BPG is committed to discovery and dissemination of knowledge
Gastric Cancer Open Access
©2006 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Feb 7, 2006; 12(5): 686-690
Published online Feb 7, 2006. doi: 10.3748/wjg.v12.i5.686
Construction of retroviral vector of p125FAK specific ribozyme genes and its effects on BGC-823 cells
Guo-Xian Guan, Hong-Xing Jian, Dong-Yin Lei, Hui-Shan Lu, Xiang-Fu Zhang, Department of Oncology, Affiliated Union Hospital, Fujian Medical University, Fuzhou 350001, Fujian Province, China
Supported by the Natural Science Foundation of Fujian Province, No.C0010015
Correspondence to: Guo-Xian Guan, Department of Oncology, Affiliated Union Hospital, Fujian Medical University, Fuzhou 350001, Fujian Province, China. gxguan1108@163.com
Telephone: +86-591-83357896 Fax: +86-591-83321970
Received: June 22, 2005
Revised: June 28, 2005
Accepted: August 14, 2005
Published online: February 7, 2006

Abstract

AIM: To construct the retroviral vector of p125FAK specific ribozyme genes and to explore the feasibility of ribozyme in BGC-823 gene therapy in vitro.

METHODS: A hammerhead ribozyme DNA targeting p125FAK mRNA from nt 1010 to nt 1032 was synthesized and recombinated into the retroviral vector pLXSN forming pLRZXSN recon. Using the lipofectin-mediated DNA transfection technique, pLRZXSN was introduced into BGC-823 cells. The effects of ribozyme on the growth of BGC-823 cells and apoptosis were studied by cell colony assay, flow cytometry (FCM), reverse transcriptase-polymerase chain reaction (RT-PCR), detection of DNA fragmentation and electron microscopy.

RESULTS: The number of BGC-823 cell colonies was inhibited by 56% after the cells were treated for 48 h. The cell proliferation was inhibited effectively by p125FAK ribozyme and the inhibitory effect depended on the concentration and the time of incubation. The expression of p125FAK mRNA and protein P125 decreased sharply in BGC-823 cells treated with p125FAK ribozyme. The characteristics of apoptosis, namely sub-G1 peak, DNA fragmentation and morphological changes, were revealed in BGC-823 cells treated with p125FAK ribozyme.

CONCLUSION: p125FAK ribozyme decreases p125FAK gene expression and induces apoptosis of human gastric cancer cells in vitro.

Key Words: Ribozyme; p125FAK gene; Stomach neoplasm; Apoptosis



INTRODUCTION

p125FAK is a non-receptor cytoplasm protein tyrosine kinase (PTK) with a molecular weight of 125 ku , which has unique structural and functional characteristics . Focal adhesion kinase (FAK) regulates multiple cellular processes including growth, differentiation, adhesion, motility and apoptosis[1-4]. The high expression of p125FAK is possibly a part of cell incidents contributing to the invasion and metastasis of tumors[5-7]. Ribozyme (RZ) is defined as a kind of small RNA molecule that has catalytic activity and can inhibit the translation process of mRNA after RZ combines with the complementary sequences of mRNA and incises it[8-11]. In this study, a hammerhead ribozyme DNA targeting p125FAK mRNA from nt 1010 to nt 1032 was synthesized according to p125FAK cDNA sequences, and recombinated into the retroviral vector pLXSN forming pLRZXSN recon. Using the lipofectin-mediated DNA transfection technique, pLRZXSN was introduced into BGC-823 cells to study the expression of RZ and its effect on BGC-823 cells.

MATERIALS AND METHODS
Materials

BGC-823 cells were purchased from Shanghai Cytobiology Institute of Chinese Academy of Medical Sciences. E. coli DH-5 were donated by Hematopathy Laboratory of Fujian Medical University. Restriction enzymes (HindIII, pstI, BamHI, XhoI)and T4DNA ligase, X-gal, ITPG were all from Promega. pBluescript@SK plasmid was from Stratagene. RT-PCR kit was from Promega, Lipofectin TM was from Gibco/BRL,p125FAK(H-1)was from American Santa Cruz. S-P kit and DAB kit were from Maxim Biotechnology and Zymed Lab Inc, respectively.

Design and synthesis of RZ template

GUU triplets of nt 1010 to nt 1032 in p125FAK cDNA base sequences were used as cleavage sites. Two small nucleotide sequences complementary to the cleavage sites of target RNA were put at the two ends of the conservative core sequence-(the hammerhead structure) to form a typical active incisive secondary structure of RZ as previously described[12]. The two limbs and complementary ribonucleotides of target RNA were all 10 nt. RZ gene consisted of 2 completely complementary trains called trains A and B, consisting of 60 bases respectively. Two cleavage sites and 3 protective bases were synthesized by Shanghai Sangon Technology Corporation. The sequences of RZ gene were 5’CGGACTCATCAGCAAGCTGGATAAGCTTCGT-3’ for train A and 3’GCCTGAGTAGTCGTTCGACCTATTCGAAGCA-5’ for train B.

Constructtion of sequencing vector and DNA sequence analysis

Plasmid extraction, restrictive enzymolysis reaction, ligase coupled reaction, preparation of competent germ, E coli transfection,agarose gel electrophoresis and DNA fragment retrieval were routinely carried out. DNA sequencing was undertaken by Shanghai Sangon Technology Corporation.

Construction of pLRZSN recon

Sequencing of a fragment of 81 bp was carried out with Bam HI and Xho I, retrieved by polyacrylamide gel electrophoresis(PGE), recombinated into pLXSN cleavage sites of Bam HI and XhoI and then labeled as pLRZSN. The pLRZSN from QIAGEN was exactly quantified and sub-packaged for later use.

Transfection of BGC-823 cells

BGC-823 cells in log growth phase were divided into BGC 823 cell blank group, BGC-823 cells + LipofectinTM group, BGC-823 cells + pLXSN group and BGC-823 cells + pLRZSN group. Liquor A was obtained by adding 4 μg DNA (pLXSN or pLRZSN) to 100 μL serum-free RPMI1640, while liguor B was obtained by adding 10μL LipofectinTM to 90 μL serum-free RPMI1 640. Liguors A and B were mixed after 30 min and stood for 15 min. At the same time, 1×106 BGC-823 cells in log growth phase were washed. After resuspension in 0.8mL serum-free RPMI1640,the mixture of liquors A and B was added into the suspension and incubated at 37 °C in an atmosphere containing 5% CO2 for 6 h . Four mL RPMI1640 containing 10% serum was added into the suspension and incubated for 48-72 h and then the BGC823 cells were collected.

Colony forming experiment

After incubated for 48 h, the 4 groups of cells were digested in monoplast suspensions and inoculated into 24-well plates (200/well). At the same time, 3 parallel wells were being designed. After being incubation for 7 d, colonies formed when the number of cells was over 50. The number of colonies was calculated under microscope and the colony forming efficiency was determined.

Detection of p125FAK protein

After being incubated for 48 h, the 4 groups of cells were digested in monoplast suspensions and inoculated onto slides. When the slides were open-air dried and fixed in cold acetone for 10 min,immunochemistry dyeing was carried out by S-P method. Positive cell cytoplasm was buffy, nuclei and negative cells were not stained. p125FAK positive cell labeling index (PI = p125FAK positive cell number under one field of vision/1000×100%) was calculated. After being incubated for 48 h, the 4 groups of cells were digested in monoplast suspensions and prepared into specimens. p125FAK protein was detected by flow cytometry (Bio-Rad, Bryte-HS).

Evaluation of p125FAK mRNA

Total RNA was extracted from the cells after incubation for 48 h. cDNA synthesis and PCR amplification were performed as previously described[13]. p125FAK gene nucleotide sequence to be amplified the primers used are listed in Table 1.

Table 1 Primer sequence and fragment length.
PrimerSequenceFragment length (bp)Annealin Temp (°C)
p125FAKA: 5’TTCTTCTATCAACAGGTGAAG3’63255
B: 5’CTGCGAGGTTCCATTCACCAG3’
β-actin ’A: 5’GGCATGGGTCAGAAGGATTCC350055
B: 5’ATGTCACGCACGATTTCCCGC3’
Detection of apoptosis of BGC-823 cells

After being incubated for 48 h, the 4 groups of cells were digested in monoplast suspensions, poached with PBS, centrifuged and incubated for 30 min in Kenesis50 kit (BioRad) and the DNA contents were analyzed by FCM. The ultra-structure of BGC-823 cells was observed under transmission electron microscope. The 4 groups of cells incubated for 48 h were prepared and photographed. Extraction and electrophoresis of DNA apoptotic fragments were carried out following the directions of apoptotic DNA ladder kit (Roche Corporation).

Statistical analysis

The data were expressed as mean ± SD. The variance analysis and significant difference test were crried out by SPSS 10.0.

RESULTS
Effect of RZ on colony forming efficiency (CFE) of BGC-823 cells

The results of colony forming experiment are summarized in Table 2. RZ could inhibit colony formation of BGC-823 cells (P < 0.05).

Table 2 Effect of RZ on colony formation of BGC-823 cells.
GroupsCFE (%)CIE (%)
Control group51.24 ± 6.8a
Liposome group46.43 ± 8.6a9.38
Keno-vector group45.32 ± 5.2a11.55
Ribozyme group16.14 ± 3.5a68.5
Effect of RZ on expression of BGC-823 p125FAK protein

After the cells were incubated for 48 h, the expression rate of p125FAK protein was 88.4% in control group, 79.55% in liposome group, 77.08% in kenovector group, and 46.09% in ribozyme group. A significant difference was found among the 4 groups. The positive number of BGC823 cells expressed in the p125FAK protein decreased sharply and the intensity of expression also weakened. PI was obviously smaller in RZ group than in other three groups (Figure 1A).

Figure 1
Figure 1 Expression of p125FAK protein (A) and mRNA (B) in BGC 823 cells M: Marker; lane 1: control; lane 2: liposome; lane 3: keno-vector; lane 4: RZ
Effect of RZ on p125FAK mRNA expression in BGC 823 cells

PCR product electrophoresis showed 632 bp and 500 bp bands. The fluorescence intensity value of p125FAK and β-actin was 1.23 in control group, 0.98 in liposome group, 0.92 in keno-vector group, and 0.38 in RZ group, indicating that the level of p125FAK mRNA in BGC-823 cells decreased sharply than that in other three groups (Figure 1B).

Apoptosis of BGC-823 cells induced by RZ

Apoptotic peak (sub-diploid peak) appeared in RZ group but not in other three groups (Figure 2).

Figure 2
Figure 2 Cell cycle analysis of cells cultivated for 48 h in liposome group (A), keno-vector group (B) and RZ group (C).

Karyopynosis, chromatin margination, complete caryotheca, condensed kytoplasm with deep staining were found in RZ group. Larger karyoplasmic ratio, puffed chromotin, clear plasmosome, and abundant cytoplasm were seen in other three groups. These cells were poorly-differentiated BGC-823 cells which did not undergo apoptosis (Figure 3).

Figure 3
Figure 3 Apoptotic changes of BGC-823 cells in RZ group.

Typical DNA fragments were seen in RZ group but not in other three groups (Figure 4).

Figure 4
Figure 4 DNA fragments of BGC-823 cells in different groups M: 123 bp DNA ladder; lane1: liposome group; lane 2: keno-vector group; lane 3: RZ group for 24 h; lane 4: RZ group for 48 h; lane 5: RZ group for 72 h.
DISCUSSION

Recent studies showed that when malignant cells adhere to extra-cellular matrix (ECM), p125FAK tyrosine self phosphorylation takes place and its activity increases[14-16]. The precise mechanism of p125FAK underlying apoptosis is not clear. But when malignant cells spread or migrate , p125FAK regulates the formation of adhesion plaque or takes part in signal cascade conduction and inhibits apoptosis by informing karyoplasts to that cells are ECM-anchored[17,18]. Anti-sense oligonucleotides of p125FAK have been used to inhibit the expression of p125FAK gene in order to induce apoptosis of malignant cells[19,20], but the result is not satisfactory because the number of target RNAs is so larger that complete blocking is impossible and anti-sense oligonucleotides are so easy to be degraded. RZ may solve the above problems. Ribozyme is a small RNA molecule that has catalytic activity. On the one hand, it can combine with complementary sequences of mRNA to block the translation of mRNA. moreover, it can incise mRNA and promote the degradation of mRNA[10,21]. Symons[8] reported that RZ can be used in treatment of viral disease and tumor. RZ genes such as c-erbB-2, P53, Ras, TGF-β, can be used in oncotherapy[22-25]. Qian et al [26] reported that FGFR3 RZ gene could inhibit the growth of myeloma cells and promote their apoptosis. But studies on p125FAK RZ gene are relatively fewer. In the present study, a hammerhead ribozyme DNA targeting p125FAK mRNA from nt 1010 to nt 1032 was synthesized according to p125FAK cDNA sequences, and recombinated into the retroviral vector pLXSN forming pLRZXSN recon. Using the lipofectin-mediated DNA transfection technique, pLRZXSN was introduced into BGC-823 cells to inhibit the growth of BGC-823 cells to observe the typical changes of apoptosis under electron microscope. The results demonstrate that p125FAK RZ gene is sequence specific and can be used in treatment of gastric carcinoma.

References
1.  Juliano RL, Haskill S. Signal transduction from the extracellular matrix. J Cell Biol. 1993;120:577-585.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1302]  [Cited by in RCA: 1225]  [Article Influence: 37.1]  [Reference Citation Analysis (0)]
2.  Xu LH, Yang X, Craven RJ, Cance WG. The COOH-terminal domain of the focal adhesion kinase induces loss of adhesion and cell death in human tumor cells. Cell Growth Differ. 1998;9:999-1005.  [PubMed]  [DOI]
3.  Tamura M, Gu J, Takino T, Yamada KM. Tumor suppressor PTEN inhibition of cell invasion, migration, and growth: differential involvement of focal adhesion kinase and p130Cas. Cancer Res. 1999;59:442-449.  [PubMed]  [DOI]
4.  Kasahara T, Koguchi E, Funakoshi M, Aizu-Yokota E, Sonoda Y. Antiapoptotic action of focal adhesion kinase (FAK) against ionizing radiation. Antioxid Redox Signal. 2002;4:491-499.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 72]  [Cited by in RCA: 70]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
5.  van Nimwegen MJ, Verkoeijen S, van Buren L, Burg D, van de Water B. Requirement for focal adhesion kinase in the early phase of mammary adenocarcinoma lung metastasis formation. Cancer Res. 2005;65:4698-4706.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 112]  [Cited by in RCA: 110]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
6.  Varadarajulu J, Laser M, Hupp M, Wu R, Hauck CR. Targeting of alpha(v) integrins interferes with FAK activation and smooth muscle cell migration and invasion. Biochem Biophys Res Commun. 2005;331:404-412.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 21]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
7.  Mitra SK, Hanson DA, Schlaepfer DD. Focal adhesion kinase: in command and control of cell motility. Nat Rev Mol Cell Biol. 2005;6:56-68.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2175]  [Cited by in RCA: 2012]  [Article Influence: 95.8]  [Reference Citation Analysis (0)]
8.  Symons RH. Small catalytic RNAs. Annu Rev Biochem. 1992;61:641-671.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 323]  [Cited by in RCA: 312]  [Article Influence: 9.2]  [Reference Citation Analysis (0)]
9.  Kim DE, Joyce GF. Cross-catalytic replication of an RNA ligase ribozyme. Chem Biol. 2004;11:1505-1512.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 107]  [Cited by in RCA: 85]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
10.  Scanlon KJ. Anti-genes: siRNA, ribozymes and antisense. Curr Pharm Biotechnol. 2004;5:415-420.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 46]  [Cited by in RCA: 36]  [Article Influence: 1.6]  [Reference Citation Analysis (1)]
11.  Tobé S, Heams T, Vergne J, Hervé G, Maurel MC. The catalytic mechanism of hairpin ribozyme studied by hydrostatic pressure. Nucleic Acids Res. 2005;33:2557-2564.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 43]  [Cited by in RCA: 37]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
12.  Haseloff J, Gerlach WL. Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature. 1988;334:585-591.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 801]  [Cited by in RCA: 746]  [Article Influence: 19.6]  [Reference Citation Analysis (0)]
13.  Chen YZ, Gu XF, Caen JP, Han ZC. Interleukin-3 is an autocrine growth factor of human megakaryoblasts, the DAMI and MEG-01 cells. Br J Haematol. 1994;88:481-487.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 12]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
14.  Kahana O, Micksche M, Witz IP, Yron I. The focal adhesion kinase (P125FAK) is constitutively active in human malignant melanoma. Oncogene. 2002;21:3969-3977.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 64]  [Cited by in RCA: 58]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
15.  Golubovskaya VM, Gross S, Kaur AS, Wilson RI, Xu LH, Yang XH, Cance WG. Simultaneous inhibition of focal adhesion kinase and SRC enhances detachment and apoptosis in colon cancer cell lines. Mol Cancer Res. 2003;1:755-764.  [PubMed]  [DOI]
16.  Beviglia L, Golubovskaya V, Xu L, Yang X, Craven RJ, Cance WG. Focal adhesion kinase N-terminus in breast carcinoma cells induces rounding, detachment and apoptosis. Biochem J. 2003;373:201-210.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 41]  [Cited by in RCA: 44]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
17.  Xu LH, Owens LV, Sturge GC, Yang X, Liu ET, Craven RJ, Cance WG. Attenuation of the expression of the focal adhesion kinase induces apoptosis in tumor cells. Cell Growth Differ. 1996;7:413-418.  [PubMed]  [DOI]
18.  Han EK, Mcgonigal T, Wang J, Giranda VL, Luo Y. Functional analysis of focal adhesion kinase (FAK) reduction by small inhibitory RNAs. Anticancer Res. 2004;24:3899-3905.  [PubMed]  [DOI]
19.  Gu Y, Chen JS, Zhou XD. [Inhibitory effects of antisense focal adhesion kinase oligodeoxynucleotides on the invasion of Bel 7402 hepatocellular carcinoma cells]. Zhonghua Gan Zang Bing Za Zhi. 2003;11:612-615.  [PubMed]  [DOI]
20.  Hauck CR, Sieg DJ, Hsia DA, Loftus JC, Gaarde WA, Monia BP, Schlaepfer DD. Inhibition of focal adhesion kinase expression or activity disrupts epidermal growth factor-stimulated signaling promoting the migration of invasive human carcinoma cells. Cancer Res. 2001;61:7079-7090.  [PubMed]  [DOI]
21.  Zhang YC, Taylor MM, Samson WK, Phillips MI. Antisense inhibition: oligonucleotides, ribozymes, and siRNAs. Methods Mol Med. 2005;106:11-34.  [PubMed]  [DOI]
22.  Abuharbeid S, Apel J, Sander M, Fiedler B, Langer M, Zuzarte ML, Czubayko F, Aigner A. Cytotoxicity of the novel anti-cancer drug rViscumin depends on HER-2 levels in SKOV-3 cells. Biochem Biophys Res Commun. 2004;321:403-412.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 25]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
23.  Shin KS, Sullenger BA, Lee SW. Ribozyme-mediated induction of apoptosis in human cancer cells by targeted repair of mutant p53 RNA. Mol Ther. 2004;10:365-372.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 60]  [Cited by in RCA: 54]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
24.  Kijima H, Yamazaki H, Nakamura M, Scanlon KJ, Osamura RY, Ueyama Y. Ribozyme against mutant K-ras mRNA suppresses tumor growth of pancreatic cancer. Int J Oncol. 2004;24:559-564.  [PubMed]  [DOI]
25.  Song YH, Chen XL, Kong XJ, Liu NZ, Li W, Wu XL, Lin JS, Jin YX. Ribozymes against TGFbeta1 reverse character of activated hepatic stellate cells in vitro and inhibit liver fibrosis in rats. J Gene Med. 2005;7:965-976.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 9]  [Article Influence: 0.4]  [Reference Citation Analysis (1)]
26.  Qian S, Somlo G, Zhou B, Zhu L, Mi S, Mo X, Cheung EM, Qiu W, Lin RJ, Rossi J. Ribozyme cleavage leads to decreased expression of fibroblast growth factor receptor 3 in human multiple myeloma cells, which is associated with apoptosis and downregulation of vascular endothelial growth factor. Oligonucleotides. 2005;15:1-11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 11]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
Footnotes

S- Editor Wang XL and Guo SY L- Editor Elsevier HK E- Editor Cao L

Write to the Help Desk