Increased hepatic expression of nitric oxide synthase type II in cirrhotic rats

Table 1 Oligonucleotides used for PCR

Gene	Quantification method	Primer sequence	cDNA
NOS II	Forward primer	5’-CCCTTCCGAAGTTTCTGGCAGCAG-3’	2793-2817
	Reverse primer	5’-GGGCTCCTCCAAGGTGTTGCCC-3’	3424-3446
	Probe	5’-(FAM)TCTTCGGTGCGGTCTTTTCCTATGGAGCAA(TAMRA)-3’	3391-3421
NOS III	Forward primer	5’-CAAGACCGATTACACGACAT-3’	31-51
	Reverse primer	5’-GCTGGTTGCCATAGTGACAT-3’	300-321
	Probe	5’-(FAM)GAGTGTTTGGACAAGTCCTCACCGCCTTTT-(TAMRA)-3’	158-188
GAPDH	Forward primer	5’-GAAGGTGAAGGTCGGAGTCA-3’
	Reverse primer	5’-GAAGATGGTGATGGGA-3’
	Probe	5’-(JOE)CAAGCTTCCCGTTCTCAGCC(TAMRA)-3’

Table 2 Effects of tetrandrine and on serum NO in cirrhotic rats (μmol/L, mean ± SD)

Grade	Tetrandrine	Cirrhosis	Negative control
	(n = 8)	(n = 8)	(n = 8)
Earlier period	6.51 ± 0.56b	10.27 ± 0.71	5.91 ± 0.67
Metaphase	6.87 ± 0.78b	10.88 ± 0.82	6.04 ± 0.98
Late period	6.49 ± 0.83b	6.35 ± 1.48b	6.17 ± 0.73

^bP < 0.01 vs cirrhosis.

Table 3 Effects of Tetrandrine on NOS activity in cirrhotic rats (mol/min·g, mean ± SD)

Grade	Tetrandrine	Cirrhosis	Negative control
	(n = 8)	(n = 8)	(n = 8)
Earlier period	0.5165 ± 1455a	1.6916 ± 0.8099	0.4275 ± 0.2037
Metaphase	0.6901 ± 0.2092a	1.9756 ± 0.7833	0.5639 ± 0.4275
Late period	0.8483 ± 0.2393a	1.9789 ± 0.7690	0.6723 ± 0.5784

^aP < 0.05 vs cirrhosis.

Table 4 Effects of tetrandrine on hemodynamics in cirrhotic rats (mean ± SD)

Stage	Index	Tetrandrine	Cirrhosis	Negative control
		(n = 8)	(n = 8)	(n = 8)
Earlier period	PVF	18.37 ± 1.83	21.25 ± 1.76	16.50 ± 1.73
	PVP	1.35 ± 0.25b	1.67 ± 0.21	1.18 ± 0.13
	ICVP	0.31 ± 0.04	0.32 ± 0.04	0.31 ± 0.04
	PVR	5.73 ± 0.88	6.38 ± 1.12	5.81 ± 1.04
Metaphase	PVF	14.50 ± 1.61a	20.35 ± 1.07	17.75 ± 1.37
	PVP	1.44 ± 0.13b	1.72 ± 0.69	1.30 ± 0.21
	ICVP	0.32 ± 0.04	0.31 ± 0.04	0.32 ± 0.04
	PVR	7.98 ± 1.68	9.56 ± 1.29	5.53 ± 0.67
Late period	PVF	15.85 ± 1.23	17.57 ± 1.93	15.42 ± 1.27
	PVP	1.45 ± 0.24b	1.67 ± 0.23	1.37 ± 0.10
	ICVP	0.31 ± 0.04	0.32 ± 0.04	0.32 ± 0.04
	PVR	7.44 ± 1.08	8.01 ± 0.79	6.76 ± 0.34

^aP < 0.05,

^bP < 0.01 vs cirrhosis.

Table 5 Quantification of PCR products

Stage	Index	Tetrandrine	Cirrhosis	Negative control
		(n = 8)	(n = 8)	(n = 8)
Earlier period	NOS II	0.1723 ± 0.0014	0.5635 ± 0.0104	-
	NOS III	0.2578 ± 0.0076	0.2694 ± 0.0043	0.2786 ± 0.0107
Metaphase	NOS II	0.1679 ± 0.0093	0.7521 ± 0.0098	-
	NOS III	0.3210 ± 0.0084	0.3412 ± 0.0113	0.2916 ± 0.0089
Late period	NOS II	0.1876 ± 0.0065	0.6987 ± 0.0078	-
	NOS III	0.2917 ± 0.0102	0.3002 ± 0.0091	0.2815 ± 0.0098