Search Article Keyword  
PubMed Submission Abstarct PDF Cited  Click Count: 2238 DownLoad Count: 992 

ISSN 1007-9327 CN 14-1219/R  World J Gastroenterol  2002; June 8(3):400-405

Effects of histone acetylation and DNA methylation on p21WAF1 regulation

Jing-Yuan Fang, You-Yong Lu


Jing-Yuan Fang, Renji Hospital, Shanghai Institute of Digestiv e Disease, Shanghai Second Medical University, Shanghai, China
You-Yong Lu, Beijing Cancer Institute, Beijing University, Bei jing 100000, China
Correspondence to: Jing-Yuan Fang, M.D.,Ph.D. , Shanghai Institute of Digestive Disease, Renji Hospital, 145 Shandong Zhong Ro ad, Shanghai 200001, China. jingyuanfang@yahoo.com
Received 2001-12-04 Accepted 2002-02-07

Abstract
Cell cycle progression is regulated by interactions between cyclins and c yclin- dependent kinases (CDKs). p21WAF1 is one of the CIP/KIP family which inhib its CDKs activity. Increased expression of p21WAF1 may play an important r ole in the growth arrest induced in transformed cells. Although the stability of the p21WAF1 mRNA could be altered by different signals, cell differentiat ion and numerous influencing factors. However, recent studies suggest that two k nown mechanisms of epigenesis, i.e.gene inactivation by methylation in promoter region and changes to an inactive chromatin by histone deacetylation, seem to be the best candidate mechanisms for inactivation of p21WAF1. To date, almos t no coding region p21WAF1 mutations have been found in tumor cells, despi te extensive screening of hundreds of various tumors. Hypermethylation of the p2 1WAF1 promoter region may represent an alternative mechanism by which the p21WAF1/CIP1 gene can be inactivated. The reduction of cellular DNMT prote in levels also induces a corresponding rapid increase in the cell cycle regulato r p21WAF1 protein demonstrating a regulatory link between DNMT and p21 WAF1 which is independent of methylation of DNA. Both histone hyperacetylation and hypoacetylation appear to be important in the carcinoma process, and induct ion of the p21WAF1 gene by histone hyperacetylation may be a mechanism by which dietary fiber prevents carcinogenesis. Here, we review the influence of hi stone acetylation and DNA methylation on p21WAF1 transcription, and affect ion of pathways or factors associated such as p53, E2A, Sp1 as well as sever al histone deacetylation inhibitors.

Fang JY, Lu YY. Effects of histone acetylation and DNA methylation on p21WAF1 regulation.World J Gastroenterol 2002;8(3):400-405

INTRODUCTION
Cell cycle progression is regulated by interactions between cyclins and CDKs [1,2]. Especially, the transition of G1 to S phase is known to be regulate d by a family of negative cell cycle regulators, CDKIs. The latter includes two families, the CIP/KIP family and the INK4 family[3-6]. p21WAF1 is one of the CIP/KIP family[7,8]. Increased expression of p21WAF1 m ay play a crucial role in the growth arrest induced in transformed cells[9 ].
      p21WAF1 was first cloned and characterized as an important effector that a cted to inhibit cyclin-dependent kinase activity in p53 mediated cell cycle arrest induced by DNA damage[10,11]. It has been shown that this is a G C-rich region in the human p21WAF1 promoter[12]. Although the sta bility of the p21WAF1 mRNA could be altered by different signals cell diff erentiation[13] and oxidative stress[14] as well as numerous inf luencing factors including decorin[15], Ras/Raf protein[16], TGF -β[17] and Tax of human T cell leukemia virus type 1(HTLV-1)[18, 19]. However, two known mechanisms of epigenetic modification, gene inactivat ion by methylation in promoter region and changes to an inactive chromatin by hi stone deacetylation, seem to be the best candidate mechanisms for the inactivati on of CIP/KIP family[20]. In this review, we focused on the methylation, histone acetylation and some transcription factor, co-transcription factor ass ociated with acetylation.

DNA METHYLATION AND HISTONE ACETYLATION
The post-translational modifications include acetylation, phosphorylation, meth ylation, ubiquitination and ADP-ribosylation[21]. In mammals, methylati on of the 5' position of cytosine in the CpG dinucleotide sequence is the only n aturally occurring covalent modification of the genome. The enzyme DNA 5-cytosi ne methyltransferase (DNMT) catalyzes the transfer of a methyl group from S -adenosylmethionine to the 5 position of cytosines residing in the dinucleotide sequence CpG[22]. DNA methylation patterns correlate inversely with gen e expression[23] and, therefore, DNA methylation has been suggested to b e an epigenetic determinant of gene expression.
      DNA methylation is believed to be an on-off switch in gene expression, CpG isla nds present in the promoter regions have been shown to be susceptible to hyperme thylation in many cancer cells[24]. CpG islands near promoters and 5' re gulatory region are usually unmethylated in normal somatic cells. In contrast, w idespread methylation of CpG islands occurs in autosomal genes and leads to the silencing of the genes during oncogenic transformation.
      DNA in eukaryotes is packaged with histone and non-histone proteins into chroma tin. In general, regions of chromatin that are hyperacetylated are transcription ally active, whereas regions that are hypoacetylated are silenced. Indeed, a glo bal increase in core histone acetylation does not necessarily induce widespread transcription[25]. Histone acetylation results in charge neutralization and separation of DNA from the histones allowing nucleosomal DNA to become more accessible to transcription factors. Histone acetylation is believed to stabiliz e local nucleosomal structure, thereby allowing transcription factors and the ba sal trancriptional machinery access to DNA. Hyperacetylation of histones has bee n shown to mark open chromatin and to be required for trancriptional activation [26].
      Histone acetylation is a reversible process: histone acetyltransferases (HATs) t ransfer the acetyl moiety from acetyl coenzyme A to the lysine neutralizes the p ositive charge, and histone deacetylases (HDACs) remove the acetyl groups re-es tablishing the positive charge in the histones. At least six human HDAC enzymes exist, and for higher eukaryotes, HDAC1 was first purified using an affinity mat rix based on the deacetylase inhibitor trapoxin[27]. HDAC inhibitor incl ude trichostatin A(TSA)[28,29], trapoxin (TPX) [30], Butyrate[31,32], MS-27-275 (a synthetic benzamide derivative)[33] and Ap icidin[9,34]. Due to the inhibitory effects of the compounds of endogeno us genes that plays significant roles in G1-S progression of the cell cycle, HD AC inhibitors have been considered to be a novel class of cancer treatment agent [34].
      Methylation is not genomically uniform, as unmethylated CpG are found preferenti cally in transcriptionally active chromatin. The highest density of nonmethylated CpG islands, which usually contain promoter or other regulatory DNA that is re quired for active transcription of a gene. CpG island chromatin is enriched in h yperacetylated histones and deficient in linker histones[35]. Recent stu dies have suggested a strong link between histone acetylation, chromatin remodel ing, and gene regulation[26,36,37]. The results from many papers establi shed a link between DNA methylation, histone acetylation and sequence-specific DNA binding activity. In general, CpG island chromatin was found to contain high ly acetylated histone H3 and H4. Deacetylation of histone H3 and H4 by the HDACs presumably leads to the formation of a chromatin environment that inhibits tran scription[38]. Hypoacetylated, transcriptionally silenced regions are of ten methylated[39], Furthermore, methylated DNA is transcriptionally rep ressed, but only under conditions in which the methylated template is assembled into uncleosomal structures[40], methylation density defines the level o f histone acetylation[41]. There are the roles of MeCP2, MBD1, MBD2,and MBD3[35],NuRD (nucleosome-remodeling histone deacetylase)[42,43] and DMAP1[44], as well as DNMT1[44,45] in the linkage of methylation with acetylation.

METHYLATION AND TRANSCRIPTION EXPRESSION OF p21WAF1 GENE
Usually, one could propose the negative regulation of p21WAF1 on the bindi ng of DNMT1 with PCNA in normal cells[46], however the loss of p21WA F1 from PCNA complexes could cause abnormal gains of methylation during repair of DNA damage[47]. Moreover, the p21WAF1 gene transcription level is regulated by methylation, due to that p21WAF1 promoter contains high d ensity of potentially methylatable CpG dinucleotides clustered around the initia tion site of transcription
(Figure 1).

CpG island
-243
CGAGGGACTGGGGGAGGAGGGAAGTGCCCTCCTGCAGCACGCGAGGTT CCGGGACCGGCTGGCCTG CTGGA
ACTCGGCCAGGCTCAGCTGCTCCGCGCTGGGCAGCCAGGAGCCTGGGC CCCGGGGAGGGCGGTCCCGGG
CGGCGCGGTGGGCCGAGCGCGGGTCGCCTCCTTGAGGCGGGCCCGG GCGGGGCGGTTGTATATCAGGGCCG
CGCTGAGCTGCGCCAGCTGAGGTGTGAGCAGCT      G
                                    -1
|→+1
Figure 1(PDF)There are more CpG island at the domain near by the t ranscription start site in the promoter of p21WAF1 gene.

      Dr. Nass et al[48] transfected three antisense DNMT1 (pCMV TMH) into human breast cancer MDA231 cell line, and found that the reduced DNMT1 protein and up-regulation of p21WAF1 suggesting that DNMT protein levels were inv ersely correlated with the level of p21WAF1 in breast cancer cells.To date, almost no coding region p21WAF1 mutations have been found in tumo r cells, despite extensive screening of hundreds of various tumors[49-51]. Hypermethylation of the p21WAF1 promoter region may represent an alter native mechanism by which the p21WAF1/CIP1 gene can be inactivated. DNMT a nd p21WAF1 compete for the same binding site on PCNA, an increase in DNMT expression might promote dissociation of p21WAF1 from PCNA, perhaps making p21WAF1 more susceptible to ubiquitination and proteasome degradation [52]. A decrease in DNMT expression would then be expected to have an opposi te effect on p21WAF1 stability[48]. 5-Azacytidine (5-Aza-C, a demethylating agent) mediated Sp1 expression also up-regulated activities p21WAF1[53].
      Rat-1 is a cell line containing wild-type p53[54]. Allan and co-w orkers found which p21WAF1 5'UTR contains a putative CpG island which is m ethylated in Rat -1 cells that used frequently to assess transformation and for apoptosis studies, the lack of p21WAF1 expression appears to be the resul t of hypermethylation of the p21WAF1 promoter region, as p21WAF1 protein expression could be induced by growth of Rat-1 cells in the presence of 5 -aza-2-deoxycytidine(5-Aza-dC). Furthermore, sequencing analysis of bisulfi te-treated DNA demonstrated extensive methylation of cytosine residues in CpG d inucleotides in a CpG-rich island in the promoter region of the p21WAF1 g ene[55]. A report showed that altered DNA methylation was present in RMS tumors and that the DNA methyltransferase expression is increased in bot h embryonal and alveolar subtypes of this cancer[56,57]. They think that hypermethylation of the p21WAF1 gene at the proximal STAT-binding site, xorrelates with decreased p21WAF1 expression. The p21WAF1 gene is su bjected to methylation regulation at the transcription level and is a target of aberrant methylation in RMS cells.
      However, several studies indicated that the hypermethylation of p21WAF1 wa s not the main machineries of p21WAF1 expression regulation. Although Youn g et al[58] reported that cells arrested and p21WAF1 expressed by DNMT inhibition in normal human fibroblasts. Milutinovic demonstrated that i nhibition of DNMT resulted in the rapid induction of the known tumor suppressor and cell cycle regulator p21WAF1 by a mechanism that did not involve DNA m ethylation of the p21WAF1 promoter, in human non-small cell lung cancer c ell line, A549 cells[59]. The reduction of cellular DNMT protein levels also induced a corresponding rapid increase in the cell cycle regulator p21W AF1 protein demonstrating a regulatory link between DNMT and p21WAF1 whi ch was independent of methylation of DNA[60]. Shin's result showed that the promoter of the p21WAF1 gene was not been methylated in gastric cancer cells. This confirmed that methylation was not the mechanism for inactivation o f p21WAF1 in gastric cancer cells[20]. In adenomatoid polyps, alth ough DNMT1 expression coincided with the expression of other cell proliferation markers, many DNMT1-expressing cells also expressed p21WAF1. The fidelity of DNMT1 expression was further undetermined in colorectal carcinomas, in which a striking heterogeneity in DNMT1 expression, with some carcinoma cells contain ing very high DNMT1 levels and others containing very low DNMT1. These results i ndicate that human colorectal carcinogenesis is accompanied by a progressive dys regulation of DNMT1 expression and suggest that abnormalities in DNMT1 expressio n may contribute to the abnormal CpG dinucleotide methylation which changes the characteristic of human colorectal carcinoma cell DNA[61].

HYPERACETYLATION, HDAC INHIBITORS AND OVEREXPRESSION OF p21 WAF1 GENE
Histone deacetylation is a general mechanism for inactivation of the p21WAF1 in gastric cancer cell lines[20]. Both histone hyperacetylation and hypoacetylation appear to be important in the carcinoma process, and induction o f the p21WAF1 gene by histone hyperacetylation may be a mechanism by which dietary fiber prevents carcinogenesis[31].
      Regarding the correlation of histone acetylation and p21WAF1 gene expression, that HDAC inhibitor TSA, trapoxin, butyrate and apicidin induce p21WAF1 transcriptional activity involved in most studies.
      TSA is originally reported to be a fungistatic antibiotic, and it appears to be a promising tool for analyzing the many functions of histone hyperacetylation in cell proliferation and differentiation. TSA can stimulate p21WAF1 express ion in HT29 cells[32].
      TPX is the microbially derived cyclotetrapeptide[62], Sambucetti found t hat it increased the level of chromatin acetylation associated with histone H3 i n the trapoxin-responsive region of the p21WAF1 promoter, and it activate d p21WAF1 transcription that led to elevated p21WAF1 protein levels in three kinds of human tumor cells. Since the domain of the promoter that is ne cessary for TPX- mediated activation does not contain p53 binding sites, hence p21WAF1 expression upregulation by TPX is independent of p53[3 0].
      Sodium butyrate is a short chain fatty acid produced in the human colon by bacte rial fermentation of carbohydrates[32], causes hyperacetylation of histo ne through the inhibition of HDAC. Three years ago, Archer and his coworkers sho wed firstly the critical importance of p21WAF1 in butyrate-mediated growt h arrest was able to cause growth arrest in the human colon cancer cell line HT -29[31]. Siavoshian[32] suggested that butyrate and TSA stimula ted, the p21WAF1 expression both at the mRNA and protein levels, whereas t hey induced histone H4 hyperacetylation. Butyate sensitivity requires Sp1-3 sit e in conjunction with the Sp1-5 site and Sp1-6[29]. Shin et al [20] indicated that the overexpression of p21WAF1 gene occurred in human gastric cancer cell lines after butyrate treatment. Butyrate increased histo ne H4-acetylation in human melanoma cell lines A375 and S91 and up-regulated p 21WAF1 gene transcription level[63].
      Apicidin is a fungal metabolite shown to exhibit antiparasitic activity by inhib ition of HDAC. Han et al[64] indicated that inhibition of HDAC activ ity by apicidin was closely associated with monorphological change and induction of p21WAF1, although The protein levels of cyclin D1, CDK2, HDAC1 and p 53 were not affected by the addition of apicidin for 24 hrs, whereas the induc tion of p21WAF1 by apicidin was reversible.
      Suberoylanilide hydroxamic acid (SAHA) is a hydroxamic acid-based hybrid polar compound, and it is an inhibitor of HDAC[65,66]. SAHA causes an accumula tion of acrtylated histones H3 and H4 in total cellular chromatin by 2h, which is maintained throughout 24h of culture with increased p21WAF1 expressi on, but no change in chromatin associated with the actin and p27 genes, and SAHA also induces up to a 9-fold increase in p21WAF1 mRNA and protein in T24 bladder carcinoma cells. p21WAF1 by SAHA is regulated, at least in par t, by the degree of acetylation of the gene-associated histones and that this i nduced increase in acetylation is gene selective[66]. These studies also suggest that p21WAF1 is HDAC inhibitor and that the p21WAF1 promote r is a useful model for study in hsitone acetylation regulated transcription.
      In addition, MS-27-275 inhibits HDAC and causes hyperacetylation of histones, as well as induces the expression of p21WAF1 various tumor cell lines [33].
      The data above indicated that the induction of histone hyperacetylation by HDAC inhibitor is responsible for the antiproliferative activity through the crucial
role of p21WAF1 in the regulation of cell cycle.

PATHWAY OR FATORS ASSOCIATED TO ACETYLATION OF p21WAF1
Several genes or transcriptional regulatory proteins including p300/CBP associate to p21WAF1 gene regulation.

p53
The p21WAF1 expression may be dependent[11,67] or independent of p53 regulation[68-70]. Also, the mechanisms of p21WAF1 transc ription regulation fall into two general categories: dependent or independent of the p53 gene[31]. The p21WAF1 promoter contains five natural p53 binding sites, at positions 4001, 3764, 2311, 2276, and 1391,respectivel y (GenBank accession number U24170)[19].
      p53 gene regulates the expression of p21WAF1, and HDAC1,2,and 3 are al l capable of downregulating p53 function, i.e., interactions of p53 and HDAC2 likely result in p53 deacetylation, thereby reducing its transcription al activity[71]. Clark and co-workers found that loss of the G1/S che ckpoint in HIV-1-infected cells may in part be due to Tat's ability to bind p53 and sequester its transactivation activity, as seen in both in vivo an d in vitro transcription assays[72].
      p21WAF1 overexpression has been seen to inhibit two critical checkpoints i n the cell cycle, G1 and G2, through both p53-dependent and -independent[ 74].

p300/CBP
Up to now, four families of nuclear proteins including p300/CBP and p300/CBP-as sociated cofactors contain an intrinsic HAT activity have been confirmed that po ssess HAT activity[74-78].Accumulating evidences suggest that p300 and CBP are adaptors for various DNA-binding transcription factors[79]. Alt hough the precise mechanism by which p300/CBP stimulates transcription remains u nclear, the discovery that p300/CBP and an associated factor P/CAF have histone acetylase activities suggests that these cofactors may regulate transcription th rough acetylation[80]. These activities have been proposed to modify the amino-terminal tails of the core histone ptoteins in a manner that may allow f or some as yet uncharacterized modification of nucleosome structure.
      p300 has been found to be required for induction of p21WAF1 expression in keratinocyte differentiation[70]. Xiao and coworkers indicated the evide nces that p300 is required for TSA-induced, Sp1-mediated p21WAF1 transcr iption: cotransfection of p300 elevated p21WAF1 promoter activity, and thi s elevation was dependent on TSA-responsive GC-box; TSA-induced promoter acti vation was blocked by the introduction of p300 dominant-negative mutant into ce lls; Sp1- or Sp3- mediated activation was also suppressed by this p300 dominan t-negative mutant[28]. Owen et al[81] demonstrated the prog esterone regulated transcription of the p21WAF1 gene through Sp1 and CBP/ p300. A report[82] showed that p21WAF1 stimulated trans-activatio n by p300/CBP, p21WAF1 induction of p300 results from the activity of a di screte domain in the amino-terminal half of the protein which functioned to rep ress transcription. they proposed a model in which p300/CBP activity might switc hed between promoters following p21WAF1 induced cell cycle arrest.

P/CAF and GCN5
Two human homologs of GCN5 have been cloned and shown to have HAT activity[ 83,84]. One homolog is human p300/CBP associated factor (hP/CAF), which is a transcriptional co-activator with intrinsic histone acetylase activity, which c ontributes to transcriptional activation by modifying chromatin and transcriptio nal factors[84,95]. The second family member is hGCN5[85,86 ].The ability of hGCN5 to acetylate nucleosomal histones is significantly re duced relative to its activity on free histones, where it predominantly modifies histone H3 at lysine 14.
      The co-activator/adaptor protein GCN5 is a conserved histone acetyltransferase, which functions as the catalytic subunit in multiple yeast transcriptional regu latory complexes.

E2A
E2A gene encodes two alternatively spliced products, E12 and E47[87,88]. The p21WAF1 promoter contains eight putative E-box consensus sequences, two of which lie between the TATA box and the transcription starting site, E2 an d E1(as Figure 2). E1 binds E47 hetero- and homodimers and E2 has mush less aff inity for E47[89], and it contains a conserved basic region responsible for DNA binding and a helix-loop-helix domain for dimerization[90].

TATA box                                            E Boxes
TATAT CAGGGCCG
CGCTGAGCTGCGCCAGCTG AGGTGTGAGCAGCTGC CGAAGTCAGT
                                E2                            E1            
|→+1

Figure 2
(PDF)The nucleotide sequence of the p21WAF1 promoter from -149 through +1. There are the E1 and E2 binding sites.

E2A plays important roles not only in promoting cellular differentiation but als o in suppressing cells grown[89]. E2A binds to p21WAF1, so the ove rexpression of p21WAF1 may be due to the effects of E2A transcriptional fa ctor[19]. Moreover, the overexpression of E2A proteins, such as E47 has been shown to induce p21WAF1 promoter activity independent of p53 bind ing sites[89].
      Histone H4 but not histone H3 is acetylated from the endogenous p21WAF1 pr omoter in vivo, implying that CBP/p300, and not the SAGA complex is critical in complexing with E2A and upregulation of p21WAF1 in HTLV-1 infected ce lls[19].
      The E3 box located 130 bp upstream from the TATA box also contributes to the act ivation of p21WAF1 expression, but the E4 to E8 boxes have no effect on p2 1WAF1 expression[89]. E2A is shown to be upregulated in HTLV-1 in fected T cells.

Sp1 binding
Sp family of proteins comprise ubiquitous and tissue-restricted transcription f actors that bind GC-rich DNA sequences and other related GT and GA motifs throu gh their zinc-finger domains[91].The ubiquitously expressed and closely related Sp1 and Sp3 factors have been found to regulate the promoters of severa l genes, including cell-cycle regulated genes, with Sp1 defined as a potent coo perative transcriptional activator and Sp3 as weak trans-activator or a repress or[91,92]. Sp1-binding sites appear to play a critical role in the main tenance of the methylation-free CpG island[93].Both Sp1 and Sp3 bind th e promoter of p21WAF1 gene[94].
      The proximal p21WAF1 promoter contains a TATA box[81] and six Sp1 binding sites, also Sp1-1,-2,-3,-4,-5 and -6 near the TATA box[29]. p21WAF1 is Sp1 dependent promoters[95]. The region between -15 4 and transcription starting site contains Sp1-1,-2,-3,-4,-5,-6 binding si tes[20,81]. Sp1 is a sequence-specific transcription factor that recogn izes GGGGCGGGG and closely related sequences, often referred to as GC boxes. To Sp1, at last there are at least three homologous, transcription factors in the S p1 family: Sp2, Sp3 and Sp4[96]. Xiao also reported[28] TSA-ind uced promoter activation was blocked by the introduction of p300 dominant-negat ive mutant into cells. Their result from gel-shift assay[29] showed tha t physical and functional evidence which strongly indicated that both Sp1 and Sp 3 were responsible for TSA-induced transactivation for he murine p21WAF1 promoter in NIH3T3 cells. p21WAF1 gene is one of the natural target s of HDAC inhibitors. Sp1 is a sequence-specific transcription factor that reco gnizes GGGGCGGGG and closely related sequences, often being referred to as GC bo xes. To Sp1 at last there are at least three homologous, transcription factors i n the Sp family: Sp2, Sp3 and Sp4[96].
      The GC-rich region in the six consecutive Sp1 binding sites of the p21WAF1 promoter was digested either with methylation-sensitive Hpa or with me thylation-insensitive Msp. The resulting DNA was subjected to a PCR react ion. Sp1 binding sites are the common elements that exist in the promoters of bo th genes[20]. Using transient reporter gene assays, Pagliuca et al[94] determined that Sp1 was a stroung activator of p21WAF1 promoter , whereas Sp3 functioned as a weak transactivator.

Signal transducers and activators of transcription (STAT)
STAT proteins recognize and bind to the palindromic sequence TTCNNGAA[95]. Such sequences have been identified in the p21WAF1 promoter region at nt -692,-2557 and -4232, and designated as sis-inducible element (SIE)-1, -2 and -3, respectively[97].All three SIEs have been shown to bind STA T1. Chen et al indicated that hypermethylation of p21 gene at the proximal Sis-inducible element (SIE)-1, a STAT-responsive element located upstream of the p21WAF1 CpG 5-Aza-dC, demethylation at SIE-1 reactivated p21 WAF1 expression[98]. STAT could up-regulate activation of cyclin-dep endent kinase inhibitor p21WAF1[98,99].
      In addition to its role in cell cycle regulation, p21WAF1 is also believed to inhibit DNA replication through its ability to bind proliferating cell nucle ar antigen (PCNA), which is required for both replicative DNA synthesis and DNA repair. However, p21WAF1 has no inhibitory effect on the DNA repair functi on of PCNA[100,101]. Thus, p21WAF1may play a central role in preve nting the replication of mutations incurred after exposure of cells to DNA damag e.

CONCLUSIONS
Histone acetylation is the major mechanism for regulation of the p21WAF1 gene in most cell lines (shown as Figure 3). Both histone hyperacetylation and hy poacetylation appear to be important in the carcinoma process. The influence of methylation on p21WAF1 gene expression is dependent on differentiation of cells and tissue. It is our anticipation that induction of the p21WAF1 gen e by histone hyperacetylation may become a mechanism of dietary prevention of ca rcinogenesis.

Figure 3 Butyrate,TSA,TPX and Apicidin inhibits HDAC enzyme ac tivity, and HAT from p300/CBP, P/CAF and GCN5 resulting in histone hyperacetylat ion of H3 or H4 associated p21WAF1 gene, and induces transcriptional activ ation of the p21WAF1 gene.

REFERENCES
1    Norbury C, Nurse P. Animal cell cycles and their control. Ann Rev Biochem 1992; 61: 441-470
2    Marx J. How cells cycle toward cancer. Science 1994; 263: 319-321
3    Elledge SJ, Winston J, Harper JW. A question of balance: the role of cyclin-kinase inhibitors in development and 
      tumorigenesis. Trends Cell Biol 1996; 6: 388-392
4    Sherr CJ, Roberts JM. Inhibitors of mammalian G1 cyclin-dependent kinase. Genes Dev 1995; 9: 1149-1163
5    Hall M, Bates S, Peters G. Evidence for different mode of action of cyclin-dependent kinase inhibitors: p15 and p16
      bind to kinase, p21 and p27 bind to cyclins. Oncogene 1995; 11: 1581-1588
6    Chen J, Saha P, Kornbluth S, Dynlacht BD, Dutta A. Cyclin-binding motifs are essential for the function of p21CIP1.
      Mol Cell Biol 1996; 16: 4673-4682
7    Matsuoka S, Edwards MC, Bai C, Parker S, Zhang P, Baldini A, Harper JW, Elledge SJ. p57KIP2, a structurally distinct 
      member of the p21CIP1 Cdk inhibitor family, is a candidate tumor suppressor gene. Genes Dev 1995; 9: 650-662
8    Polyak K, Lee MH, Erdjument-Bromage H, Koff A, Roberts JM, Tempst P, Massague J. Cloning of p27Kip1, a 
      cyclin-dependent kinase inhibitor and potential mediator of extracellular antimitogenic signals. Cell 1994; 78: 59-66
9    Kim JS, Lee S, Lee T, Lee YW, Trepel JB. Transcriptional activation of p21WAF1/CIP1 by apicidin, a novel histone 
      deacetylase inhibitor. Biochem Biop hy Res Comm 2001; 281: 866-871
10  Gu Y, Turck CW, Morgan DO. Inhibition of CDK2 activity in vivo by an associated 20 Kregulatory subunit. Nature 1993;
      366: 707-710
11  el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parson R, Trent JM, Li n D, Mercer WE, Kinzler KW, Vogelstein B. WAF1,
      a potential medicator of p53 tumor suppression. Cell 1993; 75: 817-825
12  Prowse DM, Bolgan L, Molnar A, Dotto GP. Involvement of the Sp3 transcription factor in induction of p21Cip1/WAF1 in
      keratinocyte differentiation. J Biol Chem 1997; 272:1308-1314
13  Schwaller J, Koeffler HP, Niklaus G, Loetscher P, Nagel S, Fey MF, Tobler A. Posttranscriptional stabilization underlies 
      p53-independent inductio n of p21WAF1/CIP1/SDI1 in differentiating human leukemic cells. J Clin I nvest 1995;95:
      973-979
14  Esposito F, Cuccovillo F, Vanoni M, Cimino F, Anderson CW, Appella E, Russo T. Redox-mediated regulation of 
      p21(waf1/cip1) expression involves a post -transcriptional mechanism and activation of the mitogen-activated protein
      kin ase pathway. Eur J Biochem 1997; 245:730-737
15  Stander M, Naumann U, Wick W, Weller M. Transforming growth factor-(a nd p21: multiple molecular targets of 
      decorin-mediated suppression of neopl astic growth. Cell Tissue Res 1999; 296: 221-227
16  Wang LG, Liu XM, Kreis W, Budman DR. The effect of antimicrotubule age nts on signal transduction pathways of 
      apoptosis: a reviw. Cancer Chemother Ph armacol 1999; 44: 355-361
17  Datto MB, Yu Y, Wang XF. Functional analysis of the transforming growt h factor beta responsive elements in the 
      WAF1/Cip1/p21 promoter. J Biol Chem 1995; 270: 28623-28628
18  Parker SF, Perkins ND, Gitlin SD, Nabel GJ. A cooperative interaction of human T-cell leukemia virus type 1 Tax with the 
      p21 cyclin-dependent kinase inhibitor activates the human immunodeficiency virus type 1 enhancer. J V irol 1996; 
      70:5731-5734
19  de la Fuente C, Santiago F, Chong SY, Deng L, Mayhood T, Fu P, Stein D, Denny T, Coffman F, Azimi N, Mahieux R, 
      Kashanchi F. Overexpression of p21WAF1 in Human T-Cell Lymphotropic Virus Type 1-Infected Cells and Its Association 
      with Cyclin A/cdk2. J Virol 2000; 74: 7270-7283
20  Shin JY, Kim HS, Park J, Park JB, Lee JY. Mechanism for Inactivation o f the KIP Family Cyclin-dependent Kinase Inhibitor 
      Genes in Gastric Cancer Cell s. Cancer Res 2000; 60:262-265
21  Strahl BD, Allis CD. The language of covalent histone modifications. Nature 2000; 403: 41-45
22  Adams RL, McKay EL, Craig LM, Burdon RH. Mouse DNA methylase: methylat ion of native DNA. Biochem. Biophys Acta 
      1979; 561: 345-357
23  Yeivin A, Razin A. Gene methylation patterns and expression. EXS 1993; 64: 523-568
24  Baylin SB, Herman JG, Graff JR, Vertino PM, Issa JP. Alterations in D NA methylation: a fundamental aspect of neoplasia. 
      Adv Cancer Res 1998; 72: 141-196
25  Gu W, Roeder RG. Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell
      1997; 90:595-606
26  Struhl K. Histone acetylation and transcriptional regulatory mechanism a. Genes Dev 1998; 12:599-606
27  Taunton J, Hassig CA, Schreiber SL. A mammalian histone deacety lase related to the yeast transcriptional regulator 
      Rpd3p. Science 1996; 27 2: 408-411
28  Xiao H, Hasegawa T, Isobe K. p300 collaborates with Sp1 and Sp3 in p21 waf1/cip1 promoter activation induced by
      histone deacetylase inhibitor. J Biol Chem 2000; 275:1371-1376
29  Xiao H, Hasegawa T, Isobe K. Both sp1 and sp3 are responsible for p21w af1 promoter actvity induced by histone 
      deacetylase inhibitor in HIH3t3 cells. J Cell Biochem 1999; 73:291-302
30  Sambucetti LC, Fischer DD, Zabludoff S, Kwon PO, Chamberlin H, Trogani N, Xu H, Cohen D. Histone deacetylase
      inhibition selectively alters the activit y and expression of cell cycle proteins leading to specific chromatin acetylatio n
      and antiproliferative effects. J Biol Chem 1999; 274: 34940-34947
31  Archer SY, Hodin RA. Histone acetylation and cancer. Current Opini Gene Devel 1999; 9: 171-174
32  Siavoshian S, Segain JP, Kornprobst M, Bonnet C, Cherbut C, Galmiche J P, Blottiere HM. Butyrate and trichostain A
      effects on the proliferation/differ entiation of human intestinal epithelial cells: induction of cyclin D3 and p 21 expression. 
      Gut 2000; 46:507-514
33  Saito A, Yamashita T, Mariko Y, Nosaka Y, Tsuchiya K, Ando T, Suzuki T , Tsuruo T, Nakanishi O. A synthetic inhibitor of 
      histone deacetylase, MS-27-2 75, with marked in vivo antitumor activity against human tumors. Proc Natl Aca d Sci U S A 
      1999; 96: 4592-4597
34  Vettese-Dadey M, Grant PA, Hebbes TR, Crane- Robinson C, Allis CD, W orkman JL. Acetylation of histone H4 plays a 
      primary role in enhancing transcrip tion factor binding to nucleosomal DNA in vitro. EMBO J 1996; 15:2508-2 518
35  Bird AP, Wolffe AP. Methylation-induced repression-belts, braces, an d chromatin. Cell 1999; 99:451-454
36  Wade PA, Wolffe AP. Histone acetyltransferases in control. Curr Biol 1997; 7: R82-R84
37  Workman JL, Kingston RE. Alteration of nucleosome structure as a mechanism of transcriptional regulation.
      Annu Rev Biochem 1998; 67:545-57 9
38  Ng HH, Zhang Y, Hendrick B, Johnson CA, Turner BM, Erdjument-Bromage H, Tempst P, Reinberg D, Bird A. MBD2 is a 
      transcriptional repressor belonging to the MeCP1 histone deacetylase complex. Nat Genet 1999; 23:58-61
39  Jeppesen P, Turner BM. The inactive X chromosome in female mammals is distinguished by a lack of histone H4 
      acetylation, a cytogenetic marker for gen e expression. Cell 1993;74:281-289
40  Kass SU, Landsberger N, Wolffe AP. DNA methylation directs a time-dep endent repression of transcription initiation.
      Curr Biol 1997;7:157-165
41  Schubeler D, Lorincz MC, Cimbora DM, Telling A, Feng YQ, Bouhassira EE , Groudine M. Genomic targeting of
      methylated DNA: influence of methylation on t ranscription, replication, chromatin structure, and histone acetylation.
      Mol Cell Biol 2000; 20:9103-9112
42  Zhang Y, Ng HH, Erdjument-Bromage H, Tempst P, Bird A, Reinberg D. An alysis of the NuRD subunits reveals a histone 
      deacetylase core complex and a con nection with DNA methylation. Genes Devel 1999;13:1924-1935
43  Wade PA, Gegonne A, Jones PL, Ballestar E, Aubry F, Wolffe AP. Mi-2 c omplex couples DNA methylation to chromatin 
      remodelling and histone deacetylatio n. Nat Genet 1999;23:62-66
44  Rountree MR, Bachman KE, Baylin SB. DNMT1 binds HDAC2 and a new co-re pressor, DMAP1, to form a complex at 
      replication foci. Nat Genet 2000; 25: 269-276
45  Fuks F, Burgers WA, Brehm A, Hughes-Davies L, Kouzarides T. DNA methy latransferase DNMT1 associates with histone 
      deacetylase activity. Nat Genet 2000; 24:88-91
46  Baylin SB. Tying it all together: epigenetics, genetics, cell cycle, a nd cancer. Science 1997; 277: 1948-1949
47  Chuang LS, Ian HI, Koh TW, Ng HH, Xu G, Li BFL. Human DNA-(Cytosine- 5) methyltransferase-PCNA complex as a
      target for p21WAF1. Science 19 97; 277:1996-2000
48  Nass SJ, Ferguson AT, El-Ashry D, Nelson WG, Davidson NE. Expression of DNA methyl-transferase (DMT) and the cell 
      cycle in human breast cancer cells . Oncogene 1999; 18:7453-7461
49  Balbin M, Hannon GJ, Pendas AM, Ferrando AA, Vizoso F, Fueyo A, Lopez -Otin C. Functional analysis of a 
      p21WAF1,CIP1,SDI1 mutant (Arg94Trp) ide ntified in a human breast carcinoma. Evidence that the mutation impairs the 
      abil ity of p21 to inhibit cyclin-dependent kinases. J Biol Chem 1996; 271: 15782-15786
50  Malkowicz SB, Tomaszewski JE, Linnenbach AJ, Cangiano TA, Maruta Y, M cGarvey TW. Novel p21WAF1/CIP1 mutations in
      superficial and invasive trans itional cell carcinomas. Oncogene 1996; 13:1831-1837
51  Shiohara M, el-Deiry WS, Wada M, Nakamaki T, Takeuchi S, Yang R, Chen DL, Vogelstein B, Koeffler HP. Absence of 
      WAF1 mutations in a variety of human malignancies. Blood 1994; 84: 3781-3784
52  Maki CG, Howley PM. Ubiquitination of p53 and p21 is different ially affected by ionizing and UV radiation.
      Mol Cell Biol 1997; 17: 355-36 3
53  Periyasamy S, Ammanamanchi S, Tillekeratne MP, Brattain MG. Repression of transforming growth factor-beta receptor 
      type I promoter expression by Sp1 deficiency. Oncogene 2000; 19: 4660-4667
54  Ling CC, Guo M, Chen CH, Deloherey T. Radiation-induced apoptosis:eff ects of cell age and dose fractionation.
      Cancer Res 1995; 55: 5207-5212
55  Allan LA, Duhig T, Read M, Fried M. The p21WAF1/CIP1 Promoter Is Methylated in Rat-1 Cells: Stable Restoration of 
      p53-Dependent p21WAF 1/CIP1 Expression after Transfection of a Genomic Clone Containing the p21 WAF1/CIP1 Gene.
      Mol Cell Biol 2000; 20:1291-1298
56  Chen B, He L, Savell VH, Jenkins JJ, Parham DM. Inhibition of the interferon-(/signal transducers and activators of 
      transcription (STST) pathway by h ypermethylation at a STST-binding site in the p21WAF1 promoter region. Cancer Res 
      2000; 60:3290-3298
57  Chen B, Liu X, Savell VH, Dilday BR, Johnson MW, Jenkins JJ, Parham DM . Increased DNA methyltransferase expression
      in rhabdomyosarcomas. Int J Cance r 1999; 83: 10-140
58  Young JI, Smith JR. DNA methltransferase inhibition in normal human fibroblasts induces a p21-dependent cell cycle 
      withdrawal. J Biol Chem 2 001; 276: 19610-19616
59  Milutinovic S, Knox JD, Szyf M. DNA methyltransferase inhibition induc es the transcription of the tumor suppressor
      p21WAF1/CIP1/sdi1. J Biol C hem 2000; 275: 6353-6359
60  Fournel M, Sapieha P, Beaulieu N, Besterman JM, MacLeod AR. Down-regu lation of human DNA-(cytosine-5) 
      methyltransferase induces cell cycle regulato rs p16ink4A and p21WAF1/Cip1 by distinct mechanisms. J Biol Chem 1999;       274: 24250-24256
61  De Marzo AM, Marchi VL, Yang ES, Veeraswamy R, Lin X, Nelson WG. Abnor mal Regulation of DNA Methyltransferase 
      Expression during Colorectal Carcinogene sis. Cancer Res 1999; 59: 3855-3860
62  Itazaki H, Nagashima K, Sugita K, Yoshida H, Kawamura Y, Yasuda Y. Iso lation and structural elucidation of new 
      
      cyclotetrapeptides, trapoxins A and B, having detransformation activities as antitumor agents. J Antibiot 1990; 12: 
      1524-1532
63  Demary K, Wong L, Spanjaard RA. Effects of retinoic acid and sodium bu tyrate on gene expression, histone acetylation 
      and inhibitor of proliferation of melanoma cells. Cancer Lett 2001; 163:103-107
64  Han JW, Ahn SH, Park SH, Wang YS, Bae GU, Seo DW, Kwon HK, Hong S, Lee HY, Lee YW, Lee HW. Apicidin, a Histone
      deacetylase inhibitor, inhibits prolife ration of tumor cells via induction of p21WAF1/Cip1 and Gelsolin. Cancer Res 
      2000;60:6068-6074
65  DiGiuseppe JA, Weng LJ, Yu KH, Fu S, Kastan MB, Samid D, Gore SD. Phen ylbutyrate-induced G1 arrest and apoptosis in 
      myeloid leukemia cells: structure -function analysis. Leukemia 1999; 13: 1243-1253
66  Richon VM, Sandhoff TW, Rifkind RA, Marks PA. Histone deacetyla se inhibitor selectively induces p21WAF1 expression
      and gene-associated h istone acetylation. Proc Natl Acad Sci U S A 2000; 97:10014-10019
67  el-Deiry WS, Tokino T, Waldman T, Oliner JD, Velculescu VE, Burrell M, Hill DE, Healy E, Rees JL, Hamilton SR.
      Topological control of p21WAF1/C IP1 expression in normal and neoplastic tissues. Cancer Res 1995; 55:2910 -2919
68  Halevy O, Novitch BG, Spicer DB, Skapek SX, Rhee J, Hannon GJ, Beach D , Lassar ABl. Correlation of terminal cell cycle 
      arrest of skeletal muscle with induction of p21 by MyoD. Science 1995; 267: 1018-1021
69  Parker SB, Eichele G, Zhang P, Rawla A, Sands AT, Bradley A, Ol son EN, Harper JW, Elledge SJ. p53-independent 
      expression of p21Cip in musc le and other terminally differentiating cells. Science 1995; 67: 1024-1027
70  Missero C, Calautti E, Eckner R, Chin J, Tsai LH, Livingston DM, Dotto GP. Involvement of the cell-cycle inhibitor
      Cip1/WAF1 and the E1A-associated p300 protein in terminal differentiation. Proc Natl Acad Sci U S A 1995; 92:
      5451-5455
71  Juan LJ, Shia WJ, Chen MH, Yang WM, Seto E, Lin YS, Wu CW. Histone dea cetylases specifically down-regulate 
      p53-dependent gene activaiton. J Bi ol Chem 2000;275: 20436-20443
72  Clark E, Santiago F, Deng L, Chong S, de la Fuente C, Wang L, Fu P, St ein D, Denny T, Lanka V, Mozafari F, Okamoto T,
      Kashanchi F. Loss of G1/S Checkp oint in Human Immunodeficiency Virus Type 1-Infected Cells Is Associated with a Lack 
      of Cyclin-Dependent Kinase Inhibitor p21/Waf1. J Virol 2000; 74: 504 0-5052
73  Macleod KF, Sherry N, Hannon G, Beach D, Tokino T, Kinzler K, Vogelste in B, Jacks T. p53-dependent and independent 
      expression of p21 during c ells growth, differentiation, and DNA damage. Genes Dev 1995; 9: 935-944
74  Bannister AJ, Kouzarides T. The CBP (CREB binding protein) co-activat or is a histone acetylatransferase. Nature 1996; 
      384: 641-643
75  Parekh BS, Maniatis T. Virus infection leads to localized hyperacetyl ation of histones H3 and H4 at the IFN-β promtoer.
      Mol Cell 1999; 3: 125- 129
76  Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfel d MG. The transcriptional co-activator p/CIP
      binds CBP and medicates nuclear-r eceptor function. Nature 1997; 387:677-684
77  Yang X, Herrmann CH, Rice AP. The human immunodeficiency virus Tat proteins specifically associate with TAK in vivo
      and require the carboxy -terminal domain of RNA polymerase II for function. J Virol 1996; 70:4576- 4584
78  Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y. The transc riptional coactivators p300 and CBP are histone
      acetyltransferases. Cell 199 6; 87: 953-959
79  Janknecht R, Hunter T. Transcription. A growing coactivator network. Nature 1996; 383:22-23
80  Martinez-Balbas MA, Bauer UM, Nielsen SJ, Brehm A, Kouzarides T. Regu lation of E2F1 activity by acetylation.
      EMBO J 2000; 19:662-671
81  Owen GI, Richer JK, Tung L, Takimoto G, Horwitz. Progesteron regulates transcrition of the p21WAF1 cyclin-dependent 
      kinase inhibitor gene throu gh Sp1 and CBP/p300. J Biol Chem 1998; 273: 10696-10701
82  Snowden AW, Anderson LA, Webster GA, Perkins ND. A novel transcriptio nal repression domain mediates p21WAF1/CIP1
      induction of p300 transctivati on. Mol Cell Biol 2000; 20: 2676-2686
83  Candau R, Moore PA, Wang L, Barlev N, Ying CY, Rosen CA, Berger SL. Id entification of human proteins functionally 
      conserved with the yeast putative ad aptors ADA2 and GCN5. Mol Cell Biol 1996; 16: 593-602
84  Yang XJ, Ogryzko VV, Nishikawa J, Howard BH, Nakatani Y. A p300/CBP- associated factor that competes with the 
      adenoviral oncoprotein E1A. Nature 1996; 382: 319-324
85  Schiltz RL, Nakatani Y. The PCAF acetylase complex as a potential tumo r suppressor. Biochim. Biophys. Acta 2000;
      1470: M37-M53
86  Smith ER, Belote JM, Schiltz RL, Yang XJ, Moore PA, Berger SL, Nakatani Y, Allis CD. Cloning of Drosophila GCN5: 
      conserved features among metaz oan GCN5 family members.Nucleic Acids Res 1998;26:2948-2954
87  Mahajan MA, Park ST, Sun XH. Association of a novel GTP-bindin g protein, DRG, with TAL oncogenic proteins.
      Oncogene 1996; 12: 2343-2350
88  Peverali FA, Ramqvist T, Saffrich R, Pepperkok R, Barone MV, Phillips on L. Regulation of G1 progression of E2A and Id 
      helix- loophelix proteins. EM BO J 1994; 13: 4291-4301
89  Prabhu S, Ignatova A, Park ST, Sun XH. Regulation of the expression of cyclin-dependent kinase inhibitor p21 by E2A
      and Id proteins. Mol Cell Biol 1997; 17: 5888-5896
90  Murre C, McCaw PS, Baltimore D. A new DNA binding and dimerization mot if in immunoglobin enhancer binding, 
      daughterless, MyoD and myc proteins. Cell 1989; 56:777-783
91  Lania L, Majello B, De Luca P. Transcriptional regulation of the Sp fa mily proteins. Int J Biochem Cell Biol 1997; 
      29:1313-1323
92  Birnbaum MJ, van Wijnen AJ, Odgren PR, Last TJ, Suske G, Stein GS, St ein JL. Sp1 trans-cativation of cell cycle regulated 
      promoters is selectively r epressed by Sp3. Biochem 1995; 34: 16503-16508
93  Brandeis M, Frank D, Keshet I, Siegfried Z, Medelsohn M, Nemes A, Temp er V, Razin A, Cedar H. Sp1 elements protect
      a  CpG island from de novo methylati on. Nature 1994; 371: 435-438
94  Pagliuca A, Gallo P, Lania L. Differentical role for Sp1/Sp3 transcrip tion factors in the regulation of the promoter activity
      of multiple cyclin-depe ndent kinase inhibitor genes. J Cell Biochem 2000; 76: 360-367
95  Periyasamy S, Ammanamanchi S, Tillekeratne MP, Brattain MG. Repressio n of transforming growth factor-beta
      receptor type I promoter expression by Sp1 deficiency. Oncogene 2000;19:4660-4667
96  Hagen G, Muller S, Beato M, Suske G. Cloning by recognition site scree ning of two novel GT box binding proteins:A
      family of Sp1 related genes. Nucle ar Acids Res 1992; 20:5519-5525
97  Horvath CM, Wen Z, Darnell JE Jr. A STAT protein domain that determin es DNA sequence recognition suggests a novel
      DNA-binding domain. Genes Dev 1995; 9: 984-994
98  Chin YE, Kitagawa M, Su WC, You ZH, Iwamoto Y, Fu XY. Cell growth arre st and induction of cyclin-dependent kinase 
      inhibitor p21 WAF1/CIP1 mediated by STAT1. Science 1996; 272: 719-722
99  Darnell JE, Jr. STSTs and gene regulation. Science 1997; 277:1630 -1635
100 Li R, Waga S, Hannon GJ, Beach D, Stillman B. Differential e ffects by the p21 CDK inhibitor on PCNA-dependent DNA 
      replication and repair. Nature 1994; 371:534-537
101 Waga S, Hannon GJ, Beach D, Stillman B. The p21 inhibitor of cycl in-dependent kinases controls DNA replication by 
      interaction with PCNA. Natur e 1994; 369:574-578

Edited by Wu XN

 

Reviews Add
more>>


Related Articles:
more>>