytes via autocrine or paracrine pathways. However, no information is yet available on the effect of GW4064 on the expression of leptin in 3T3-L1 cells.

The third adipokine studied in our study was resistin which is mainly secreted by macrophages, rather than by adipocytes, in humans[51]. Several experiments in rodent models have shown that resistin may induce glucose homeostasis, insulin resistance, and hepatic steatosis[52-54]. However, no human studies have demonstrated a clear relationship between resistin and NAFLD. In our study, GW4064 treatment did not affect resistin expression, so we did not explore further this aspect. Since resistin had no specific receptor, we did not study its receptor.

Peroxisome proliferator activated receptor-gamma (PPAR-γ), which belongs to the nuclear hormone receptor superfamily, is highly expressed in the adipose tissue. PPAR-γ plays a key role in the regulation of adipocyte differentiation and glucose metabolism[28]. PPAR-γ appears to act as a prominent regulator that can stimulate the whole program of adipogenesis and also as a transcriptional activator of many fat specific genes that are involved in lipid synthesis, growth regulation, insulin signaling, adipokine and associated receptor production[55-57]. Rizzo et al[15] and Abdelkarim et al[58] have shown that the FXR agonist promotes adipocyte differentiation through a mechanism at least partly involving the induction of PPAR-γ expression. In our study, PPAR-γ expression increased along with the FXR increase after GW4064 treatment. We hypothesized that the effects of the FXR agonist on the adipokines and their receptors in 3T3-L1 cells involved the regulation of PPAR-γ expression. Since the differentiation of fat cells is affected by various other factors, further studies are warranted to elucidate the precise mechanisms whereby FXR agonists are able to impact the adipokines and their receptors.

This study described the expression of adiponectin, leptin, resistin and their receptors during the differentiation of 3T3-L1 adipocytes. We have demonstrated that the FXR agonist, GW4064, increased gene expression and protein levels of adiponectin and leptin, and gene expression of AdipoR2. Moreover, in HepG2 cells, GW4064 enhanced AdipoR2 and OB-Rb gene expression. This study also provides evidence that the FXR agonist regulated adipokines and expression of the associated receptor genes at least partly through the PPAR-γ pathway. Globally, these data may pave the road for a new therapeutic approach in the field of nonalcoholic fatty liver disease. Since adipokines and their receptors also play important roles in other metabolic diseases, FXR agonists might be of interest in therapeutic approaches for other metabolic diseases.

COMMENTS
Background

Nonalcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide, affecting 20%-40% of the general population in industrialized countries. However, up to now, the only effective treatment for NAFLD consists of weight loss with lifestyle modifications because no drugs have yet been approved by international agencies. Farnesoid X receptor (FXR) is a member of the nuclear receptor superfamily of ligand-activated receptors. Many studies have reported that FXR agonists could prevent and slow down the progress of NAFLD, but the underlying mechanisms remain unclear. Adipokines, secreted by the white adipose tissue, take part in the regulation of insulin resistance, energy metabolism and metabolic syndromes. They are also thought to play an important role in the pathogenesis of NAFLD. Studies have demonstrated that FXR is expressed in the adipose tissue, where its activation promotes the process of adipocyte differentiation. However, the effects of FXR activation on the adipokines and their receptors are not yet fully understood.

Research frontiers

Initially, FXR was thought to have an important role in regulating bile acid metabolism, but increasing data have proved that FXR also plays a key role in the progress of NAFLD. So far, some FXR agonists have been just used in a few clinical trials, but the pharmacology and adverse reactions are still unclear. An improved understanding of mechanisms whereby FXR agonists act on NAFLD is needed.

Innovations and breakthroughs

Both FXR and adipokines play important roles in the progress of NAFLD, and some studies have demonstrated that FXR activation could promote the process of adipocyte differentiation. This study highlights for the first time the effect of GW4064, a synthetic FXR agonist, on adipokines and their receptors. The authors have also proposed a mechanistic basis for using FXR agonists in the treatment of NAFLD. FXR agonists may also be considered for the treatment of other metabolic diseases because adipokines and their receptors are key to those as well.

Applications

The study results strongly suggest that FXR agonist may be a potential therapeutic drug that could be used not only in NAFLD but also in other metabolic diseases.

Peer review

This is a good study in which the authors demonstrate the effect of an FXR agonist on adipokines and their receptors in 3T3-L1 adipocytes and HepG2 cells. The results suggest that the effect of FXR agonist on NAFLD may be partially through regulating the expression of adipokines and their receptors. The study provides more evidence for the use of FXR agonists in the treatment of NAFLD and other metabolic diseases.

References
1.  Williams CD, Stengel J, Asike MI, Torres DM, Shaw J, Contreras M, Landt CL, Harrison SA. Prevalence of nonalcoholic fatty liver disease and nonalcoholic steatohepatitis among a largely middle-aged population utilizing ultrasound and liver biopsy: a prospective study. Gastroenterology. 2011;140:124-131.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1760]  [Cited by in RCA: 1623]  [Article Influence: 108.2]  [Reference Citation Analysis (6)]
2.  Sanyal AJ. NASH: A global health problem. Hepatol Res. 2011;41:670-674.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 107]  [Cited by in RCA: 109]  [Article Influence: 7.3]  [Reference Citation Analysis (4)]
3.  de Alwis NM, Day CP. Non-alcoholic fatty liver disease: the mist gradually clears. J Hepatol. 2008;48 Suppl 1:S104-S112.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 444]  [Cited by in RCA: 412]  [Article Influence: 22.9]  [Reference Citation Analysis (1)]
4.  Postic C, Girard J. Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: lessons from genetically engineered mice. J Clin Invest. 2008;118:829-838.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1014]  [Cited by in RCA: 946]  [Article Influence: 52.6]  [Reference Citation Analysis (6)]
5.  Fujii H, Kawada N. Inflammation and fibrogenesis in steatohepatitis. J Gastroenterol. 2012;47:215-225.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 108]  [Cited by in RCA: 116]  [Article Influence: 8.3]  [Reference Citation Analysis (1)]
6.  Farrell GC. The liver and the waistline: Fifty years of growth. J Gastroenterol Hepatol. 2009;24 Suppl 3:S105-S118.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 31]  [Cited by in RCA: 34]  [Article Influence: 2.0]  [Reference Citation Analysis (3)]
7.  Dowman JK, Armstrong MJ, Tomlinson JW, Newsome PN. Current therapeutic strategies in non-alcoholic fatty liver disease. Diabetes Obes Metab. 2011;13:692-702.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 89]  [Cited by in RCA: 89]  [Article Influence: 5.9]  [Reference Citation Analysis (3)]
8.  Forman BM, Goode E, Chen J, Oro AE, Bradley DJ, Perlmann T, Noonan DJ, Burka LT, McMorris T, Lamph WW. Identification of a nuclear receptor that is activated by farnesol metabolites. Cell. 1995;81:687-693.  [PubMed]  [DOI]
9.  Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, Mangelsdorf DJ. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell. 2000;6:507-515.  [PubMed]  [DOI]
10.  Zhang Y, Kast-Woelbern HR, Edwards PA. Natural structural variants of the nuclear receptor farnesoid X receptor affect transcriptional activation. J Biol Chem. 2003;278:104-110.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 206]  [Cited by in RCA: 225]  [Article Influence: 9.8]  [Reference Citation Analysis (4)]
11.  Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ. Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell. 2000;102:731-744.  [PubMed]  [DOI]
12.  Cariou B, van Harmelen K, Duran-Sandoval D, van Dijk TH, Grefhorst A, Abdelkarim M, Caron S, Torpier G, Fruchart JC, Gonzalez FJ. The farnesoid X receptor modulates adiposity and peripheral insulin sensitivity in mice. J Biol Chem. 2006;281:11039-11049.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 464]  [Cited by in RCA: 439]  [Article Influence: 22.0]  [Reference Citation Analysis (3)]
13.  Ma K, Saha PK, Chan L, Moore DD. Farnesoid X receptor is essential for normal glucose homeostasis. J Clin Invest. 2006;116:1102-1109.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 759]  [Cited by in RCA: 706]  [Article Influence: 35.3]  [Reference Citation Analysis (10)]
14.  Zhang Y, Lee FY, Barrera G, Lee H, Vales C, Gonzalez FJ, Willson TM, Edwards PA. Activation of the nuclear receptor FXR improves hyperglycemia and hyperlipidemia in diabetic mice. Proc Natl Acad Sci USA. 2006;103:1006-1011.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 819]  [Cited by in RCA: 770]  [Article Influence: 38.5]  [Reference Citation Analysis (15)]
15.  Rizzo G, Disante M, Mencarelli A, Renga B, Gioiello A, Pellicciari R, Fiorucci S. The farnesoid X receptor promotes adipocyte differentiation and regulates adipose cell function in vivo. Mol Pharmacol. 2006;70:1164-1173.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 125]  [Cited by in RCA: 130]  [Article Influence: 6.5]  [Reference Citation Analysis (3)]
16.  Anisfeld AM, Kast-Woelbern HR, Meyer ME, Jones SA, Zhang Y, Williams KJ, Willson T, Edwards PA. Syndecan-1 expression is regulated in an isoform-specific manner by the farnesoid-X receptor. J Biol Chem. 2003;278:20420-20428.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 74]  [Cited by in RCA: 72]  [Article Influence: 3.1]  [Reference Citation Analysis (3)]
17.  Fruchart-Najib J, Baugé E, Niculescu LS, Pham T, Thomas B, Rommens C, Majd Z, Brewer B, Pennacchio LA, Fruchart JC. Mechanism of triglyceride lowering in mice expressing human apolipoprotein A5. Biochem Biophys Res Commun. 2004;319:397-404.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 161]  [Cited by in RCA: 163]  [Article Influence: 7.4]  [Reference Citation Analysis (0)]
18.  Claudel T, Inoue Y, Barbier O, Duran-Sandoval D, Kosykh V, Fruchart J, Fruchart JC, Gonzalez FJ, Staels B. Farnesoid X receptor agonists suppress hepatic apolipoprotein CIII expression. Gastroenterology. 2003;125:544-555.  [PubMed]  [DOI]
19.  Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest. 2002;109:1125-1131.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4292]  [Cited by in RCA: 1757]  [Article Influence: 73.2]  [Reference Citation Analysis (0)]
20.  Wang YD, Chen WD, Wang M, Yu D, Forman BM, Huang W. Farnesoid X receptor antagonizes nuclear factor kappaB in hepatic inflammatory response. Hepatology. 2008;48:1632-1643.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 566]  [Cited by in RCA: 536]  [Article Influence: 29.8]  [Reference Citation Analysis (4)]
21.  Zhang S, Wang J, Liu Q, Harnish DC. Farnesoid X receptor agonist WAY-362450 attenuates liver inflammation and fibrosis in murine model of non-alcoholic steatohepatitis. J Hepatol. 2009;51:380-388.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 257]  [Cited by in RCA: 244]  [Article Influence: 14.4]  [Reference Citation Analysis (5)]
22.  Kong B, Luyendyk JP, Tawfik O, Guo GL. Farnesoid X receptor deficiency induces nonalcoholic steatohepatitis in low-density lipoprotein receptor-knockout mice fed a high-fat diet. J Pharmacol Exp Ther. 2009;328:116-122.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 181]  [Cited by in RCA: 167]  [Article Influence: 9.8]  [Reference Citation Analysis (5)]
23.  Li J, Kuruba R, Wilson A, Gao X, Zhang Y, Li S. Inhibition of endothelin-1-mediated contraction of hepatic stellate cells by FXR ligand. PLoS One. 2010;5:e13955.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 46]  [Cited by in RCA: 58]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
24.  Yang ZX, Shen W, Sun H. Effects of nuclear receptor FXR on the regulation of liver lipid metabolism in patients with non-alcoholic fatty liver disease. Hepatol Int. 2010;4:741-748.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 190]  [Cited by in RCA: 185]  [Article Influence: 11.6]  [Reference Citation Analysis (2)]
25.  Lyon CJ, Law RE, Hsueh WA. Minireview: adiposity, inflammation, and atherogenesis. Endocrinology. 2003;144:2195-2200.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 528]  [Cited by in RCA: 500]  [Article Influence: 21.7]  [Reference Citation Analysis (0)]
26.  Conde J, Scotece M, Gómez R, López V, Gómez-Reino JJ, Lago F, Gualillo O. Adipokines: biofactors from white adipose tissue. A complex hub among inflammation, metabolism, and immunity. Biofactors. 2011;37:413-420.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 136]  [Cited by in RCA: 144]  [Article Influence: 9.6]  [Reference Citation Analysis (0)]
27.  Berg AH, Combs TP, Scherer PE. ACRP30/adiponectin: an adipokine regulating glucose and lipid metabolism. Trends Endocrinol Metab. 2002;13:84-89.  [PubMed]  [DOI]
28.  Schmidt MV, Brüne B, von Knethen A. The nuclear hormone receptor PPARγ as a therapeutic target in major diseases. ScientificWorldJournal. 2010;10:2181-2197.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 70]  [Cited by in RCA: 82]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
29.  Polyzos SA, Kountouras J, Zavos C, Tsiaousi E. The role of adiponectin in the pathogenesis and treatment of non-alcoholic fatty liver disease. Diabetes Obes Metab. 2010;12:365-383.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 213]  [Cited by in RCA: 203]  [Article Influence: 12.7]  [Reference Citation Analysis (0)]
30.  Kadowaki T, Yamauchi T, Kubota N, Hara K, Ueki K, Tobe K. Adiponectin and adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome. J Clin Invest. 2006;116:1784-1792.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2259]  [Cited by in RCA: 2084]  [Article Influence: 104.2]  [Reference Citation Analysis (3)]
31.  Kadowaki T, Yamauchi T. Adiponectin and adiponectin receptors. Endocr Rev. 2005;26:439-451.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2029]  [Cited by in RCA: 1811]  [Article Influence: 86.2]  [Reference Citation Analysis (4)]
32.  Rauchenzauner M, Laimer M, Luef G, Kaser S, Engl J, Tatarczyk T, Ciardi C, Tschoner A, Lechleitner M, Patsch J. Adiponectin receptor R1 is upregulated by valproic acid but not by topiramate in human hepatoma cell line, HepG2. Seizure. 2008;17:723-726.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 13]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
33.  Yamauchi T, Nio Y, Maki T, Kobayashi M, Takazawa T, Iwabu M, Okada-Iwabu M, Kawamoto S, Kubota N, Kubota T. Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions. Nat Med. 2007;13:332-339.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1176]  [Cited by in RCA: 1070]  [Article Influence: 56.3]  [Reference Citation Analysis (1)]
34.  Nazal L, Riquelme A, Solís N, Pizarro M, Escalona A, Burotto M, Méndez JI, Saint-Jean C, Concha MJ, Giovanni S. Hypoadiponectinemia and its association with liver fibrosis in morbidly obese patients. Obes Surg. 2010;20:1400-1407.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 21]  [Article Influence: 1.3]  [Reference Citation Analysis (1)]
35.  Kotronen A, Yki-Järvinen H, Aminoff A, Bergholm R, Pietiläinen KH, Westerbacka J, Talmud PJ, Humphries SE, Hamsten A, Isomaa B. Genetic variation in the ADIPOR2 gene is associated with liver fat content and its surrogate markers in three independent cohorts. Eur J Endocrinol. 2009;160:593-602.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 61]  [Cited by in RCA: 58]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
36.  Pickup JC. Inflammation and activated innate immunity in the pathogenesis of type 2 diabetes. Diabetes Care. 2004;27:813-823.  [PubMed]  [DOI]
37.  Fu Y, Luo N, Klein RL, Garvey WT. Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation. J Lipid Res. 2005;46:1369-1379.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 432]  [Cited by in RCA: 487]  [Article Influence: 23.2]  [Reference Citation Analysis (0)]
38.  Masuzaki H, Ogawa Y, Isse N, Satoh N, Okazaki T, Shigemoto M, Mori K, Tamura N, Hosoda K, Yoshimasa Y. Human obese gene expression. Adipocyte-specific expression and regional differences in the adipose tissue. Diabetes. 1995;44:855-858.  [PubMed]  [DOI]
39.  Ahima RS, Saper CB, Flier JS, Elmquist JK. Leptin regulation of neuroendocrine systems. Front Neuroendocrinol. 2000;21:263-307.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 589]  [Cited by in RCA: 488]  [Article Influence: 18.8]  [Reference Citation Analysis (0)]
40.  Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, Friedman JM. Abnormal splicing of the leptin receptor in diabetic mice. Nature. 1996;379:632-635.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1719]  [Cited by in RCA: 1571]  [Article Influence: 52.4]  [Reference Citation Analysis (3)]
41.  Tartaglia LA. The leptin receptor. J Biol Chem. 1997;272:6093-6096.  [PubMed]  [DOI]
42.  Carvalheira JB, Ribeiro EB, Folli F, Velloso LA, Saad MJ. Interaction between leptin and insulin signaling pathways differentially affects JAK-STAT and PI 3-kinase-mediated signaling in rat liver. Biol Chem. 2003;384:151-159.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 53]  [Cited by in RCA: 57]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
43.  Tsochatzis E, Papatheodoridis GV, Archimandritis AJ. The evolving role of leptin and adiponectin in chronic liver diseases. Am J Gastroenterol. 2006;101:2629-2640.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 147]  [Cited by in RCA: 134]  [Article Influence: 6.7]  [Reference Citation Analysis (5)]
44.  Trujillo ME, Scherer PE. Adiponectin--journey from an adipocyte secretory protein to biomarker of the metabolic syndrome. J Intern Med. 2005;257:167-175.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 525]  [Cited by in RCA: 529]  [Article Influence: 25.2]  [Reference Citation Analysis (0)]
45.  Tsochatzis E, Papatheodoridis GV, Hadziyannis E, Georgiou A, Kafiri G, Tiniakos DG, Manesis EK, Archimandritis AJ. Serum adipokine levels in chronic liver diseases: association of resistin levels with fibrosis severity. Scand J Gastroenterol. 2008;43:1128-1136.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 56]  [Cited by in RCA: 53]  [Article Influence: 2.9]  [Reference Citation Analysis (3)]
46.  Hu ZW, Guo JW, Deng XL. [Association of serum leptin and insulin resistance with nonalcoholic fatty liver disease]. Nanfang Yikedaxue Xuebao. 2006;26:853-855.  [PubMed]  [DOI]
47.  Schwartz MW, Baskin DG, Bukowski TR, Kuijper JL, Foster D, Lasser G, Prunkard DE, Porte D, Woods SC, Seeley RJ. Specificity of leptin action on elevated blood glucose levels and hypothalamic neuropeptide Y gene expression in ob/ob mice. Diabetes. 1996;45:531-535.  [PubMed]  [DOI]
48.  Safar Zadeh E, Lungu AO, Cochran EK, Brown RJ, Ghany MG, Heller T, Kleiner DE, Gorden P. The liver diseases of lipodystrophy: the long-term effect of leptin treatment. J Hepatol. 2013;59:131-137.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 146]  [Cited by in RCA: 141]  [Article Influence: 10.8]  [Reference Citation Analysis (0)]
49.  Huang XD, Fan Y, Zhang H, Wang P, Yuan JP, Li MJ, Zhan XY. Serum leptin and soluble leptin receptor in non-alcoholic fatty liver disease. World J Gastroenterol. 2008;14:2888-2893.  [PubMed]  [DOI]
50.  Le D, Marks D, Lyle E, Corless CL, Diggs BS, Jobe BA, Kay T, Deveney CW, Wolfe BM, Roberts CT. Serum leptin levels, hepatic leptin receptor transcription, and clinical predictors of non-alcoholic steatohepatitis in obese bariatric surgery patients. Surg Endosc. 2007;21:1593-1599.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 21]  [Cited by in RCA: 18]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
51.  Savage DB, Sewter CP, Klenk ES, Segal DG, Vidal-Puig A, Considine RV, O’Rahilly S. Resistin/Fizz3 expression in relation to obesity and peroxisome proliferator-activated receptor-gamma action in humans. Diabetes. 2001;50:2199-2202.  [PubMed]  [DOI]
52.  Qi Y, Nie Z, Lee YS, Singhal NS, Scherer PE, Lazar MA, Ahima RS. Loss of resistin improves glucose homeostasis in leptin deficiency. Diabetes. 2006;55:3083-3090.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 119]  [Cited by in RCA: 112]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
53.  Muse ED, Obici S, Bhanot S, Monia BP, McKay RA, Rajala MW, Scherer PE, Rossetti L. Role of resistin in diet-induced hepatic insulin resistance. J Clin Invest. 2004;114:232-239.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 107]  [Article Influence: 4.9]  [Reference Citation Analysis (0)]
54.  Singhal NS, Patel RT, Qi Y, Lee YS, Ahima RS. Loss of resistin ameliorates hyperlipidemia and hepatic steatosis in leptin-deficient mice. Am J Physiol Endocrinol Metab. 2008;295:E331-E338.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 51]  [Cited by in RCA: 50]  [Article Influence: 2.8]  [Reference Citation Analysis (1)]
55.  Zhang F, Lu Y, Zheng S. Peroxisome proliferator-activated receptor-γ cross-regulation of signaling events implicated in liver fibrogenesis. Cell Signal. 2012;24:596-605.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 59]  [Cited by in RCA: 55]  [Article Influence: 3.9]  [Reference Citation Analysis (4)]
56.  Tontonoz P, Spiegelman BM. Fat and beyond: the diverse biology of PPARgamma. Annu Rev Biochem. 2008;77:289-312.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1806]  [Cited by in RCA: 1675]  [Article Influence: 93.1]  [Reference Citation Analysis (7)]
57.  Spiegelman BM, Flier JS. Adipogenesis and obesity: rounding out the big picture. Cell. 1996;87:377-389.  [PubMed]  [DOI]
58.  Abdelkarim M, Caron S, Duhem C, Prawitt J, Dumont J, Lucas A, Bouchaert E, Briand O, Brozek J, Kuipers F. The farnesoid X receptor regulates adipocyte differentiation and function by promoting peroxisome proliferator-activated receptor-gamma and interfering with the Wnt/beta-catenin pathways. J Biol Chem. 2010;285:36759-36767.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 67]  [Cited by in RCA: 80]  [Article Influence: 5.0]  [Reference Citation Analysis (4)]
Footnotes

P- Reviewer: Marie JC S- Editor: Ding Y L- Editor: Wang TQ E- Editor: Liu XM

Write to the Help Desk