©The Author(s) 2020.
World J Gastrointest Oncol. May 15, 2020; 12(5): 535-548
Published online May 15, 2020. doi: 10.4251/wjgo.v12.i5.535
Published online May 15, 2020. doi: 10.4251/wjgo.v12.i5.535
Table 2 Nucleotide primer sequences, PCR conditions, and minor allele frequency for polymorphisms TLR2 -196 to -174 ins/del (rs111200466) and TLR2 19216T/C (rs3804099)
| Genes | Location | MAF | Primers, 5’-3’ | Cycles | T° melting | Enzyme | Genotypes, bp |
| TLR2 -196 to -174 ins/del (rs111200466) | Chromosome 4:153684312-153684338 (intron variant) | 0.1952 (del) | F: CACGGAGGCAGCGAGAAA | 35 | 60 °C | - | ins/ins: 286 bp |
| R: CTGGGCCGTGCAAAGAAG | ins/del: 286 + 264 bp | ||||||
| del/del: 264 bp | |||||||
| TLR2 19216T/C (rs3804099) | Chromosome 4:153703504 (synonymous variant) | 0.4048(C) | F: TCCCTGGGCAGTCTTGAACATTTAG | 30 | 65 °C | TaiI | TT: 415 bp |
| TC: 415 + 109 + 306 bp | |||||||
| R: TGTCCAAATCAGTATCTCGCAGTTCC | CC: 306 + 109 bp |
- Citation: Lourenço CM, Susi MD, Nascimento MCAD, Serafim Junior V, Vila APS, Rodrigues-Flemming GH, Goloni-Bertollo EM, Silva AE, Oliveira-Cucolo JG. Characterization and strong risk association of TLR2 del -196 to -174 polymorphism and Helicobacter pylori and their influence on mRNA expression in gastric cancer. World J Gastrointest Oncol 2020; 12(5): 535-548
- URL: https://www.wjgnet.com/1948-5204/full/v12/i5/535.htm
- DOI: https://dx.doi.org/10.4251/wjgo.v12.i5.535