BPG is committed to discovery and dissemination of knowledge
Case Control Study
©The Author(s) 2020.
World J Gastrointest Oncol. May 15, 2020; 12(5): 535-548
Published online May 15, 2020. doi: 10.4251/wjgo.v12.i5.535
Table 2 Nucleotide primer sequences, PCR conditions, and minor allele frequency for polymorphisms TLR2 -196 to -174 ins/del (rs111200466) and TLR2 19216T/C (rs3804099)
GenesLocationMAFPrimers, 5’-3’CyclesT° meltingEnzymeGenotypes, bp
TLR2 -196 to -174 ins/del (rs111200466)Chromosome 4:153684312-153684338 (intron variant)0.1952 (del)F: CACGGAGGCAGCGAGAAA3560 °C-ins/ins: 286 bp
R: CTGGGCCGTGCAAAGAAGins/del: 286 + 264 bp
del/del: 264 bp
TLR2 19216T/C (rs3804099)Chromosome 4:153703504 (synonymous variant)0.4048(C)F: TCCCTGGGCAGTCTTGAACATTTAG3065 °CTaiITT: 415 bp
TC: 415 + 109 + 306 bp
R: TGTCCAAATCAGTATCTCGCAGTTCCCC: 306 + 109 bp

  • Citation: Lourenço CM, Susi MD, Nascimento MCAD, Serafim Junior V, Vila APS, Rodrigues-Flemming GH, Goloni-Bertollo EM, Silva AE, Oliveira-Cucolo JG. Characterization and strong risk association of TLR2 del -196 to -174 polymorphism and Helicobacter pylori and their influence on mRNA expression in gastric cancer. World J Gastrointest Oncol 2020; 12(5): 535-548
  • URL: https://www.wjgnet.com/1948-5204/full/v12/i5/535.htm
  • DOI: https://dx.doi.org/10.4251/wjgo.v12.i5.535

Write to the Help Desk