©The Author(s) 2003.
World J Gastroenterol. Aug 15, 2003; 9(8): 1762-1766
Published online Aug 15, 2003. doi: 10.3748/wjg.v9.i8.1762
Published online Aug 15, 2003. doi: 10.3748/wjg.v9.i8.1762
Table 1 Oligonucleotide primers used for vacA typing
| Gene and region amplified | Genotype identified | Primer designation | Primer sequence | Size of PCR product(bp) |
| Mid-region | m1/m2 | VAG-F | 5’CAATCTGTCCAATCAAGCGAG3’ | 567/642 |
| VAG-R | 5’GCGTCAAAATAATTCCAAGG3’ | |||
| Signal sequence | s1/s2* | VA1-F | 5’ATGGAAATACAACAAACACAC3’ | 259/286* |
| VA1-R | 5’CTGCTTGAATGCGCCAAAC3’ | |||
| s1a | SS1-F# | 5’GTCAGCATCACACCGCAAC3’ | 190 | |
| s1b | SS3-F# | 5’AGCGCCATACCGCAAGAC3’ | 187 |
-
Citation: Qiao W, Hu JL, Xiao B, Wu KC, Peng DR, Atherton JC, Xue H. cagA and vacA genotype of
Helicobacter pylori associated with gastric diseases in Xi’an area. World J Gastroenterol 2003; 9(8): 1762-1766 - URL: https://www.wjgnet.com/1007-9327/full/v9/i8/1762.htm
- DOI: https://dx.doi.org/10.3748/wjg.v9.i8.1762