©The Author(s) 2017.
World J Clin Infect Dis. May 25, 2017; 7(2): 21-31
Published online May 25, 2017. doi: 10.5495/wjcid.v7.i2.21
Published online May 25, 2017. doi: 10.5495/wjcid.v7.i2.21
Table 1 Primers used in RT-PCR of Entamoeba histolytica thioredoxin reductase, peroxiredoxin, FeSOD and 18SrRNA
| S.No. | Primer | Sequence | Tm | Amplicon size | Ref. |
| 1 | Thioredoxin reductase (TrxR) | F-5’GTAATATTCATGATGTTGT3’ | 48 °C | 204 bp | [4] |
| Accession no (EHI_155440) | R-5’CATCATTAATTCATTTTCCA3’ | 48 °C | |||
| 2 | Eh Peroxiredoxin (Prx) | F 5’AAATCAATTGTGAAGTTATTGG3’ | 53.6 °C | 100 bp | [16] |
| R 5’TCCTACTCCTCCTTTACTTTTA3’ | 56.8 °C | ||||
| 3 | FeSOD | F 5’ACAATTACCTTATGCTTATAA3’ | 52 °C | 240 bp | [16] |
| Accession number (XM_643735.2) | F 5’TCCACATCCACACATACAAT3’ | 54 °C | |||
| 4 | Entamoeba histolytica 18s ribosomal RNA gene | F 5’TCAGCCTTGTGACCATACTC3’ | 61.7 °C | 200 bp | [16] |
| F 5’AAGACGATCAGATACCGTCG3’ | 68.9 °C |
- Citation: Iyer LR, Banyal N, Naik S, Paul J. Antioxidant enzyme profile of two clinical isolates of Entamoeba histolytica varying in sensitivity to antiamoebic drugs. World J Clin Infect Dis 2017; 7(2): 21-31
- URL: https://www.wjgnet.com/2220-3176/full/v7/i2/21.htm
- DOI: https://dx.doi.org/10.5495/wjcid.v7.i2.21