BPG is committed to discovery and dissemination of knowledge
Clinical Research Open Access
©2005 Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Nov 21, 2005; 11(43): 6815-6822
Published online Nov 21, 2005. doi: 10.3748/wjg.v11.i43.6815
Association between cag-pathogenicity island in Helicobacter pylori isolates from peptic ulcer, gastric carcinoma, and non-ulcer dyspepsia subjects with histological changes
Mahaboob Ali, Aleem A Khan, Santosh K Tiwari, CM Habibullah, Center for Liver Research and Diagnostics, Deccan College of Medical Sciences, Kanchanbagh, Hyderabad 500 058, Andhra Pradesh, India
Niyaz Ahmed, Pathogen Evolution Group, Centre for DNA Fingerprinting and Diagnostics, Nacharam Main Road, Hyderabad 500 076, Andhra Pradesh, India
Mahaboob Ali, L Venkateswar Rao, Department of Microbiolo-gy, Osmania University, Hyderabad 500 007, Andhra Pradesh, India
Author contributions: All authors contributed equally to the work.
Supported by the Department of Biotechnology, Government of India , NO. BT/PR2473/Med/13/106/2001
Correspondence to: Professor L Venkateswar Rao, Head of the Department, Department of Microbiology, Osmania University, Hyderabad 500 007, Andhra Pradesh, India. vrlinga@yahoo.com
Telephone: +91-40-27090661 Fax: +91-40-27090661
Received: March 24, 2005
Revised: April 26, 2005
Accepted: April 30, 2005
Published online: November 21, 2005

Abstract

AIM: To investigate the presence of the cag-pathogenicity island and the associated histological damage caused by strains with complete cag-PAI and with partial deletions in correlation to the disease status.

METHODS: We analyzed the complete cag-PAI of 174 representative Helicobacter pylori (H pylori ) clinical isolates obtained from patients with duodenal ulcer, gastric ulcer, gastric cancer, and non-ulcer dyspepsia using eight different oligonucleotide primers viz cagA1, cagA2, cagAP1, cagAP2, cagE, cagT, LEC-1, LEC-2 spanning five different loci of the whole cag-PAI by polymerase chain reaction (PCR).

RESULTS: The complete screening of the genes comprising the cag-PAI showed that larger proportions of subjects with gastric ulcer (97.8%) inhabited strains with complete cag-PAI, followed by gastric cancer (85.7%), non-ulcer dyspepsia (7.1%), and duodenal ulcer (6.9%), significant differences were found in the percentage distribution of the genes in all the clinical groups studied. It was found that strains with complete cag-PAI were able to cause severe histological damage than with the partially deleted ones.

CONCLUSION: The cag-PAI is a strong virulent marker in the disease pathogenesis as it is shown that a large number of those infected with strain with complete cag-PAI had one or the other of the irreversible gastric pathologies and interestingly 18.5% of them developed gastric carcinoma. The presence of an intact cag-PAI correlates with the development of more severe pathology, and such strains were found more frequently in patients with severe gastroduodenal disease. Partial deletions of the cag-PAI appear to be sufficient to render the organism less pathogenic.

Key Words: Helicobacter pylori; cag-pathogenicity island; Genetic diversity; Gastro-duodenal diseases



INTRODUCTION

Gastric cancer is the second most deadly malignant neoplasia worldwide. According to the presently available statistics, approximately 74% of those diagnosed succumb to this disease every year[1]; this is because of poor prognosis as it is often made when the disease has assaulted the muscularis propria. Evidences show that the pathogenesis of gastric cancer is a multistep process[2,3]. This ‘cascade’ is believed to be triggered by Helicobacter pylori (H pylori ) infection, a Gram negative pathogen. Chronic infection with this gastric pathogen is known to be the major factor driving the precancerous process via mechanisms including direct transformation of cells, induction of immunosuppression with consequently reduced cancer immunosurveillance, or by causing chronic inflammation[4,5]. In 1994, the International Agency for Research on Cancer (IARC) declared H pylori a Class l (definite) carcinogen based on the epidemiological and interventional studies in human beings[6] and convinced that this bacterial infection indeed plays a key role in the initiation of the neoplastic process in the stomach.

Although many attempts in the past have been made to understand and associate the causal link between H pylori infection and the sequelae that leads to gastric carcinoma[7,8], there are conflicting data in the literature due to differences in the study population and designs[9,10].

In the past few years, many H pylori virulence factors have been described that contribute to the survival of this pathogen in an extremely hostile acidic milieu of the stomach and its colonization in that organ[11,12]. Other putative virulence determinants such as vacuolating cytotoxin gene A (vacA), cytotoxin associated gene pathogenicity island (cag-PAI) and induced by contact with epithelium gene A (iceA) are not present in all H pylori strains or are known to exhibit different allelic variations[13]. The cytotoxin-associated gene island also referred to as the cag-PAI is an approximately 40-kb cluster of genes and is the most studied marker of the H pylori. In many studies[20,22,24], this large fragment has been a criterion of typing H pylori into pathogenic and non-pathogenic strains (Type I and Type II). Studies emphasizing on the functional importance of this island have reported that strains possessing cag-PAI induce more notable phenotypic changes in vivo, such as higher levels of IL-8 production than cag-PAI negative ones[30]. Recent studies made from within our institute[14,15] and other parts of the world[16,17] have mainly focused on the presence of this large fragment and its association with the disease status. Therefore, in a continuing attempt to further establish a strong epidemiologic relation between the cag-PAI and the disease conditions with reference to the histopathologic changes lead to the inception of the present study. As it is reported[18] that the presence of cag island and the consequent cag instability may produce differences in the pathogenicity and host adaptability within a bacterial strain, detailed analyses of the genes of the cag island in human beings isolates with reference to histologic damage and disease outcome would be essential. Therefore, compelled by these observations, the present study was designed to identify the distribution of different genes of the cag-PAI in clinical H pylori isolates by assessing the presence of representative genes located in different segments of the cag-island and its correlation with the histologic changes and disease status.

MATERIALS AND METHODS
Patients and sampling

The study population consisted of 174 patients (100 males and 74 females) with a mean age of 48.4 years (range 21-73 years). The patients were classified at the time of endoscopy into those suffering from active ulcers disease [duodenal ulcers (n = 58), gastric ulcers (n = 46), gastric carcinoma (n = 14)] and those with no evidence of mucosal ulcer and gastritis, but suffering from mild or severe dyspeptic symptoms, i.e. non-ulcer dyspepsia (n = 56). None of the patients included in the study had received NSAIDs or antibiotics within the previous 2 mo. Informed consents were taken from the patients who underwent upper gastrointestinal endoscopy at the department of gastroenterology, Deccan College of Medical Sciences, Hyderabad.

Four gastric biopsies were collected: one in urea solution for the rapid urease test (RUT), one in supplemented broth for isolating culture, one in phosphate-buffered saline (PBS) for testing by PCR assay, and one in 10% buffered formalin for histological examination by modified Giemsa stain for the presence of H pylori.

H pylori strains

A total of 174 clinical H pylori strains were screened for the presence of cag-PAI genes. These strains were recovered from individual subjects undergoing upper gastrointestinal endoscopy presenting with various symptoms. This included 43 live strains and 131 genomic DNA isolated from the gastric biopsy.

Extraction of genomic DNA

H pylori culture and DNA extraction from the culture and biopsy was carried out as described elsewhere[19].

PCR analysis of the cag-PAI genes

The genes of the cag-PAI were PCR amplified under the conditions described by Ikenoue et al[20]. One microliter of the extracted genomic DNA was used in a 20 μL reaction volume containing 1´ PCR buffer, 1 U Taq DNA polymerase, 1.5 mmol/L Mg2+, 200 μmol/L each dNTP and 10 pmol/L of each primer.

The cycling parameters were optimized and are as follows: Initial denaturation at 95 °C for 5 min, followed by 40 cycles each of denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s and extension at 72 °C for 1.5 min and finally after the last cycle, extension was continued for another 7 min.

Eight sets of oligonucleotide primers spanning the 40 kb cag-PAI were used in the study. Appropriate positive and negative controls were included in each set to avoid misinterpretation of results. The details of the primers used with their product sizes are enlisted in Table 1. Amplicons were separated by electrophoresis on 2% agarose gel and stained by ethidium bromide.

Table 1 List of primers.
TargetPrimerSequence (5’- 3’)Product
genesize (bp)
CagA-F1AACAGGACAAGTAGCTAGCC
CagA1CagA-R1TATTAATGCGTGTGTGGCTG701
CagA-F2GATAACAGGCAAGCTTTTGA
CagA2CagA-R2CTGCAAAAGATTGTTTGGCAGA349
CagAP-F1GTGGGTAAAAATGTGAATCG
CagAP1CagA-R1TATTAATGCGTGTGTGGCTG730
CagAP-F2CTACTTGTCCCAACCATTTT
CagAP2CagA-R2CTGCAAAAGATTGTTTGGCAGA1 181
CagE-F1GCGATTGTTATTGTGCTTGTAG
CagECagE-R1GAAGTGGTTAAAAAATCAATGCCCC329
CagT-F1CCATGTTTATACGCCTGTGT
CagTCagT-R1CATCACCACACCCTTTTGAT301
LEC-F1ACATTTTGGCTAAATAAACGCTG
LEC-1LEC-R1TCTCCATGTTGCCATTATGCT384
LEC-F2ATAGCGTTTTGTGCATAGAA
LEC-2LEC-R2ATCTTTAGTCTCTTTAGCTT877
Histopathological analysis

The biopsy specimen collected from the gastric antrum was used for histopathologic examination to grade the severity of disease after they were embedded in paraffin and stained with hematoxylin and eosin. A single experienced pathologist (ZA), who was blinded to the patient’s history and molecular data of the isolate, evaluated all histological data. The grade of gastritis was determined on the basis of the updated Sydney system[21].

Statistical analysis

The data were analyzed by means of χ2 test and the Mann–Whitney U test.

RESULTS

In a total of 174 isolates screened, only 65 (37.4%) was found to carry the complete cag-PAI, while 109 (62.6%) carried the cag-PAI with partial deletions. No isolate was found with completely deleted cag-PAI (Table 2).

Table 2 Relationship between the presence of cag-PAI and the clinical status.
Clinical status (n)Intact PAI (%)cag-PAI typeCompletely deleted
Partially deletedPAI (%)
PAI (%)
DU (58)4 (6.9)54 (93.1)0
GU (46)45 (97.8)1 (2.2)0
NUD (56)4 (7.1)52 (92.9)0
GC (14)12 (85.7)2 (14.3)0
Total (174)65 (37.4)109 (62.6)0

With reference to the clinical status, we found majority of the duodenal ulcer (DU) isolates and non-ulcer dyspepsia (NUD) isolates to possess partially deleted cag-PAI, while on the contrary we found ~97.8% of the gastric ulcer (GU) isolates and 85.7% of the gastric carcinoma (GC) isolates possessed the intact cag-PAI. The details of the results obtained are given in Table 2 and Figure 1. Statistically these differences were highly significant.

Figure 1
Figure 1 Distribution of cag-PAI in dyspeptic subjects.

When checked for the presence of each locus, we could find that the total cagA gene (i.e. with promoters) to be present in 69 (39.7%) of all the isolates screened, 4 (2.3%) isolates had total deletion of the gene and 101 (58%) were carrying partial deletions. Of the 69-cagA positive isolates, prevalence of cagA gene was predominant among gastric ulcer (GU) and gastric carcinoma (GC) strains (Table 3 and Figure 2) simultaneously cagA gene with partial deletions were more prevalent among H pylori isolated from duodenal ulcer (DU) and non-ulcer dyspepsia (NUD) subjects.

Figure 2
Figure 2 Distribution of cagA in clinical isolates.
Table 3 cagA status of H pylori isolates.
Clinical status (n)cagA +ve (%)Partial cagA +ve (%)cagA–ve (%)
DU (58)8 (13.8)46 (79.3)4 (6.9)
GU (46)45 (97.8)1 (2.2)0
NUD (56)4 (7.1)52 (92.9)0
GC (14)12 (85.7)2 (14.3)0
Total (174)69 (39.7)101 (58)4 (2.3)

Observing the prevalence patterns of cagA deletion mutant strains, we further analyzed the predominance of deletions in the promoter and body part of the cagA gene. The body part of cagA gene (i.e. A1+A2) was present in a maximum number of isolates i.e. 134 (77%), among which a considerable number of isolates lacked the promoter region (i.e. AP1+AP2) (Table 4).

Table 4 Distribution of cagA gene and cagA promoter in H pylori isolates.
Clinical status (n)A1+A2 (%)AP1+AP2 (%)
DU (58)43 (74.1)8 (13.8)
GU (46)45 (97.8)46 (100)
NUD (56)32 (57.1)6 (10.7)
GC (14)14 (100)12 (85.7)
Total (174)134 (77)72 (41.4)

Screening of the cagII region of the cag-PAI revealed cagE, cagT, LEC-1, and LEC-2 to be present in 143 (82.1%), 145 (87.3%), 142 (81.6%) and 111 (63.7%) of the total isolates, respectively. The distribution of these genes with reference to disease status is illustrated in detail in Table 5 and Figure 3. We found the difference between DU and GU, GU and NUD, GC and NUD to be highly significant statistically.

Figure 3
Figure 3 Distribution of cagE, T, LEC1, LEC2
Table 5 Distribution of cagE, T, LEC1, and LEC2 in H pylori isolates.
Clinical status (n)cagE (%)cagT (%)LEC1 (%)LEC2 (%)
DU (58)47 (81)56 (96.5)44 (75.8)33 (56.8)
GU (46)46 (100)46 (100)46 (100)46 (100)
NUD (56)36 (64.2)36 (64.2)38 (67.8)18 (32.1)
GC (14)14 (100)14 (100)14 (100)14 (100)
Total (174)143 (82.1)152 (87.3)142 (81.6)111 (63.7)

In the present study, histopathological examination of antral biopsies from a total of 174 subjects was carried out to check the grade of gastritis and the differences between the pathologies of intact cag-PAI and partial cag-PAI infection. Of the 174 subjects included for the study, we screened 160 subjects as 14 of them had endoscopically proven gastric carcinoma and hence histopathology confirmed features of carcinoma. Out of the 160 subjects screened, all showed chronic gastritis and on further screening for any other advanced type of gastritis, we found 112 (70%) of the total 160 to possess topographic chronic superficial gastritis, 20 (12.5%) showed atrophic changes, whereas 18 (11.25%) and 10 (6.25%) of the subjects showed IM and dysplasia respectively (Table 6). When each of these histological lesions were scored individually in relation to their respective clinical status, we found that among the 58 duodenal ulcer cases, 52 (89.7%) showed chronic superficial gastritis, 2 (3.4%) showed atrophy and 4 (6.9%) showed intestinal metaplasia while none of the subjects had dysplasia (Table 6).

Table 6 Frequency of atrophy, metaplasia, and dysplasia in chronic gastritis subjects.
ClinicalAcuteChronic gastritis
status (n)gastritis (%)SuperficialGastritis withGastritis withGastritis with
gastritisatrophy (%)metaplasia (%)dysplasia (%)
DU (58)052 (89.7)2 (3.4)4 (6.9)0
GU (46)09 (19.6)13 (28.3)14 (30.4)10 (21.7)
NUD (56)051 (91.1)5 (8.9)00
Total (160)0112 (70)20 (12.5)18 (11.25)10 (6.25)

In the gastric ulcer category, we found that 9 (19.6%) showed chronic superficial gastritis, 13 (28.3%) showed atrophy, 14 (30.4%) showed intestinal metaplasia and 10 (21.7%) showed dysplasia. For atrophy, metaplasia and dysplasia, the difference between GU and DU was statistically highly significant (P<0.001, Table 6).

In the NUD category, we found that 51 (91.1%) showed chronic superficial gastritis and 5 (8.9%) showed atrophic gastritis while none had intestinal metaplasia and dysplasia. For metaplasia and dysplasia, the difference between GU and NUD, was statistically highly significant (P <0.001, Table 6).

When we analyzed the histological status, with reference to the strain infecting with either intact PAI or partially deleted ones, we found a significant difference among them. As evidenced from Table 7, we found that, of the 65 subjects infected with intact PAI, 8 (12.3%) showed chronic superficial gastritis, 17 (26.1%) showed atrophic changes, 18 (27.7%) showed intestinal metaplasia (all of them were Type III), 10 (15.4%) showed high grade dysplastic changes and 12 (18.5%) showed intestinal type gastric carcinoma. On the contrary, when we checked those subjects, who inhabited partially deleted strains, we found 104 (95.4%) to possess chronic superficial gastritis, 3 (2.8%) showed atrophy while 2 (1.8%) showed gastric carcinoma and these differences were statistically very significant (P<0.001, Table 7).

Table 7 Histological status of subjects with intact cag-PAI (n = 65) and partial cag-PAI (n = 109).
Cag-typeChronic gastritis
Gastric carcinoma
(n)Superficial gastritisGastritis with atrophy
Gastritis with metaplasia (%)
Gastritis with dysplasia(%)
Intestinal (%)
Diffuse (%)
(%)(%)Ty-1Ty-2Ty-3Low gradeHigh grade
Intact (65)8 (12.3)17 (26.1)b001801012b0
-27.7-15.4-18.5
Partial (109)104 (95.4)3 (2.8)000002 (1.8)0

When a correlation between the histological status of the subjects infected with either intact cag-PAI or partially deleted strains isolated from subjects with varied disease status was made, we found that among 58 DU subjects, 4 had intact cag-PAI and all of them were Type III intestinal metaplasia, among the remaining 54, which had partial deletions in the cag-PAI, 52 (96.3%) showed chronic superficial gastritis and 2 (3.7%) showed atrophic changes. Among the GU subjects, of the 46 infected, 45 were known to possess the cag-PAI and 8 (17.8%) of them showed chronic superficial gastritis, 13 (28.9%) showed atrophic gastritis, 14 (31.1%) showed Type III intestinal metaplasia and 10 (22.2%) showed high grade dysplastic changes (Table 8). Among the 56 NUD subjects, 4 with intact cag-PAI showed atrophic changes and of the rest with partial deletions 51 (98.1%) showed chronic superficial gastritis and 1 (1.9%) showed atrophic gastritis (Table 8) while among the 14 isolated from gastric carcinoma 12 had intact cag-PAI while the other 2 partial deletions and when scored for the type of gastric carcinoma all of them showed intestinal type of carcinoma (Table 8).

Table 8 Correlation of the histological status of the subjects with intact and partially deleted cag-PAI from varied disease status.
Clinical statusChronic gastritis
Gastric carcinoma
(n)cag statusSuperficial gastritisGastritis with atrophy (%)Gastritis with metaplasia (%)
Gastritis with dysplasia (%)
Intestinal (%)Diffuse (%)
(n)(%)Ty-1Ty-2Ty-3Low gradeHigh grade
DU (58)Intact (4)00004 (100)0000
Partial (54)52 (96.3)2 (3.7)0000000
GU (46)Intact (45)8(17.8)a13 (28.9)0014 (31.1)010 (22.2)00
Partial (1)1 (100)00000000
NUD (56)Intact (4)04(100)a0000000
Partial (52)51 (98.1)1 (1.9)0000000
GC (14)Intact (12)000000012 (100)b0
Partial (2)00000002 (100)0
DISCUSSION

The cag-PAI is an approximately 40-kb cluster of genes in H pylori chromosome, and a quite conservative entity. Censini et al[22] in 1996 first identified strains with partially deleted cag-PAIs. The molecular mechanism of these genetic rearrangements was explained by incorporation of an insertion element, IS605, in cag-PAI. Recently, the composition of the cag-PAI in clinical H pylori isolates has been studied in different populations by various methods, including PCR, dot blotting and long distance PCR[20,23,24].

In the present study, we used simple PCR for structural screening of cag-PAI in clinical isolates of H pylori. Out of the 174 clinical isolates, we found only 37.4% were carrying the complete cag-PAI (Table 2), whereas Mukhopadhyay et al[25] reported more than 96% in Calcutta strains of peptic ulcer and non-ulcer dyspepsia. In our study, 97.8% of gastric ulcer and 85.7% (Table 2 and Figure 1) of the gastric carcinoma strains were carrying complete PAI, which are considered to be severe forms of the gastro-duodenal diseases. Even though duodenal ulcer is also considered to be a severe form of the gastro-duodenal disease, the proportion of DU strains that carried was just 6.9%. Jenks et al[23] reported that the presence of certain genes (cagA, cagE, cagM, T, ORF 6, 10, 13) in the cag-PAI is highly associated with duodenal ulcers. We too found a similar type of observation, but not for all the seven genes which they selected. We observed the same kind of correlation with only two genes i.e. cagE and cagT, where DU cases carried cagE with 81% and cagT with 96.5% (Table 5 and Figure 3). Whereas NUD isolates were carrying the genes with an average of 65% (Table 5 and Figure 3). Further, Day et al[26] revealed that isolates containing cagE were associated with duodenal ulceration.

Among non-ulcer dyspepsia strains, we found 7.1% to carry the complete cag-PAI, which is statistically almost equal to DU percentage, and a report from Sweden[27] showed 58% of cag-PAI positivity in NUD isolates. In the same report, the authors showed that 5% of isolates from severe pathology i.e. gastric carcinoma and duodenal ulcer, and 15% of the isolates from NUD lacking the cag-PAI. Not only the data from other continents, but from the same Indian sub-continent showed total deletions from ulcer group and non-ulcer group[25], whereas we could not come across a single isolate with entirely deleted cag-PAI from any of the disease condition indicating strain diversity. This kind of diversity, i.e. absence of completely deleted PAIs and presence of just 6.9% complete cag-PAIs in duodenal ulcer cases, might be particularly true for the south Indian of Telugu linguistic group who are mainly Dravidian and married consanguineously for millennia[28]. Their genetic separation from other Indian communities during much of the human history has already been reported[29].

Strains with intermediate genotypes, lacking parts of the cag-PAI, were found in 62.6% (Table 2) and more frequently found in patients with non-ulcer dyspepsia and duodenal ulcer (Figure 1). A probable mechanism for the establishment of these internal deletions within the cag-PAI would be that the short repeated sequences found by Nilsson et al[27] may serve as homologies enabling slipped strand mispairing and consequently excision of the enclosed DNA fragment especially in DU and NUD subjects. Moreover, in our observation, the partially deleted cag-PAI represented a genotype more common than a complete cag-PAI and no strain was found with completely deleted cag-PAI.

Conventionally cagA was used and is still used as a marker for the presence of an intact cag-PAI and for virulence. Recently, Backert et al[30] showed a good correlation of cagA with the presence of cag-PAI. In this study, we found that 39.7% of the strains carried the complete cagA gene (Table 3) and the presence of cagA gene did not correlate with the genetic presence of complete cag-PAI. Further, for - 4 kb cagA gene, we used four sets of primers i.e. two primers for body of the gene and two primers for promoter, designed from various locations of the body region and promoter, whereas other studies taken up earlier had used a single set of primer for complete cag-PAI. This might be the reason for the correlation, which they obtained. The typical observation was when 77% of the isolates were carrying the body region (A1+A2) only 41.4% of them carried promoter region (Table 4), which means that in our isolates even though the strains carried the cagA gene, most of them lacked the promoter of the gene, without which cagA is not functional. Further, four isolates i.e. 2.3% completely lacked the cagA gene and all the four isolates belonged to duodenal ulcer cases.

Among many virulence markers present in the H pylori genome, cag-PAI is the major virulence factor and is associated with severe gastroduodenal pathology[31,32] that includes both duodenal and gastric ulcers along with carcinomas. Some studies have identified a correlation between an intact cag-PAI and development of disease[20,23,24,27], as we are trying to show with this present study in Indian scenario, whereas others could not find such a relationship[33,34].

“Infection with H pylori always causes chronic active gastritis”[35]. This phrase has become true in our observation. As it is observed in Table 6, there are no acute gastritis subjects. Moreover, the subjects infected with cag-PAI positive strains were found to show severe forms of histopathological changes, like atrophic gastritis, intestinal metaplasia, and neoplasia. This might be the reason for IARC-WHO to designate H pylori a class I (definite) carcinogen[6].

Out of the 174 isolates, 65 (37.4%) had complete cag-PAI and 109 (62.6%) had partial deletions in the cag-PAI (Table 2). As evident from Table 7, it can be observed that subjects infected with H pylori strains with intact cag-PAI had many remarkable histopathological changes, when compared to those who had partially deleted cag-PAI. It is quite clear from the statistics (P<0.001) that among 65 H pylori strains with intact cag-PAI, 18.5% subjects had advanced cancerous lesions, while only 1.8% of the 109 subjects, who harbored H pylori with partial cag-PAI had advanced to carcinoma thus allowing us to delineate that persons with intact cag-PAI are 10-fold more prone to develop carcinoma in comparison to the partially deleted cag-PAI strains.

Parallelly, a small group of population, i.e. 12.3% with intact cag-PAI, were shown to have only chronic superficial gastritis, but according to Ohkuma et al[36] H pylori positive cases with chronic gastritis have increased risk of atrophy and intestinal metaplasia. On the other hand, partial cag-PAI subjects were also shown to have chronic gastritis (Table 6), but the percentage of disease progression was very high among cag-PAI positive subjects (Table 7) than those with partially deleted ones. Moreover, Type-3 metaplasia and high-grade dysplasia were seen only in cag-PAI positive subjects, where Type-3 metaplasia is closely linked to carcinoma[37] and dysplasia is nothing but a non-invasive type of neoplasia[38]. The results of this study are in contrast to those obtained by Keates et al[39] who determined that gene products of the cag pathogenicity island are required for maximal activation of mitogen-activated protein kinases (MAPK) in gastric epithelial cells, which regulate cell proliferation, differentiation, inflammatory responses, stress, and programmed death, leading to induce gastroduodenal inflammation, ulceration and neoplasia. Further, Naumann et al[40] stated that the integrity of whole cag-PAI is also a pre-requisite for efficient activation of early transcription factor AP-1, which is known for its immuno-stimulatory function.

In relation with disease status, among DU, GU, and NUD, gastric ulcers are considered to be more prone to the gastric carcinoma[41]. The observations of this study are in correlation to that obtained by Hansson et al[41]. When we compare GU subjects with DU and NUD, the percentage of predisposing factors was much more among GU subjects. Recently, Wanatabe et al[42] proved this in animal models. In their study at 26 wk, Mongolian gerbils developed chronic gastritis, ulceration and metaplasia. At 62 wk, 31% of them developed adenocarcinoma. Interestingly the inoculum used for the infection was obtained from a patient with gastric ulcer. Moreover, there have been reports that gastric cancer mortality rates bear an inverse relationship to duodenal ulcer disease rates[43], suggesting that they are directly relating with gastric ulcer in ulcer groups.

Further, in partial cag-PAI subjects, 2.8% showed atrophy, 1.8% showed carcinoma (Table 7) suggesting the role of other virulence genes and risk factors. Parallelly high incidence rate of gastric carcinoma among the gastric ulcer cases might be true, but it should not be assigned to a single determinant such as cag-PAI, but it is a result of many factors such as host genetic factors, environment, low socio-economic status, irregular dietary habits in addition to H. pylori with complete cag-PAI[43].

Hence, we can suggest that the cag-PAI is a strong virulent marker in the disease pathogenesis because more than 85% of the cag-PAI positive subjects were shown to have one or the other of the irreversible gastric pathologies and interestingly 18.5% of them developed gastric carcinoma and GU is the major risk/predisposing factor for the gastric carcinoma. Moreover, duodenal ulcer is not at all a risk factor for severe gastric pathologies and it is not a severe kind of disease, like gastric ulcer in our population.

References
1.  Leung WK, Lin SR, Ching JY, To KF, Ng EK, Chan FK, Lau JY, Sung JJ. Factors predicting progression of gastric intestinal metaplasia: results of a randomised trial on Helicobacter pylori eradication. Gut. 2004;53:1244-1249.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 340]  [Cited by in RCA: 321]  [Article Influence: 14.6]  [Reference Citation Analysis (6)]
2.  Correa P. Human gastric carcinogenesis: a multistep and multifactorial process--First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention. Cancer Res. 1992;52:6735-6740.  [PubMed]  [DOI]
3.  Kuipers EJ, Uyterlinde AM, Peña AS, Roosendaal R, Pals G, Nelis GF, Festen HP, Meuwissen SG. Long-term sequelae of Helicobacter pylori gastritis. Lancet. 1995;345:1525-1528.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 577]  [Cited by in RCA: 496]  [Article Influence: 16.0]  [Reference Citation Analysis (2)]
4.  Correa P. Is gastric cancer preventable? Gut. 2004;53:1217-1219.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 70]  [Cited by in RCA: 69]  [Article Influence: 3.1]  [Reference Citation Analysis (0)]
5.  Shimoyama T, Fukuda S, Liu Q, Nakaji S, Fukuda Y, Sugawara K. Helicobacter pylori water soluble surface proteins prime human neutrophils for enhanced production of reactive oxygen species and stimulate chemokine production. J Clin Pathol. 2003;56:348-351.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 20]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
6.  Schistosomes , liver flukes and Helicobacter pylori. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Lyon, 7-14 June 1994. IARC Monogr Eval Carcinog Risks Hum. 1994;61:1-241.  [PubMed]  [DOI]
7.  Wong BC, Ching CK, Lam SK. Helicobacter pylori infection and gastric cancer. Hong Kong Med J. 1999;5:175-179.  [PubMed]  [DOI]
8.  Blaser MJ. Linking Helicobacter pylori to gastric cancer. Nat Med. 2000;6:376-377.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 52]  [Cited by in RCA: 45]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
9.  Uemura N, Mukai T, Okamoto S, Yamaguchi S, Mashiba H, Taniyama K, Sasaki N, Haruma K, Sumii K, Kajiyama G. Effect of Helicobacter pylori eradication on subsequent development of cancer after endoscopic resection of early gastric cancer. Cancer Epidemiol Biomarkers Prev. 1997;6:639-642.  [PubMed]  [DOI]
10.  Sung JJY, Lin S-R, Ching JYL, Zhou L–Y, To KF, Wang R–T, Leung WK, NG EKW, Lau JYW, Lee YT. Atrophy and intestinal metaplasia one year after cure of H pylori infection: a prospective, randomized study. Gastroenterology. 2000;119:7-14.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 270]  [Cited by in RCA: 246]  [Article Influence: 9.5]  [Reference Citation Analysis (1)]
11.  Koehler CI, Mues MB, Dienes HP, Kriegsmann J, Schirmacher P, Odenthal M. Helicobacter pylori genotyping in gastric adenocarcinoma and MALT lymphoma by multiplex PCR analyses of paraffin wax embedded tissues. Mol Pathol. 2003;56:36-42.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 50]  [Cited by in RCA: 56]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
12.  Suerbaum S, Michetti P. Helicobacter pylori infection. N Engl J Med. 2002;347:1175-1186.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2125]  [Cited by in RCA: 1896]  [Article Influence: 79.0]  [Reference Citation Analysis (5)]
13.  Covacci A, Telford JL, Del Giudice G, Parsonnet J, Rappuoli R. Helicobacter pylori virulence and genetic geography. Science. 1999;284:1328-1333.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 829]  [Cited by in RCA: 748]  [Article Influence: 27.7]  [Reference Citation Analysis (2)]
14.  Tiwari SK, Khan AA, Ahmed KS, Ali SM, Ahmed I, Habeeb A, Kauser F, Hussain MA, Ahmed N, Habibullah CM. Polymerase chain reaction based analysis of the cytotoxin associated gene pathogenicity island of Helicobacter pylori from saliva: an approach for rapid molecular genotyping in relation to disease status. J Gastroenterol Hepatol. 2005;20:1560-1566.  [PubMed]  [DOI]
15.  Kauser F, Khan AA, Hussain MA, Carroll IM, Ahmad N, Tiwari S, Shouche Y, Das B, Alam M, Ali SM. The cag pathogenicity island of Helicobacter pylori is disrupted in the majority of patient isolates from different human populations. J Clin Microbiol. 2004;42:5302-5308.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 70]  [Cited by in RCA: 72]  [Article Influence: 3.3]  [Reference Citation Analysis (1)]
16.  Covacci A, Falkow S, Berg DE, Rappuoli R. Did the inheritance of a pathogenicity island modify the virulence of Helicobacter pylori? Trends Microbiol. 1997;5:205-208.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 118]  [Cited by in RCA: 92]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
17.  Occhialini A, Marais A, Urdaci M, Sierra R, Muñoz N, Covacci A, Mégraud F. Composition and gene expression of the cag pathogenicity island in Helicobacter pylori strains isolated from gastric carcinoma and gastritis patients in Costa Rica. Infect Immun. 2001;69:1902-1908.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 46]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
18.  Tomasini ML, Zanussi S, Sozzi M, Tedeschi R, Basaglia G, De Paoli P. Heterogeneity of cag genotypes in Helicobacter pylori isolates from human biopsy specimens. J Clin Microbiol. 2003;41:976-980.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 47]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
19.  Li C, Musich PR, Ha T, Ferguson DA, Patel NR, Chi DS, Thomas E. High prevalence of Helicobacter pylori in saliva demonstrated by a novel PCR assay. J Clin Pathol. 1995;48:662-666.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 103]  [Cited by in RCA: 102]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
20.  Ikenoue T, Maeda S, Ogura K, Akanuma M, Mitsuno Y, Imai Y, Yoshida H, Shiratori Y, Omata M. Determination of Helicobacter pylori virulence by simple gene analysis of the cag pathogenicity island. Clin Diagn Lab Immunol. 2001;8:181-186.  [PubMed]  [DOI]
21.  Dixon MF, Genta RM, Yardley JH, Correa P. Classification and grading of gastritis. The updated Sydney System. International Workshop on the Histopathology of Gastritis, Houston 1994. Am J Surg Pathol. 1996;20:1161-1181.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3861]  [Cited by in RCA: 3636]  [Article Influence: 121.2]  [Reference Citation Analysis (7)]
22.  Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P, Borodovsky M, Rappuoli R, Covacci A. cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and diseaseassociated virulence factors. Proc Natl Acad Sci USA. 1996;93:14648-14653.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1462]  [Cited by in RCA: 1367]  [Article Influence: 45.6]  [Reference Citation Analysis (0)]
23.  Jenks PJ, Mégraud F, Labigne A. Clinical outcome after infection with Helicobacter pylori does not appear to be reliably predicted by the presence of any of the genes of the cag pathogenicity island. Gut. 1998;43:752-758.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 91]  [Cited by in RCA: 85]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
24.  Maeda S, Yoshida H, Ikenoue T, Ogura K, Kanai F, Kato N, Shiratori Y, Omata M. Structure of cag pathogenicity island in Japanese Helicobacter pylori isolates. Gut. 1999;44:336-341.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 143]  [Cited by in RCA: 132]  [Article Influence: 4.9]  [Reference Citation Analysis (1)]
25.  Mukhopadhyay AK, Kersulyte D, Jeong JY, Datta S, Ito Y, Chowdhury A, Chowdhury S, Santra A, Bhattacharya SK, Azuma T. Distinctiveness of genotypes of Helicobacter pylori in Calcutta, India. J Bacteriol. 2000;182:3219-3227.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 179]  [Cited by in RCA: 178]  [Article Influence: 6.8]  [Reference Citation Analysis (1)]
26.  Day AS, Jones NL, Lynett JT, Jennings HA, Fallone CA, Beech R, Sherman PM. cagE is a virulence factor associated with Helicobacter pylori-induced duodenal ulceration in children. J Infect Dis. 2000;181:1370-1375.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 59]  [Cited by in RCA: 52]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
27.  Nilsson C, Sillen A, Eriksson L, Strand ML, Enroth H, Normark S, Falk P, Engstrand L. Correlation between cag pathogenicity island composition and Helicobacter pylori-associated gastroduodenal disease. Infect Immun. 2003;71:6573-581.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 82]  [Cited by in RCA: 85]  [Article Influence: 3.7]  [Reference Citation Analysis (0)]
28.  Ahmed N, Khan AA, Alvi A, Tiwari S, Jyothirmayee CS, Kauser F, Ali M, Habibullah CM. Genomic analysis of Helicobacter pylori from Andhra Pradesh, South India: molecular evidence for three major genetic clusters. Current Sci. 2003;85:1579-1586.  [PubMed]  [DOI]
29.  Bamshad M, Fraley AE, Crawford MH, Cann RL, Busi BR, Naidu JM, Jorde LB. mtDNA variation in caste populations of Andhra Pradesh, India. Hum Biol. 1996;68:1-28.  [PubMed]  [DOI]
30.  Backert S, Schwarz T, Miehlke S, Kirsch C, Sommer C, Kwok T, Gerhard M, Goebel UB, Lehn N, Koenig W. Functional analysis of the cag pathogenicity island in Helicobacter pylori isolates from patients with gastritis, peptic ulcer, and gastric cancer. Infect Immun. 2004;72:1043-1056.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 103]  [Cited by in RCA: 100]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
31.  Crabtree JE, Kersulyte D, Li SD, Lindley IJ, Berg DE. Modulation of Helicobacter pylori induced interleukin-8 synthesis in gastric epithelial cells mediated by cag PAI encoded VirD4 homologue. J Clin Pathol. 1999;52:653-657.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 55]  [Cited by in RCA: 45]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
32.  Guillemin K, Salama NR, Tompkins LS, Falkow S. Cag pathogenicity island-specific responses of gastric epithelial cells to Helicobacter pylori infection. Proc Natl Acad Sci USA. 2002;99:15136-15141.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 171]  [Cited by in RCA: 157]  [Article Influence: 6.5]  [Reference Citation Analysis (1)]
33.  Audibert C, Burucoa C, Janvier B, Fauchère JL. implication of the structure of the Helicobacter pylori cag pathogenicity island in induction of interleukin-8 secretion. Infect Immun. 2001;69:1625-1629.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 51]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
34.  Peters TM, Owen RJ, Slater E, Varea R, Teare EL, Saverymuttu S. Genetic diversity in the Helicobacter pylori cag pathogenicity island and effect on expression of anti-CagA serum antibody in UK patients with dyspepsia. J Clin Pathol. 2001;54:219-223.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 31]  [Cited by in RCA: 30]  [Article Influence: 1.2]  [Reference Citation Analysis (1)]
35.  Meining A, Riedl B, Stolte M. Features of gastritis predisposing to gastric adenoma and early gastric cancer. J Clin Pathol. 2002;55:770-773.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 43]  [Cited by in RCA: 38]  [Article Influence: 1.6]  [Reference Citation Analysis (2)]
36.  Ohkuma K, Okada M, Murayama H, Seo M, Maeda K, Kanda M, Okabe N. Association of Helicobacter pylori infection with atrophic gastritis and intestinal metaplasia. J Gastroenterol Hepatol. 2000;15:1105-1112.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 47]  [Article Influence: 1.8]  [Reference Citation Analysis (1)]
37.  Rokkas T, Filipe MI, Sladen GE. Detection of an increased incidence of early gastric cancer in patients with intestinal metaplasia type III who are closely followed up. Gut. 1991;32:1110-1113.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 185]  [Cited by in RCA: 166]  [Article Influence: 4.7]  [Reference Citation Analysis (4)]
38.  Rugge M, Correa P, Dixon MF, Hattori T, Leandro G, Lewin K, Riddell RH, Sipponen P, Watanabe H. Gastric dysplasia: the Padova international classification. Am J Surg Pathol. 2000;24:167-176.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 289]  [Cited by in RCA: 262]  [Article Influence: 10.1]  [Reference Citation Analysis (0)]
39.  Keates S, Keates AC, Warny M, Peek RM, Murray PG, Kelly CP. Differential activation of mitogen-activated protein kinases in AGS gastric epithelial cells by cag+ and cag- Helicobacter pylori. J Immunol. 1999;163:5552-5559.  [PubMed]  [DOI]
40.  Naumann M, Wessler S, Bartsch C, Wieland B, Covacci A, Haas R, Meyer TF. Activation of activator protein 1 and stress response kinases in epithelial cells colonized by Helicobacter pylori encoding the cag pathogenicity island. J Biol Chem. 1999;274:31655-31662.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 127]  [Cited by in RCA: 113]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
41.  Hansson LE, Nyrén O, Hsing AW, Bergström R, Josefsson S, Chow WH, Fraumeni JF, Adami HO. The risk of stomach cancer in patients with gastric or duodenal ulcer disease. N Engl J Med. 1996;335:242-249.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 483]  [Cited by in RCA: 420]  [Article Influence: 14.0]  [Reference Citation Analysis (1)]
42.  Watanabe T, Tada M, Nagai H, Sasaki S, Nakao M. Helicobacter pylori infection induces gastric cancer in mongolian gerbils. Gastroenterology. 1998;115:642-648.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 752]  [Cited by in RCA: 666]  [Article Influence: 23.8]  [Reference Citation Analysis (4)]
43.  Sipponen P, Hyvärinen H, Seppälä K, Blaser MJ. Review article: Pathogenesis of the transformation from gastritis to malignancy. Aliment Pharmacol Ther. 1998;12 Suppl 1:61-71.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 70]  [Cited by in RCA: 65]  [Article Influence: 2.3]  [Reference Citation Analysis (1)]
Footnotes

Co-correspondence: Mahaboob Ali

Science Editor Pravda J and Guo SY Language Editor Elsevier HK

Write to the Help Desk