Hypermethylated SFRP2 gene in fecal DNA is a high potential biomarker for colorectal cancer noninvasive screening

Table 1 SFRP2 gene primer sequences, annealing temperature and product size for MethyLight assays

CpG status	Forward primer (5’-3’)	Reverse primer (5’-3’)	Annealing temperature (°C)	Product size (bp)
M	GGGTCGGAGTTTTTCGGAGTTGCGC	CCGCTCTCTTCGCTAAATACGACTCG	62	138
U	TTTTGGGTTGGAGTTTTTTGGAGTTGTGT	AACCCACTCTCTTCACTAAATACAACTCA	50	145

M: Methylated; U: Unmethylated.

Table 2 Hypermethylation of SFRP2 in tissue and stool specimens taken from the same patients with colorectal cancer, adenoma, polyp and normal controls

Characteristics	Case (n)	Tissue M1 (%)	χ2	P	Fecal M2 (%)	χ2	P	Sensitivity M2/n	Specificity
Colorectal Cancer	69	63 (91.3)	75.3261	0.0001	60 (87.0)	57.5881	0.0001	87.00%
Age
< 50	20	17 (85.0)	1.410	0.235	16 (80.0)	1.202	0.273
≥ 50	49	46 (93.9)			44 (89.8)
Sex
Male	37	34 (91.9)	0.035	0.852	32 (86.5)	0.016	0.901
Female	32	29 (90.6)			28 (87.5)
TNM stage
I/II	30	27 (90.0)	0.114	0.736	25 (83.3)	0.614	0.433
III/IV	39	36 (92.3)			35 (89.7)
Lymph node status
Positive	27	25 (92.6)	0.093	0.761	24 (88.9)	0.146	0.702
Negative	42	38 (90.5)			36 (85.7)
Infiltration
Mucosa underlayer	21	18 (85.7)	1.188	0.276	17 (81.0)	0.959	0.327
Muscular coat	48	45 (93.8)			43 (89.6)
Tumor site
Rectum	30	27 (90.0)	0.306	0.858	27 (90.0)	0.428	0.786
Left hemicolon	18	17 (94.4)			15 (83.3)
Right hemicolon	21	19 (90.5)			18 (85.7)
Adenoma	34	27 (79.4)	27.5791	0.0001	21 (61.8)	21.0161	0.0001	61.80%
Tubular adenoma	11	8 (72.7)	0.518	0.772	6 (54.5)	0.563	0.755
Villous adenoma	10	8 (80.0)			6 (60.0)
Tubulovillous adenoma	13	11 (84.6)			9 (69.2)
Hyperplastic polyp	26	14 (53.8)	21.5381	0.0001	11 (42.3)	9.9261	0.0021	42.30%	76.80%
Normal control	30	0			2 (6.7)

M1: Hypermethylated SFRP2 in tissue; M2: Hypermethylated SFRP2 in stool.

¹Represents the value of χ² and P vs normal controls. There were significant differences in prevalence of hypermethylated SFRP2 in tissue and stool between cancer and adenoma (χ² = 2.921, P = 0.087 and χ² = 8.606, P = 0.003, respectively) and between cancer and hyperplastic polyp (χ² = 17.253, P < 0.001 and χ² = 19.936, P < 0.001, respectively). However, a significant difference was observed in prevalence of hypermethylated SFRP2 between adenoma and hyperplastic polyp only in tissue (χ² = 4.450, P = 0.035) but not in fecal specimens (χ² = 2.241, P = 0.134).